Application of TNFRSF13B gene in regulating and controlling adaptive capacity of Hu sheep to drought environment

Abstract

The invention provides application of a TNFRSF13B gene in regulating and controlling the adaptive capacity of Hu sheep to a drought environment, and belongs to the technical field of molecular breeding. The invention provides an application of a TNFRSF13B gene in regulating and controlling the adaptive capacity of Hu sheep to a drought environment. Reduction of TNFRSF13B gene expression leads to enhancement of lipid synthesis capability and glucose uptake capability of Hu sheep liver cells and reduction of lipid decomposition capability, and after Hu sheep is introduced into the Hetian region in the arid region and the Taihu Lake region, in order to well adapt to local climatic environment, the Hu sheep becomes smaller in body form and is also improved in lipid synthesis capability, the Hu sheep is reduced in lipid decomposition capability. Therefore, in order to adapt to the drought environment, the TNFRSF13B gene has high methylation and low expression and participates in a signal channel of energy metabolism, and reference is provided for improving the ability of sheep to adapt to the drought environment.

Description

Technical Field

[0001] The invention belongs to the technical field of molecular breeding, and in particular relates to the application of the TNFRSF13B gene in regulating the adaptability of Hu sheep to arid environments. Background Art

[0002] The Hu sheep, a local breed of sheep with white lamb fur, exhibits excellent adaptability to arid climates. Currently, there are relatively few reports on the Hu sheep's adaptability and resistance to drought. Summary of the Invention

[0003] The purpose of the present invention is to provide an application of the TNFRSF13B gene in regulating the adaptability of Hu sheep to arid environments.

[0004] The present invention provides an application of the TNFRSF13B gene in regulating the adaptability of Hu sheep to a drought environment. The CDS sequence of the TNFRSF13B gene is shown in SEQ ID NO.1.

[0005] In the specific implementation process of the present invention, the application includes the application of negatively regulating the TNFRSF13B gene in improving the adaptability of Hu sheep to arid environments; the negative regulation includes knockdown or knock-down.

[0006] The present invention also provides the use of a reagent for negatively regulating the TNFRSF13B gene in improving the adaptability of Hu sheep to arid environments. The CDS sequence of the TNFRSF13B gene is shown in SEQ ID NO.1.

[0007] In the specific implementation process of the present invention, the reagent for negatively regulating the TNFRSF13B gene includes an siRNA precursor oligonucleotide of the TNFRSF13B gene; the siRNA precursor oligonucleotide of the TNFRSF13B gene includes at least one of siTNFRSF13B-1, siTNFRSF13B-2 and siTNFRSF13B-3; the nucleotide sequences of siTNFRSF13B-1, siTNFRSF13B-2 and siTNFRSF13B-3 are shown in SEQ ID NO.2 to SEQ ID NO.4, respectively.

[0008] The present invention also provides an application of the TNFRSF13B gene in regulating Hu sheep hepatocytes, wherein the CDS sequence of the TNFRSF13B gene is shown in SEQ ID NO.1;

[0009] The regulation of Hu sheep hepatocytes includes at least one of the following:

[0010] 1) Regulate the proliferation activity of Hu sheep hepatocytes;

[0011] 2) Regulate the cell cycle of Hu sheep liver;

[0012] 3) Regulate apoptosis of liver cells in Hu sheep;

[0013] 4) Regulate the lipid synthesis capacity of Hu sheep hepatocytes;

[0014] 5) Regulate the glucose uptake capacity of Hu sheep hepatocytes;

[0015] The CDS sequence of the TNFRSF13B gene is shown in SEQ ID NO.1.

[0016] In the specific implementation of the present invention, the application includes at least one of the following:

[0017] 1) Application of negative regulation of TNFRSF13B gene in improving the proliferation activity of Hu sheep hepatocytes;

[0018] 2) Application of negatively regulating the TNFRSF13B gene to reduce the proportion of cells in the G0 / G1 phase and / or increase the proportion of cells in the S phase of Hu sheep hepatocytes;

[0019] 3) Application of negative regulation of TNFRSF13B gene in inhibiting apoptosis of Hu sheep hepatocytes;

[0020] 4) Application of negative regulation of TNFRSF13B gene in improving lipid synthesis capacity of hepatocytes;

[0021] 5) Application of negative regulation of TNFRSF13B gene in improving the glucose uptake capacity of Hu sheep hepatocytes.

[0022] The present invention also provides an application of the TNFRSF13B gene in regulating apoptosis-related genes in Hu sheep. The CDS sequence of the TNFRSF13B gene is shown in SEQ ID NO.1.

[0023] In the specific implementation process of the present invention, the application includes the application of negatively regulating the TNFRSF13B gene in positively regulating the expression of the BCL2 gene; or, the application includes the application of negatively regulating the TNFRSF13B gene in negatively regulating the expression of the BAX gene, P53 gene and / or CASP3 gene; the NCBI GenBank accession numbers of the BCL2 gene, BAX gene, P53 gene and CASP3 gene are: GeneID: 101119602, GeneID: 443059, GeneID: 443421, GeneID: 443031, respectively.

[0024] The present invention also provides an application of the TNFRSF13B gene in regulating genes related to liver cell metabolism in Hu sheep. The CDS sequence of the TNFRSF13B gene is shown in SEQ ID NO.1.

[0025] In the specific implementation process of the present invention, the application includes the application of negatively regulating the TNFRSF13B gene in positively regulating the expression of the GLUT4 gene and / or the PPARG gene; or, the application includes the application of negatively regulating the TNFRSF13B gene in negatively regulating the expression of the LPL gene; the NCBI GenBank accession numbers of the GLUT4 gene, PPARG gene and LPL gene are: GeneID: 442992, GeneID: 443513, GeneID: 443408, respectively.

[0026] The present invention provides an application of the TNFRSF13B gene in regulating the adaptability of Hu sheep to arid environments. The CDS sequence of the TNFRSF13B gene is shown in SEQ ID NO.1. The present application excavated the TNFRSF13B gene through transcriptome and whole genome methylation methods. After interfering with the expression of the TNFRSF13B gene in Hu sheep hepatocytes using the siRNA precursor oligonucleotide sequence of the TNFRSF13B gene, the apoptosis-related gene BCL2 gene (encoding an anti-apoptotic protein) was significantly overexpressed (P<0.05). BCL2 inhibits the permeability of the mitochondrial outer membrane, prevents the release of pro-apoptotic factors (such as cytochrome C), and thus prevents the transmission of apoptosis signals; the expression levels of GLUT4 and PPARG genes related to liver cell metabolism were significantly higher than those in the control group (P<0.0 5), the gene and protein expression levels of LPL were significantly lower than those in the control group (P<0.05), indicating that the decreased expression of TNFRSF13B gene led to the enhanced lipid synthesis and glucose uptake capacity of liver cells of Hu sheep, and the decreased lipid decomposition capacity. Hotan area is an arid area. After the Hu sheep from Taihu area were introduced into Hotan area, in order to adapt well to the local climate environment, the Hu sheep became smaller and their lipid synthesis capacity also increased. This shows that in order to adapt to the arid environment, the TNFRSF13B gene of Hu sheep was highly methylated and lowly expressed, and participated in the signal pathway of energy metabolism, which provides a reference for improving the ability of sheep to adapt to arid environment. BRIEF DESCRIPTION OF THE DRAWINGS

[0027] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the following briefly introduces the drawings required for use in the embodiments. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying any creative work.

[0028] Figure 1 Represents the interactions between 38 gene hub proteins;

[0029] Figure 2This is a graph showing the difference in expression of metabolism-related genes in Hu sheep from different regions (Taihu area and Hotan area);

[0030] Figure 3 This is the result of immunofluorescence identification of liver cells of Hu sheep;

[0031] Figure 4 This is the result of glycogen staining identification of Hu sheep liver cells;

[0032] Figure 5 The graph shows the expression of TNFRSF13B gene mRNA in Hu sheep hepatocytes 48 hours after transfection with siRNA;

[0033] Figure 6 This is the result diagram of the effect of TNFRSF13B gene on the proliferation of Hu sheep liver cells;

[0034] Figure 7 This is a diagram of apoptosis in liver cells of Hu sheep after interference with TNFRSF13B gene;

[0035] Figure 8 The expression results of apoptosis-related genes and proteins in Hu sheep hepatocytes after interference with the TNFRSF13B gene are shown in the figure below. The left figure shows the expression of apoptosis-related genes, and the right figure shows the expression of apoptosis-related proteins. PC represents the control group, and SI represents the interference group.

[0036] Figure 9 The results of the expression of genes and proteins related to liver cell metabolism in Hu sheep after interference with the TNFRSF13B gene are shown in the figure below. The left figure shows the expression of genes related to liver cell metabolism, and the right figure shows the expression of proteins related to liver cell metabolism. PC represents the control group, and SI represents the interference group. DETAILED DESCRIPTION

[0037] The present invention provides the application of the TNFRSF13B gene in regulating the adaptability of Hu sheep to arid environments. The CDS sequence of the TNFRSF13B gene is as shown in SEQ ID NO.1, Gene ID: 101122200, specifically: gggggctgacaccactctag gggctgggac ctcagggccc aaacctcaca cgcacatgtggacagtggag ccatcttgctggaacattcc gtctggctga gtaattccacctaaggaactcaagccttag caggagacac agaaaagccccacagggccc gcggcggggggtggccatggagccctgccc ggaagagcag tactgggact cgctgctgaacacctgcgtctcctgcaaacccatctgcag cagccagatt ccgcgcacct gtgcggccttctgcaagtcactcagttgccgcgaagagca aggcaggtac tatgacctgc tcctgagggactgcatcagctgtgcctccatctgcggacg tcaccccaag cagtgcacac actactgtgagaagacgctgaggagccaagtgagcctcct accagagttc aggagacagc gggccggagaggccccgacccgagcagacaccctggggaa gcaccaggtg ccagagcaca gaggcttggatgcgggtccagcgcctgcagggctgaagct gagcgctgac cagctggccc tggtctacagcacgctgggcctatgtctctgtgccatcgt ctgctgcttc ctgctggccg tggcctgctt cctcaagaggaggggggtccaggtctccttcccgacccgc ccagggccgt gtcccacgca ggccaaggcctccaaggatgattggatgga agccggccgcgtggcaggga cgcctcccga gccagtggagacttgtagcttctgcttccc ggagtgcagg gcgcccacccaggagagtgc aggcgcgcccccgacacccgtgtccgagcg cacagggaggagggcgagcc aggaacagagagcagccggacagccctgcgtgcgcgctgc gaacggcggg atcgaggtgg tgtacacaccagcgcaggaaggaggcctggccacgtgaac ctgggggaat ggtcaccgtc acctcaacgcacctgcggtaaaggcaccacccctgctgga ctcagccccg gggccccttg gcggaaataa aacctcccacactgcccgctc.

[0038] In the present invention, the TNFRSF13B gene is associated with Hu sheep metabolism and is a candidate gene for Hu sheep drought adaptation. After the TNFRSF13B gene was disrupted, the BCL2 gene, a gene related to cell apoptosis, was significantly overexpressed, as were the GLUT4 and PPARG genes related to liver cell metabolism, while the LPL gene was underexpressed. After the TNFRSF13B gene was disrupted, the activity of Hu sheep cells was enhanced, and the liver's lipid synthesis capacity was enhanced, both of which are manifestations of adaptation to drought environments, and thus, they can better adapt to the environment of the Xinjiang Uyghur Autonomous Region.

[0039] In the present invention, the BCL2 gene is a gene encoding an anti-apoptotic protein. BCL2 inhibits the permeability of the mitochondrial outer membrane, prevents the release of pro-apoptotic factors (such as cytochrome C), and thus prevents the transmission of apoptotic signals. It binds to pro-apoptotic proteins (such as BAX) to prevent them from forming pores on the mitochondrial outer membrane and protects cells from apoptosis when responding to external stimuli (such as stress, DNA damage, etc.).

[0040] The expression level of TNFRSF13B in the liver cells of Hu sheep in the Hotan area was significantly lower than that in the Hu sheep in the Taihu area, and the TNFRSF13B gene was highly methylated, indicating that the liver metabolic function of Hu sheep in the arid Hotan area had changed.

[0041] In the specific implementation process of the present invention, the application includes the application of negatively regulating the TNFRSF13B gene in improving the adaptability of Hu sheep to arid environments; the negative regulation includes knockdown or knock-down.

[0042] In the specific implementation of the present invention, the application also includes the use of the TNFRSF13B gene as a target gene in the preparation of preparations related to the environment in which Hu sheep are not adapted. In the specific implementation of the present invention, the relevant preparations include but are not limited to at least one of relevant vaccines, detection preparations and gene drugs.

[0043] The present invention also provides the use of a reagent for negatively regulating the TNFRSF13B gene in improving the adaptability of Hu sheep to arid environments. The CDS sequence of the TNFRSF13B gene is shown in SEQ ID NO.1.

[0044] In the specific implementation process of the present invention, the reagent for negatively regulating the TNFRSF13B gene includes an siRNA precursor oligonucleotide of the TNFRSF13B gene; the siRNA precursor oligonucleotide of the TNFRSF13B gene includes at least one of siTNFRSF13B-1, siTNFRSF13B-2 and siTNFRSF13B-3, and further siTNFRSF13B-2, siTNFRSF13B-2 has the highest interference efficiency; the nucleotide sequences of the siTNFRSF13B-1, siTNFRSF13B-2 and siTNFRSF13B-3 are shown in SEQ ID NO.2 to SEQ ID NO.4, respectively.

[0045] The present invention also provides an application of the TNFRSF13B gene in regulating Hu sheep hepatocytes, wherein the CDS sequence of the TNFRSF13B gene is shown in SEQ ID NO.1;

[0046] The regulation of Hu sheep hepatocytes includes at least one of the following:

[0047] 1) Regulate the proliferation activity of Hu sheep hepatocytes;

[0048] 2) Regulate the cell cycle of Hu sheep liver;

[0049] 3) Regulate apoptosis of liver cells in Hu sheep;

[0050] 4) Regulate the lipid synthesis capacity of Hu sheep hepatocytes;

[0051] 5) Regulate the glucose uptake capacity of Hu sheep hepatocytes;

[0052] The CDS sequence of the TNFRSF13B gene is shown in SEQ ID NO.1.

[0053] In the specific implementation of the present invention, the application includes at least one of the following:

[0054] 1) Application of negative regulation of TNFRSF13B gene in improving the proliferation activity of Hu sheep hepatocytes;

[0055] 2) Application of negatively regulating the TNFRSF13B gene to reduce the proportion of cells in the G0 / G1 phase and / or increase the proportion of cells in the S phase of Hu sheep hepatocytes;

[0056] 3) Application of negative regulation of TNFRSF13B gene in inhibiting apoptosis of Hu sheep hepatocytes;

[0057] 4) Application of negative regulation of TNFRSF13B gene in improving lipid synthesis capacity of hepatocytes;

[0058] 5) Application of negative regulation of TNFRSF13B gene in improving the glucose uptake capacity of Hu sheep hepatocytes.

[0059] In the present invention, after interfering with the TNFRSF13B gene, the cell proliferation activity of Hu sheep hepatocytes was significantly enhanced.

[0060] In the present invention, after interfering with the TNFRSF13B gene, the proportion of G0 / G1 phase cells in liver cells decreased, the proportion of S phase cells in Hu sheep liver cells increased, and the proportion of G2 phase cells did not change significantly; among them, the G0 / G1 phase is the cell resting phase and the early stage of DNA synthesis, and the S phase is the DNA synthesis phase.

[0061] In the present invention, after interfering with the TNFRSF13B gene, the apoptosis rate of liver cells in Hu sheep was significantly reduced.

[0062] In the present invention, after interfering with the TNFRSF13B gene, the BCL2 gene was significantly highly expressed in the liver cells of Hu sheep, while the expression levels of BAX, P53 and CASP3 genes were relatively reduced.

[0063] In the present invention, after interfering with the TNFRSF13B gene, the expression levels of the sugar metabolism-related gene GLUT4 and the lipid synthesis-related gene PPARG gene and their proteins in the liver cells of Hu sheep were significantly higher than those in the control group, and the expression levels of the lipid catabolism-related gene LPL gene and its protein were significantly reduced, indicating that the reduction in TNFRSF13B gene expression led to an increase in the lipid synthesis ability and glucose uptake ability of the liver cells of Hu sheep, and a decrease in the lipid decomposition ability.

[0064] The present invention also provides an application of the TNFRSF13B gene in regulating apoptosis-related genes in Hu sheep. The CDS sequence of the TNFRSF13B gene is shown in SEQ ID NO.1.

[0065] In the specific implementation process of the present invention, the application includes the application of negatively regulating the TNFRSF13B gene in positively regulating the expression of the BCL2 gene; or, the application includes the application of negatively regulating the TNFRSF13B gene in negatively regulating the expression of the BAX gene, P53 gene and / or CASP3 gene; the NCBI GenBank accession numbers of the BCL2 gene, BAX gene, P53 gene and CASP3 gene are: GeneID: 101119602, GeneID: 443059, GeneID: 443421, GeneID: 443031, respectively.

[0066] The present invention also provides an application of the TNFRSF13B gene in regulating genes related to liver cell metabolism in Hu sheep. The CDS sequence of the TNFRSF13B gene is shown in SEQ ID NO.1.

[0067] In the specific implementation process of the present invention, the application includes the application of negatively regulating the TNFRSF13B gene in positively regulating the expression of the GLUT4 gene and / or the PPARG gene; or, the application includes the application of negatively regulating the TNFRSF13B gene in negatively regulating the expression of the LPL gene; the NCBI GenBank accession numbers of the GLUT4 gene, PPARG gene and LPL gene are: GeneID: 442992, GeneID: 443513, GeneID: 443408, respectively.

[0068] To further illustrate the present invention, the application of the TNFRSF13B gene provided by the present invention in regulating the adaptability of Hu sheep to arid environments is described in detail below with reference to the accompanying drawings and examples, but they should not be construed as limiting the scope of protection of the present invention.

[0069] The sample sources used in this application are: fetal sheep livers were collected from 100-130d-old Hu sheep embryos from a Hu sheep slaughterhouse in Wuhan, Hubei Province, placed in 1% double-antibody, 37°C physiological saline, and transported back to the laboratory within 2 hours.

[0070] The reagents and consumables used in this application are: anhydrous ethanol, Sinopharm Chemical Reagent Co., Ltd.; xylene, Sinopharm Chemical Reagent Co., Ltd.; BSA, Solebao Technology Co., Ltd.; PBS buffer, Wuhan Bolfu Biotechnology Co., Ltd.; DAPI stain, Wuhan Bolfu Biotechnology Co., Ltd.; fluorescence quenching mounting medium, Wuhan Bolfu Biotechnology Co., Ltd.; primary antibody / secondary antibody, Thermo Fisher Scientific.

[0071] The instruments used in this application are: CO2 incubator, Sanyo Corporation; clean bench, Harbin Donglian Company; PCR instrument, BIO RAD Company; inverted microscope, Olympus Corporation; automatic cell counter, Ruiyu Biotechnology Co., Ltd.; embedding machine, Wuhan Junjie Electronics Co., Ltd.; dehydrator, Wuhan Junjie Electronics Co., Ltd.; pathological slicer, Leica Instrument Co., Ltd.; freezing table, Wuhan Junjie Electronics Co., Ltd.; tissue spreader, Jinhua Kedi Instrument Equipment Co., Ltd.; slide / cover glass, Jiangsu Shitai Laboratory Equipment Co., Ltd.; decolorization shaker, Jiangsu Xinkang Medical Equipment Co., Ltd.; vortex mixer, SCILOGEX; flow cytometer, Thermo Corporation.

[0072] All reagents, instruments, and materials used in the present invention are well known in the art, but do not limit the implementation of the present invention. Other reagents and equipment well known in the art can be applied to the implementation of the following embodiments of the present invention.

[0073] Example 1: Transcriptome Analysis of Hu Sheep in Hotan and Taihu Regions of Xinjiang Uygur Autonomous Region

[0074] Six Hu sheep were selected from Hotan and Taihu areas of Xinjiang Uygur Autonomous Region. Transcriptional analysis was performed on the whole blood of 12 Hu sheep. 107 differentially expressed genes were screened out. The proteins encoded by them were analyzed using the String online analysis tool. Hub genes were then screened using the CytoHubba plug-in in Cytoscape. After screening by degree score, 38 genes were found to interact ( Figure 1 ), among which five genes, IGF2, EFNA4, HPD, ALDH1A1 and TNFRSF13B, are related to metabolism, and five genes, SMAD6, CYP2E1, CYP2D6, AGT and NECTIN2, are related to immunity. TNFRSF13B is located at the center of the network and interacts with multiple proteins (proteins regulated by metabolism- and immunity-related genes).

[0075] Example 2: Analysis of differential expression of TNFRSF13B gene in Hu sheep from different regions

[0076] The tissue expression levels of the key genes screened by the transcriptome in Example 1 were detected by first extracting RNA from the liver tissue. The specific steps were as follows:

[0077] (1) Take the collected liver tissue sample out of the -80℃ freezer and quickly transfer it to a sterilized mortar pre-cooled with liquid nitrogen. Add liquid nitrogen and use a pestle to fully grind the tissue. Add liquid nitrogen while grinding until it is ground into powder. Transfer the ground sample into an enzyme-free 1.5mL centrifuge tube, add 1mL Trizol, and shake it thoroughly with a vortex oscillator to fully lyse the sample. Use a pipette to repeatedly blow and draw. Let it stand at room temperature for 5 minutes.

[0078] (2) Add 200 μL of chloroform to each tube and shake vigorously up and down for 30 seconds. Incubate at room temperature for 2-3 minutes and centrifuge at 12,000 g (4°C, 15 minutes).

[0079] (3) After centrifugation, the liquid is divided into three layers (the colorless water sample in the upper layer is RNA, the white milky sample in the middle layer is DNA, and the red organic bottom layer is protein). Carefully aspirate the upper layer RNA and transfer it to a new sterile EP tube.

[0080] (4) Add an equal volume of isopropanol (approximately 500 μL), mix well, incubate at 15-30°C for 10-30 min, and centrifuge at 12,000 g (4°C, 10 min). Note: After adding an equal volume of isopropanol, place the tube in a test tube rack, seal it with PE gloves, and place it in a refrigerator at 4°C for 30 min for better results.

[0081] (5) Discard the supernatant, add 1 ml of 75% ethanol aqueous solution to the precipitate, vortex vigorously for 30 seconds, and centrifuge at 7,500 g (4°C, 5 minutes).

[0082] (6) Carefully remove the supernatant and allow the pellet in the tube to dry in a clean bench for 3 to 5 minutes. It is best to use a pipette to remove as much of the supernatant as possible.

[0083] (7) Dissolve the solution in 20 μL of DEPC water, aliquot into 5 μL tubes, and store in a -80°C refrigerator.

[0084] Then, the primer sequences of the genes were designed. qPCR primers were designed using Primerpremier 6. The primer sequences are detailed in Table 1. The β-actin gene was used as the internal reference, and the 2-△△CT method was used to calculate the relative expression of each gene in liver tissue.

[0085] Table 1 Primer sequences

[0086]

[0087] The reverse transcription system is shown in Table 2.

[0088] Table 2 Reverse transcription system

[0089]

[0090] The qRT-PCR reaction system is shown in Table 3.

[0091] Table 3 qRT-PCR reaction system

[0092] (1)qPCRMasterMix 10 μL (2)cDNA 1 μL (3) F-primer upstream primer 0.5μL (4) R-primer downstream primer 0.5μL (5)ROX 0.1μL (6)Nuclease-free Water 7.9μL Total 20 μL

[0093] The amplification conditions of qRT-PCR were as follows: 95°C, 2 min; 95°C, 5 s, 60°C, 30 s, 72°C, 30 s, 40 cycles; 72°C, 5 min.

[0094] The expression of TNFRSF13B gene in liver tissues of Hu sheep from two regions was statistically analyzed. It was expressed in liver tissues of Hu sheep from different regions, and the expression of TNFRSF13B in liver tissues of Hu sheep from different regions was different. Among them, the expression of TNFRSF13B in Hu sheep from Hotan region was significantly lower than that in Hu sheep from Taihu region. Figure 2 ), indicating that the liver metabolic function of Hu sheep changed in the arid Hotan area.

[0095] Example 3: Whole-genome methylation analysis of Hu sheep in Hotan and Taihu regions of Xinjiang Uygur Autonomous Region

[0096] Blood samples were collected from Hu sheep in two regions for whole-genome methylation analysis. Genomic DNA was extracted from peripheral blood according to the DNA extraction kit instructions. DNA purity was determined using a NanoDrop 2000 (OD260 / 280 > 1.80), and DNA concentration was measured using Qubit 2.0. DNA was bisulfite-converted using the EZ DNA Methylation-Gold kit, and conversion efficiency was assessed by the addition of Lambda phage DNA. Genomic DNA was fragmented to 300-500 bp using Covaris S220, end-repaired, and ligated with sequencing adapters. DNA libraries were generated by PCR amplification. Quantification was performed using Qubit 2.0, insert length was determined using an Agilent 2100, and finally, the libraries were analyzed by fluorescent quantitative PCR. Samples that passed quality control were processed according to concentration and sequencing requirements, and paired-end sequencing was performed using the HiSeq 2500 platform (Beijing Biomike Biotechnology Co., Ltd.). Raw data were then quality-controlled and filtered using fastp software to generate clean data. Clean data were aligned to the sheep reference genome (ARS_UI_Ramb_v3.0) using Bsmap software and bioinformatics analysis. The aligned bam files were sorted and de-redundanted using Sambamba software. Methylation sites were extracted using MethylDackel. Differentially methylated regions (DMRs) were subsequently identified using Metilene software. After sequencing and quality control, 619.11 GB of cleanbases data were obtained. The CleanData percentage for all samples was above 79.91%, with an average alignment efficiency to the reference genome of approximately 70.80%. Q30 values ​​ranged from 96.63% to 97.37%, indicating good sequencing quality and suitability for subsequent bioinformatics analysis. Genome coverage exceeded 98.71% for all samples, demonstrating high data quality. A whole-genome methylation difference analysis was conducted on the peripheral blood of Hu sheep from Taihu Lake and Hotan Lake areas. There were 5745 regions with higher methylation levels in the peripheral blood of Hu sheep from Hotan Lake than those from Taihu Lake, and the differential regions were distributed in the corresponding 2076 genes. There were 29,996 regions with lower methylation levels in the peripheral blood of Hu sheep from Hotan Lake than those from Taihu Lake, and the differential regions were distributed in the corresponding 5247 genes. A joint analysis of the methylation levels of genes related to the methylation regions and the expression levels of their related transcriptome differential genes revealed that the TNFRSF13B gene was highly methylated and its expression was downregulated.

[0097] Example 4: Immunofluorescence identification of Hu sheep liver cells

[0098] Cell isolation and culture: Cells were seeded in 12-well culture plates coated with tail collagen at a rate of 2 × 10 cells per well. 5 Cells were cultured at 37°C and 50 mL / L CO2. WME containing 100 mL / L FBS was used as the complete culture medium for Huyang liver cells. When the cell density reached about 80%, the cells were passaged. The steps are as follows: discard the old culture medium and wash three times with PBS containing double antibodies; add 400 μL of 0.25% EDTA-containing trypsin to digest for 3 minutes. After the cells become round, tap the edge of the culture dish to suspend the cells, add twice the volume of culture medium, and mix well by pipetting. Aspirate half of the suspension and inoculate it into a new culture bottle. After observing under a microscope, place it in the incubator and continue culturing.

[0099] Immunofluorescence assay:

[0100] (1) Huyang liver cells were cultured at 2.5×10 5 Cells were seeded into 12-well plates and cultured in a constant temperature (37°C) cell culture incubator for 24 h.

[0101] (2) When the cell confluence reached 70%, the old culture medium was aspirated and the adherent cells were slowly rinsed with PBS three times, fixed with 4% paraformaldehyde for 15 min, and then rinsed with PBS three times for 5 min each time;

[0102] (3) Fix cells with paraformaldehyde at 4°C for 20 min and rinse with PBS three times for 3 min each;

[0103] (4) Permeabilization with 0.2% TritonX-100 for 10 min, followed by rinsing with PBS three times, 3 min each time;

[0104] (5) Block with BSA for 30 min, then rinse with PBS three times, 3 min each time;

[0105] (6) Add primary antibody, incubate in a 4°C wet box overnight, and rinse with PBS three times, 3 minutes each time;

[0106] (7) Add secondary antibody, incubate at 37°C for 90 min, and rinse with PBS three times, 3 min each time;

[0107] (8) Add DAPI staining solution at room temperature in the dark, incubate for 10 min, remove DAPI, and rinse three times with PBS;

[0108] (9) Observe the cells and take photos using a fluorescence microscope.

[0109] CK18 immunofluorescence was used for identification. CK18 positive staining was localized in the cell nucleus, the cytoplasm emitted red fluorescence, and the cell nucleus stained with DAPI was blue and oval ( Figure 3 ), indicating that the adherent cells were hepatocytes.

[0110] Example 5: Glycogen staining and identification of Hu sheep liver cells

[0111] Hepatocytes, as the site of glycogen synthesis and storage, can be stained light red to dark red by PAS, the cytoplasm of the cells is stained purple red, and the nucleus is stained blue, indicating that these cells can synthesize glycogen. The isolated cells are identified as hepatocytes ( Figure 4 ).

[0112] Example 6: siRNA design and transfection of Huyang liver cells

[0113] Based on the known Huyang TNFRSF13B gene sequence (XM_042255769.2) from the NCBI database and following siRNA design principles, three pairs of siRNA precursor oligonucleotide sequences targeting the TNFRSF13B gene were designed and synthesized using Invitrogen's online design tool (Table 4). The steps are as follows:

[0114] ① 24 hours after transfection, hepatocytes were plated into 12-well plates to allow the cell confluence to reach 80%. 2 hours before transfection, the medium was changed to serum-free medium.

[0115] ② Dilute the plasmids with 100 μL serum-free Opti-MEM, 0.2 μg per well, and mix gently with a pipette tip. Let stand at room temperature for 5 minutes.

[0116] ③ Before use, gently mix LipofectamineTM 2000, then dilute 5μL of LipofectamineTM 2000 in 100μL Opti-MEM and let it stand at room temperature for 5 minutes;

[0117] ④ Mix Lipofectamine™ 2000 and plasmid dilution (total volume 200 μL), mix gently and let stand at room temperature for 20 minutes;

[0118] ⑤ Add 200 μL of the mixed solution to each culture well. Replace the solution after 6 hours and use qPCR to detect the transfection efficiency.

[0119] Table 4 Sequences targeting the Hu sheep TNFRSF13B gene

[0120] name Targeting sequence (5′-3′) siTNFRSF13B-1 CAGUUGCCGCGAAGAGCAAGG(SEQ ID NO.2) siTNFRSF13B-2 CAAGGAUGAUUGGAUGGAAGC(SEQ ID NO.3) siTNFRSF13B-3 GCGGGAUCGAGGUGGUGUACA(SEQ ID NO.4)

[0121] Example 7: siRNA interference efficiency detection

[0122] The three siRNA interference sequences (siTNFRSF13B-1, siTNFRSF13B-2, siTNFRSF13B-3) in Example 6 were transfected separately and 48 hours later, the Hu sheep hepatocytes were collected and the expression of the TNFRSF13B gene was detected by qRT-PCR (see Table 1 in Example 2). The three siRNA interference sequences can interfere with the expression of the TNFRSF13B gene. Among them, siTNFRSF13B-2 has the highest interference efficiency, with an inhibition rate of greater than 76% (P<0.01). siTNFRSF13B-2 was selected for subsequent experiments ( Figure 5 ).

[0123] The qRT-PCR detection steps are as follows:

[0124] 1) Thaw the mixture at 4°C, gently invert and mix well, and centrifuge briefly.

[0125] 2) Prepare the reaction solution listed in Table 5 below on ice.

[0126] Table 5 PCR reaction system

[0127]

[0128] 3) Briefly centrifuge the reaction tube to ensure that all the reaction solution is at the bottom of the reaction well.

[0129] 4) The reaction was carried out using a three-step procedure (Table 6):

[0130] Table 6 PCR reaction program

[0131]

[0132]

[0133] Example 8: Effect of TNFRSF13B gene on proliferation of Hu sheep liver cells

[0134] (1) Take the liver cells of Hu sheep in the logarithmic growth phase and in good condition and adjust the density to 5×10 4 / mL, inoculated into 96-well plates, 100 μL of cell suspension per well, set up a blank group, cultured at 37°C overnight, and added 100 μL of sterile PBS around the cell wells.

[0135] (2) The cells in step (1) were divided into three groups: PC group (control group): Hu sheep liver cells; siNC group: Hu sheep liver cells + empty vector; siTNFRSF13B group: Hu sheep liver cells + siTNFRSF13B-2, with 9 replicates in each group, and cultured at 37°C for 24 h;

[0136] (3) After the incubation period, 10 μL of CCK-8 was added to each well and incubated at 37°C for 4 h;

[0137] (4) Measure the OD450 value of each well using a microplate reader.

[0138] (5) CCK-8 kit was used to detect cell absorbance and cell proliferation 48 h after infection.

[0139] The results showed that after Huyang liver cells were interfered with by siTNFRSF13B, the cell proliferation activity was significantly enhanced ( Figure 6 ).

[0140] Example 9: Effect of TNFRSF13B gene on the cell cycle of Hu sheep liver cells

[0141] After the cells were treated with the interference group in Example 8 for 48 hours, they were digested with EDTA-free trypsin for 3 minutes, the liver cells were collected by centrifugation, washed twice with pre-cooled PBS (1000r / min, 5min), and pre-cooled 70% ethanol was added to fix the cells, and incubated at 4°C overnight. After fixation, they were washed twice with pre-cooled PBS, 500μL PI / RNase solution was added, and incubated in the dark at room temperature for 15 minutes. Flow cytometry was used for detection, and at least 20,000 cells were counted each time. Finally, the cell cycle was analyzed using ModFit software. The results of flow cytometry showed that the distribution of the cell cycle changed significantly. In the control group, the percentages of cells in the G0 / G1, S, and G2 / M phases were 68.29±3.22%, 21.17±0.98%, and 10.55±0.85%, respectively. In the interference group, the percentages of cells in the G0 / G1, S, and G2 / M phases were 47.11±2.18%, 39.97±1.17%, and 12.92±0.96%, respectively. Compared with the control group, the percentage of cells in the G0 / G1 phase (cell quiescence and pre-DNA synthesis phase) was significantly decreased, the percentage of cells in the S phase (DNA synthesis phase) was significantly increased, and the percentage of cells in the G2 phase did not differ significantly (Table 7).

[0142] Table 7 Effects of TNFRSF13B gene on the cell cycle of Hu sheep liver cells

[0143] Group G0 / G1 (%) S(％) G2 / M (%) control group 68.29±3.22 21.17±0.98 10.55±0.85 Interference group 47.11±2.18* 39.97±1.17* 12.92±0.96

[0144] Example 10: Effect of TNFRSF13B gene on apoptosis of liver cells in Hu sheep

[0145] After the cells in the interference group in Example 8 were treated for 48 hours, the hepatocytes were labeled using the Annexin V-FITC / PI double staining method. The specific operation was as follows:

[0146] (1) After 48 h of cell treatment, the cells were digested with EDTA-free trypsin for 3 min, and serum-containing culture medium was added to terminate the digestion. The cells were transferred to a 5 mL centrifuge tube and centrifuged at 1000 g for 5 min.

[0147] (2) Wash the cells twice with PBS, centrifuge at 1000 rpm for 5 min, and discard the supernatant;

[0148] (3) Add 500 μL 1× Binding Buffer to suspend the cells, add 5 μL Annexin V-FITC and 5 μL PI, mix well, and react at room temperature in the dark for 15 minutes. Detect by flow cytometry within 1 hour.

[0149] The results showed that after interfering with the expression of TNFRSF13B gene, Annexin V-FITC / PI staining was performed as shown in the figure ( Figure 7 ) The test results distinguished apoptotic cells (early apoptosis and late apoptosis), normal living cells, and necrotic cells. The apoptosis rates of the control group and the interference group were 7.23±0.21% and 2.67±0.36%, respectively. The apoptosis rate in the interference group was significantly lower than that in the control group.

[0150] Example 11: Expression of related genes and proteins after interfering with the TNFRSF13B gene

[0151] (1)WB

[0152] The cells isolated and cultured in Example 4 were washed three times with pre-cooled PBS, 100 μl of RIPA lysis buffer (containing PMSF) was added to each culture well, and the cells were incubated at 4°C for 30 min. The cells were collected with a scraper and centrifuged at 12,000 rpm to collect the lysis supernatant. The samples were prepared and then subjected to Western blotting.

[0153] (2) qPCR gene expression verification

[0154] The qPCR method was used to detect changes in the expression of metabolism-related genes (GLUT4, PPARG, FASN, and LPL) and apoptosis genes (BCL-2, BAX, P53, and CASP3) by the TNFRSF13B gene at different expression levels. Primers were designed using AlleleID6.0 software based on the gene sequence published by Gene Bank. The primer sequences are shown in Table 8. The PCR reaction system and reaction procedure were the same as in Example 2.

[0155] Table 8 Primer sequences

[0156]

[0157]

[0158] (3) Expression of apoptosis-related genes and proteins in Hu sheep hepatocytes

[0159] After interfering with the expression of the TNFRSF13B gene, the BCL2 gene was significantly overexpressed, while the expression of the BAX, P53, and CASP3 genes was relatively reduced. The high expression of the BCL2 gene protected the cells from accelerated apoptosis. Figure 8 ).

[0160] (4) Expression of metabolism-related genes and proteins in Hu sheep liver cells after interference with TNFRSF13B gene

[0161] After interfering with the expression of TNFRSF13B gene, it was found that the expression levels of GLUT4 and PPARG genes and their proteins were significantly higher than those in the control group, while the expression levels of LPL gene and its protein were significantly lower than those in the control group, indicating that the reduction of TNFRSF13B gene expression led to an increase in the lipid synthesis capacity and glucose uptake capacity of the liver cells of Hu sheep, and a decrease in the lipid decomposition capacity ( Figure 9 ).

[0162] This indicates that the TNFRSF13B gene is a key candidate gene for Hu sheep to adapt to drought environments, and a TNFRSF13B gene low-expression model was successfully constructed to verify its function. ① After interfering with the TNFRSF13B gene, cell proliferation activity was significantly enhanced; the cell cycle was altered, with the proportion of cells in the G0 / G1 phase significantly decreased and the proportion of cells in the S phase significantly increased; and the apoptosis rate was significantly reduced. ② After interfering with the TNFRSF13B gene, the expression levels of the lipid synthesis-related gene PPARG and the glucose metabolism-related gene GLUT4 and their proteins were significantly increased, while the expression levels of the lipid catabolism-related gene LPL and their proteins were significantly decreased, indicating that the lipid synthesis and glucose metabolism capacity of Hu sheep liver cells is enhanced. In order to adapt to the drought environment in Hotan, Hu sheep in the Hotan region must improve their own cell activity and enhance the ability of liver cells to synthesize lipids. At the same time, the energy storage capacity of Hu sheep in the Hotan region is enhanced to better adapt to the drought environment in Hotan.

[0163] Although the above embodiment provides a detailed description of the present invention, it is only a part of the embodiments of the present invention, not all of the embodiments. People can also obtain other embodiments based on this embodiment without creativity, and these embodiments all fall within the scope of protection of the present invention.

Claims

1. Application of TNFRSF13B gene in regulating the adaptability of Hu sheep to drought environment, the CDS sequence of the TNFRSF13B gene is shown in SEQ ID NO.

1.

2. The use according to claim 1, characterized in that: The application includes the application of negatively regulating the TNFRSF13B gene in improving the adaptability of Hu sheep to arid environments; the negative regulation includes knockdown or knock-down.

3. Application of a negatively regulating agent for TNFRSF13B gene in improving the adaptability of Hu sheep to drought environment, wherein the CDS sequence of the TNFRSF13B gene is shown in SEQ ID NO.

1.

4. The use according to claim 3, characterized in that: The reagent for negatively regulating the TNFRSF13B gene includes an siRNA precursor oligonucleotide of the TNFRSF13B gene; the siRNA precursor oligonucleotide of the TNFRSF13B gene includes at least one of siTNFRSF13B-1, siTNFRSF13B-2 and siTNFRSF13B-3; the nucleotide sequences of the siTNFRSF13B-1, siTNFRSF13B-2 and siTNFRSF13B-3 are respectively shown in SEQ ID NO.2 to SEQ ID NO.

4.

5. Application of TNFRSF13B gene in regulating Hu sheep hepatocytes, wherein the CDS sequence of the TNFRSF13B gene is shown in SEQ ID NO.1; The regulation of Hu sheep hepatocytes includes at least one of the following: 1) Regulate the proliferation activity of Hu sheep hepatocytes; 2) Regulate the cell cycle of Hu sheep liver; 3) Regulate apoptosis of liver cells in Hu sheep; 4) Regulate the lipid synthesis capacity of Hu sheep hepatocytes; 5) Regulate the glucose uptake capacity of Hu sheep hepatocytes; The CDS sequence of the TNFRSF13B gene is shown in SEQ ID NO.

1.

6. The use according to claim 5, characterized in that: The application includes at least one of the following: 1) Application of negative regulation of TNFRSF13B gene in improving the proliferation activity of Hu sheep hepatocytes; 2) Application of negative regulation of TNFRSF13B gene in reducing the proportion of G0 / G1 phase cells in Hu sheep hepatocytes and / or increasing the proportion of S phase cells in Hu sheep hepatocytes; 3) Application of negative regulation of TNFRSF13B gene in inhibiting apoptosis of liver cells in Hu sheep; 4) Application of negative regulation of TNFRSF13B gene in improving the lipid synthesis capacity of hepatocytes; 5) Application of negative regulation of TNFRSF13B gene in improving the glucose uptake capacity of Hu sheep hepatocytes.

7. Application of TNFRSF13B gene in regulating apoptosis-related genes in Hu sheep, the CDS sequence of the TNFRSF13B gene is shown in SEQ ID NO.

1.

8. The use according to claim 7, characterized in that: The application includes the application of negatively regulating TNFRSF13B gene in positively regulating BCL2 gene expression; or, the application includes the application of negatively regulating TNFRSF13B gene in negatively regulating BAX gene, P53 gene and / or CASP3 gene expression; the NCBI GenBank accession numbers of the BCL2 gene, BAX gene, P53 gene and CASP3 gene are: GeneID: 101119602, GeneID: 443059, GeneID: 443421, GeneID: 443031, respectively.

9. Application of TNFRSF13B gene in regulating genes related to liver cell metabolism in Hu sheep, the CDS sequence of the TNFRSF13B gene is shown in SEQ ID NO.

1.

10. The use according to claim 9, characterized in that: The application includes the application of negatively regulating TNFRSF13B gene in positively regulating GLUT4 gene and / or PPARG gene expression; or, the application includes the application of negatively regulating TNFRSF13B gene in negatively regulating LPL gene expression; the NCBI GenBank accession numbers of the GLUT4 gene, PPARG gene and LPL gene are: GeneID: 442992, GeneID: 443513, GeneID: 443408, respectively.

Images