Application of combination of ZNF496 protein and KDM2B protein in medicine for treating cervical cancer
Through the combined application of ZNF496 protein and KDM2B protein, overexpression preparation drugs were prepared, which solved the problem of limited selectivity for cervical cancer treatment, achieved precise individualized treatment of cervical cancer cells, and significantly inhibited the malignant biological behavior of cervical cancer cells.
Patent Information
- Application Number
- CN202510139786.3
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-02-08
- Publication Date
- 2025-05-30
AI Technical Summary
The prior art is difficult to effectively solve the treatment problem of cervical cancer, especially in advanced or recurrent cervical cancer, with limited selectivity for treatment.
Overexpression preparation drugs were prepared through the combined application of ZNF496 protein and its interacting protein KDM2B to inhibit the migration, invasion, proliferation and induce apoptosis of cervical cancer cells.
The precise individualized treatment of cervical cancer cells has been achieved, which significantly inhibits the malignant biological behavior of cervical cancer cells and has important clinical application prospects.
Smart Images
Figure CN120053615A_ABST
Abstract
Description
Technical Field
[0001] The present invention belongs to the field of biomedicine, and particularly relates to the application of ZNF496 protein combined with KDM2B protein in drugs for treating cervical cancer. Background Art
[0002] Cervical cancer is the second most common cancer in women. Its incidence rate shows an increasing trend year by year, and the incidence rate and the high-incidence age group show a trend of getting younger. Research shows that cervical cancer develops from cervical intraepithelial neoplasia, and this is a multi-step process that takes several years or even decades to complete. Therefore, the development of cervical cancer is the result of the combined action of multiple stages, multiple pathways, and multiple molecules. Since advanced cervical cancer or recurrent cervical cancer is usually considered incurable and the treatment options are very limited. Therefore, screening and identifying abnormal molecular events in each stage and each pathway of cervical cancer can lay a foundation for our in-depth understanding of the regulatory mechanism of cervical cancer, establishing its early diagnosis system, and developing new anti-cervical cancer targeted drugs, and has great strategic significance in improving the survival rate and cure rate of patients.
[0003] ZNF496 is one of the members of the KRAB-type zinc finger protein family. Its structure includes a KRAB domain and an N-terminal SCAN domain, and the C-terminal contains four C2H2-type and one C2HR-type zinc finger motifs. Like other members of this protein family, the SCAN functional domain and C2H2 functional domain of ZNF496 have similar functions to the KRAB domain, which is to mediate its interaction with other proteins. In addition, C2HR can also bind to the methyltransferase NSD1 (nuclear receptor binding SET domain protein 1) of H3K36 to exert a KAP-1-independent transcriptional repression function. At present, there are few reports on the biological functions and regulatory mechanisms of ZNF496 in tumors.
[0004] Histone-specific demethylase KDM2B (lysine-specific demethylase 2B), also known as JHDM1B, FBXL10, NDY1, is a member of the Jmjc family and is also a widely expressed nuclear protein. KDM2B is very important for the post-translational modification of histones, and KDM2B can regulate the methylation modification of histones at multiple sites. Abnormal expression of KDM2B in cells can affect the biological processes of various malignant tumors. However, KDM2B plays different roles in different tumor cells. It regulates different signaling pathways through different mechanisms of action, showing cytological effects such as promoting or inhibiting cell proliferation, migration, and invasion, and acting as an oncogene or tumor suppressor gene to regulate tumor development.
[0005] At present, there is no report on the relationship between ZNF496 and KDM2B and their roles in the treatment of cervical cancer. Summary of the Invention
[0006] In view of the above deficiencies of the prior art, the present invention proposes the application of ZNF496 protein in combination with its interacting protein KDM2B in drugs for the treatment of cervical cancer, providing new targets and treatment strategies for solving the problem of drug treatment of cervical cancer.
[0007] The technical solution adopted by the present invention is as follows:
[0008] The application of ZNF496 protein in combination with KDM2B protein in drugs for the treatment of cervical cancer.
[0009] The application of ZNF496 protein and its interacting protein KDM2B in inhibiting the malignant cell biological behaviors of cervical cancer cells.
[0010] The preparation of an overexpression preparation drug of ZNF496 protein in combination with KDM2B protein.
[0011] The application of the above-prepared drug in the precise individualized treatment of cervical cancer.
[0012] The application of the drug in inhibiting the migration and invasion of cervical cancer cells.
[0013] The application of the drug in inhibiting the proliferation rate of cervical cancer cells.
[0014] The application of the drug in inducing the apoptosis rate of cervical cancer cells.
[0015] The technical principle of the present invention includes the following:
[0016] On the one hand, on the basis of obtaining the potential interacting protein KDM2B of ZNF496 by IP-MS technology in the early stage of our laboratory, Co-IP technology was used to prove the endogenous and exogenous interactions between ZNF496 and KDM2B. Cervical cancer cells with KDM2B knockout were used, and it was found that ZNF496 inhibited RelA methylation and the formation of RelA / p50 heterodimers depending on KDM2B, thereby inhibiting the NF-κB pathway. Cervical cancer cells with ZNF496 knockout were used, and it was found that KDM2B inhibited RelA methylation and the formation of RelA / p50 heterodimers depending on ZNF496, thereby inhibiting the NF-κB pathway.
[0017] On the other hand, cytological experiments confirmed that, compared with the empty control cells without KDM2B knockout, in the cervical cancer cells with KDM2B knockout, the ability of ZNF496 to inhibit the migration and invasion of cervical cancer cells was significantly weakened, indicating that ZNF496 inhibits the migration and invasion of cervical cancer cells in a KDM2B-dependent manner; compared with the empty control cells without ZNF496 knockout, in the cervical cancer cells with ZNF496 knockout, the ability of KDM2B to inhibit the migration and invasion of cervical cancer cells was significantly weakened, indicating that KDM2B inhibits the migration and invasion of cervical cancer cells in a ZNF496-dependent manner. Further confirmation showed that when ZNF496 and KDM2B were co-transfected and used in combination, compared with the individual use of ZNF496 or KDM2B, it significantly inhibited the proliferation of cervical cancer cells and significantly increased the apoptosis of cervical cancer cells.
[0018] The beneficial effects of the present invention are as follows:
[0019] The present invention firstly demonstrated the interaction relationship between ZNF496 protein and its interacting protein KDM2B, firstly proposed the inhibitory effect of the combination of ZNF496 protein and its interacting protein KDM2B on the NF-κB pathway in cervical cancer cells, and firstly proposed the application of ZNF496 protein and its interacting protein KDM2B in inhibiting the malignant cell biological behaviors of cervical cancer cells. Using this mechanism, specific targeted treatment regimens can be designed and applied to the preparation of drugs overexpressing ZNF496 combined with KDM2B, so as to implement precise individualized treatment for cervical cancer patients, which has important application prospects in clinical treatment. Description of the Drawings
[0020] Figure 1 : Co-IP technology confirmed the endogenous and exogenous interaction map of ZNF496 and KDM2B in cervical cancer HeLa cells;
[0021] Figure 2 : Western blot identified the stable strains with ZNF496 knockout and KDM2B knockout in cervical cancer HeLa cells;
[0022] Figure 3 : ZNF496 inhibits RelA methylation and inhibits the formation of RelA / p50 heterodimer in a KDM2B-dependent manner, thereby inhibiting the NF-κB pathway experimental diagram;
[0023] Figure 4 : KDM2B inhibits RelA methylation and inhibits the formation of RelA / p50 heterodimer in a ZNF496-dependent manner, thereby inhibiting the NF-κB pathway activity experimental diagram;
[0024] Figure 5 : ZNF496 inhibits the migration and invasion of cervical cancer cells in a KDM2B-dependent manner experimental diagram (using cervical cancer cells with KDM2B knockout);
[0025] Figure 6 : Experimental figure of KDM2B-dependent ZNF496 inhibiting the migration and invasion of cervical cancer cells (using cervical cancer cells with ZNF496 knockout);
[0026] Figure 7 : Figure showing the effect of ZNF496 combined with KDM2B on the proliferation of cervical cancer cells;
[0027] Figure 8 : Figure showing the effect of ZNF496 combined with KDM2B on the apoptosis of cervical cancer cells. Detailed implementation method
[0028] Example 1 Co-IP technology was used to confirm the endogenous and exogenous interactions between ZNF496 and KDM2B in cervical cancer HeLa cells.
[0029] A. In HeLa cells, pCMV-Myc-ZNF496 was transfected alone or co-transfected with pLV-Neo-Flag-KDM2B. After 36 h of transfection, the cells were harvested and lysed with 1.5 mM NETN lysis buffer. 30 μL of the cell lysate was used as lysate, and the remaining cell lysate was incubated with 1 μg of Flag antibody, and then 35 μL of Agarose was added for immunoprecipitation. The expression of Flag-KDM2B and Myc-ZNF496 and the enrichment degree in the antibody-precipitated complex were detected by Western blot.
[0030] B. Two dishes (10 cm) of HeLa cells were prepared. After they grew to confluence, the cells were harvested, lysed, and proteins were extracted. 30 μL of the cell lysate was used as lysate, and the remaining cell lysate was divided into two equal parts. IgG (1 μL) was added to the control group, and ZNF496 antibody (4 μL) was added to the experimental group for incubation, and then 35 μL of Agarose was added for immunoprecipitation. The expression of KDM2B and ZNF496 and the enrichment degree in the antibody-precipitated complex were detected by Western blot.
[0031] The results are as Figure 1 shown. In Figure A, exogenous expression of the KDM2B plasmid with a Flag tag and the ZNF496 plasmid with a Myc tag in HeLa cells, and IP was performed with Flag antibody. It was found that the expression of Myc-ZNF496 could be detected in the IP complex co-transfected with Flag-KDM2B, confirming that the exogenously expressed ZNF496 and KDM2B in HeLa cells can interact; in Figure B, IP was performed with ZNF496 antibody in HeLa cells, and KDM2B could be detected in the complex, confirming the interaction between endogenous ZNF496 and KDM2B.
[0032] Example 2 Identification of stable cell lines with ZNF496 knockout and KDM2B knockout in cervical cancer HeLa cells by Western blot.
[0033] a. Construction of knockout plasmids.
[0034] To establish stable cell lines with ZNF496 and KDM2B knockout in HeLa cells respectively, we used the CRISPR-Cas9 technology to construct gene knockout cell lines. The CRISPR guide sequences were from the website http: / / crispr-era.stanford.edu / CalculateAction.action. The KO-ZNF496 sgRNA primer sequence was: CACCGACGGCGGAAGAGACGCCGAG; the KO-KDM2B sgRNA primer sequence was: CACCGGGACTTCGTGCACGCCATGG.
[0035] (1) Vector digestion: Digest 5 μg of lenti-CRISPR-v2 vector with BsmBI enzyme and dephosphorylate it at 37 °C for 30 min.
[0036] (2) Electrophorese the vector digested in step (1) and perform gel extraction.
[0037] (3) Phosphorylate and anneal the synthesized gRNA sequences.
[0038] (4) Dilute the annealed oligos obtained in step (3) 200-fold.
[0039] (5) Ligation reaction, 10 min at room temperature.
[0040] (6) Transformation: Transform the ligated vector into Stabl3 Escherichia coli.
[0041] (7) Pick colonies, extract plasmids and send for sequencing.
[0042] b. Construction of stable cell lines for screening cervical cancer.
[0043] (1) Prepare HEK293T cells.
[0044] (2) When the cells grow to 60 - 70%, perform transfection with a transfection ratio of pSPAX2:pMD2G:X (constructed gRNA vector) = 3:2:5.
[0045] (3) Change the medium 6 h after transfection and supplement the medium 24 h later (add more medium).
[0046] (4) Virus liquid collection: After 48 h, transfer the culture medium to a new 15 mL centrifuge tube, centrifuge at 1,000 rpm for 3 - 5 min, and filter out cell debris with a 0.22 μm filter (it can be stored at -80 °C).
[0047] (5) Add the filtered virus liquid to the pre-plated cervical cancer HeLa cells (the confluence of plated cells is preferably 30%). After 24 h of virus infection, discard the virus liquid, and replace it with a culture medium containing 20% serum for 2 - 3 days. Then replace it with a medium containing puro for screening. Continuously screen for 1 - 2 weeks until almost no cell death occurs (a group of cells not infected with the virus can be set as a reference).
[0048] (6) Collect a part of the cells and identify the knockout effect by Western blot.
[0049] c. Selection and identification of monoclonal cells
[0050] (1) Digest the screened and identified cells with trypsin, terminate with the culture medium, and centrifuge.
[0051] (2) Resuspend with 1 mL PBS and filter the cells through a filter membrane. Sort single cells into a 96-well plate for culture by flow cytometry (the culture medium in the 96-well plate should contain puro), and replenish the liquid on time.
[0052] (3) After 2 - 3 weeks, clones can be seen. Digest with trypsin and transfer to a 24-well plate for continued culture (change to normal culture medium).
[0053] (4) When the 24-well plate is full, digest with trypsin and divide it into two parts. One part is continued to be cultured, and the other part of the cells is lysed with ATM to extract proteins, and the knockout is identified by Western blot.
[0054] (5) Expand the culture of the identified monoclonal cells and cryopreserve them for seed storage.
[0055] The results are as Figure 2 shown, Figure 2 In A. Cervical cancer HeLa cells were stably transfected with the gene knockout vector Lenti-CRISPR-v2-ZNF496 and the empty vector. After Western blot detection, the expression level of ZNF496 protein in the knockout stable strain was significantly lower than that of ZNF496 in the corresponding empty vector control strain; Figure 2 In B. Cervical cancer HeLa cells were stably transfected with the gene knockout vector Lenti-CRISPR-v2-KDM2B and the empty vector. After Western blot detection, the expression level of KDM2B protein in the knockout stable strain was significantly lower than that of KDM2B in the corresponding empty vector control strain.
[0056] Example 3: ZNF496 downregulates RelA methylation through KDM2B, inhibits the formation of RelA / p50 heterodimers, and thus inhibits the NF-κB pathway.
[0057] 3.1 ZNF496 downregulates the RelA methylation level through KDM2B
[0058] The HeLa stable cell line with KDM2B knockout and its control cell line were transfected with pLV-Neo-Flag-ZNF496 and empty vector control plasmid respectively. After 36 h, the cells were harvested, lysed with 1.5 mM NETN lysis buffer for 35 min, centrifuged after sonication, and the supernatant was taken. 40 μL of the supernatant was used as lysate, and 4 μL of pan-methylated antibody was added to the remaining supernatant, incubated at 4 °C for 2 h, and then 35 μL of Agarose was added and incubated for more than 6 h. The enrichment degree of RelA was detected by Western blot.
[0059] 3.2 ZNF496 inhibits the formation of RelA / p50 heterodimers through KDM2B
[0060] The HeLa stable cell line with KDM2B knockout and its control cell line were co-transfected or transfected separately with pLV-Neo-Flag-ZNF496 and empty vector control plasmid, pFlag-CMV-RelA plasmid, and pCMV-Myc-p50. After 36 h, the cells were harvested, lysed with 1.5 mM NETN lysis buffer for 35 min, centrifuged after sonication, and the supernatant was taken. 40 μL of the supernatant was used as lysate, and 1 μL of Myc antibody was added to the remaining supernatant, incubated at 4 °C for 2 h, and then 35 μL of Agarose was added and incubated for more than 6 h. The protein expression levels of ZNF496, p50, RelA, and KDM2B were detected by Western blot.
[0061] 3.3 ZNF496 inhibits the NF-κB pathway activity through KDM2B
[0062] The dual-luciferase reporter gene assay was used, and the specific steps were as follows:
[0063] (1) The HeLa stable cell line with stable KDM2B knockout and its empty vector control cell line were plated in 24-well plates, with three replicates for each group of experiments. When the cells grew to about 80%, the target plasmid and reporter gene plasmid were co-transfected. The transfection conditions were as follows: 0.5 μg of pLV-Neo-Flag-ZNF496 per well, 0.1 μg of NF-κB reporter gene plasmid per well, and 0.2 ng of RL per well.
[0064] (2) After 6 h of transfection, the medium was replenished. After 24 h, the medium was changed. After 30 - 36 h, the medium was discarded, and the cells were washed with 1×PBS.
[0065] (3) Add 90 μL of pre-prepared 1× Passive Lysis Buffer to each well and shake rapidly on a shaker at room temperature for 30 min.
[0066] (4) Take out 30 μL of the lysate from each well and add it to the measurement plate, and use the Dual-Luciferase Reporter Assay Kit to detect it on the machine. The remaining lysate is used to detect the protein expression level.
[0067] (5) Data statistics: Set the fluorescence intensity of the control group as 1, calculate the relative fluorescence intensity of each group, and use this to represent the relative activity of NF-κB.
[0068] According to the method of Example 3, experiments at the relevant molecular level were carried out using KDM2B-knockout cervical cancer HeLa cells. In the empty vector control cells without KDM2B knockout (containing endogenous KDM2B in the cells), overexpression of ZNF496 could significantly reduce the methylation level of RelA in the cells, but after knocking out KDM2B, the inhibitory effect of ZNF496 on RelA methylation disappeared ( Figure 3 in A). In the empty vector control cells without KDM2B knockout, overexpression of ZNF496 significantly inhibited the formation of the RelA / p50 heterodimer, but after knocking out KDM2B, the inhibitory effect of ZNF496 on the RelA / p50 heterodimer was eliminated ( Figure 3 in B). Moreover, in the empty vector control cells without KDM2B knockout, overexpression of ZNF496 could significantly inhibit the NF-κB transcriptional activity in the cells. However, after knocking out KDM2B, the inhibitory effect of ZNF496 on the NF-κB transcriptional activity disappeared significantly ( Figure 3 in C). This shows that at the molecular level, the function of ZNF496 depends on the presence of KDM2B, and the two form a complex to function together.
[0069] Example 4 KDM2B inhibits RelA methylation, inhibits the formation of the RelA / p50 heterodimer, and thus inhibits the NF-κB pathway activity in a ZNF496-dependent manner.
[0070] 4.1 KDM2B downregulates the RelA methylation level in a ZNF496-dependent manner
[0071] The HeLa cell line with ZNF496 knockout and the empty vector control cell line were transfected with
[0072] pLV-Neo-Flag-KDM2B and the empty vector control plasmid, pCMV-Myc-RelA plasmid. After 36 h, the cells were harvested, lysed, and the supernatant was taken. 4 μL of pan-methylation antibody was added and incubated at 4 °C for 2 h, and then 35 μL of Agarose was added for immunoprecipitation. The RelA methylation level was detected by Western blot.
[0073] 4.2 KDM2B inhibits the formation of RelA / p50 heterodimer depending on ZNF496
[0074] HeLa cell lines with ZNF496 knockout and empty vector control cell lines were co-transfected or separately transfected with pLV-Neo-Flag-KDM2B and empty vector control plasmid, pFlag-CMV-RelA plasmid, pCMV-Myc-p50 and its empty vector control plasmid. After 36 h, the cells were harvested, lysed with 1.5 mM NETN lysis buffer for 35 min, centrifuged after sonication, and the supernatant was taken. 40 μL of the supernatant was used as lysate, and 1 μL of Myc antibody was added to the remaining supernatant and incubated at 4 °C for 2 h, then 35 μL of Agarose was added and incubated for more than 6 h. The protein expression levels of KDM2B, p50, RelA and ZNF496 were detected by Western blot.
[0075] 4.3 KDM2B inhibits the activity of NF-κB pathway depending on ZNF496
[0076] HeLa cell lines with ZNF496 knockout and empty vector control cell lines were seeded in 24-well plates, transfected with pLV-Neo-Flag-KDM2B and empty vector control plasmid respectively, and co-transfected with RL and pNF-κB-Luc plasmids. After 36 h, the dual-luciferase reporter gene assay was performed for detection, and the specific method was referred to Example 3.3.
[0077] According to the method of Example 4, relevant molecular level experiments were carried out using ZNF496-knockout cervical cancer HeLa cells. In the empty vector control cells without ZNF496 knockout (containing endogenous ZNF496 in the cells), overexpression of KDM2B could significantly reduce the methylation level of RelA in the cells, but after knocking out ZNF496, the inhibitory effect of KDM2B on RelA methylation disappeared ( Figure 4 in A). In the empty vector control cells without ZNF496 knockout, overexpression of KDM2B significantly inhibited the formation of RelA / p50 heterodimer, but after knocking out ZNF496, the inhibitory effect of KDM2B on RelA / p50 heterodimer was eliminated ( Figure 4 in B). Moreover, in the empty vector control cells without ZNF496 knockout, overexpression of KDM2B could significantly inhibit the NF-κB transcriptional activity in the cells. However, after knocking out ZNF496, the inhibitory effect of KDM2B on NF-κB transcriptional activity disappeared significantly ( Figure 4 in C). This indicates that at the molecular level, the function of KDM2B depends on the presence of ZNF496, and the two form a complex to function together.
[0078] Example 5 ZNF496 inhibits the migration and invasion of cervical cancer cells depending on KDM2B
[0079] Using KDM2B-knockout cervical cancer HeLa cells, cell migration assay and cell invasion assay were employed to detect whether the effects of ZNF496 on the migration and invasion of cervical cancer cells are dependent on KDM2B.
[0080] The specific steps of the cell migration assay are as follows:
[0081] (1) Seed the HeLa stable strain with stable KDM2B knockout and its empty vector control cell line in 6-well plates in advance. When the confluence reaches 70 - 80%, transfect pLV-Neo-Flag-ZNF496 and the corresponding empty vector plasmid respectively, and seed the Transwell chambers 24 hours later.
[0082] (2) Pretreatment of the Transwell chamber: Add 600 μL of serum-free medium to a 24-well plate, place the chamber into the medium, and incubate and activate it in an incubator at 37°C.
[0083] (3) Digest the cells with trypsin, neutralize with medium, transfer them into a 1.5 mL centrifuge tube, and centrifuge at 800 rpm for 3 minutes.
[0084] (4) Discard the upper layer of the medium, resuspend the cells with serum-free medium, pipette and disperse them evenly, then transfer 10 μL to a new 1.5 mL centrifuge tube, add trypan blue staining solution, mix well, and then transfer 10 μL to a cell counting chamber to count the viable cell number.
[0085] (5) Add 600 μL of medium containing 20% serum to a 24-well plate, transfer the chamber into it, make sure there are no bubbles at the bottom, dilute the cells with serum-free medium, seed 3×10 4 cells in each chamber, and transfer 200 μL after dilution into the chamber, then transfer it into an incubator at 37°C.
[0086] (6) After 24 hours, take out the chamber, wash the chamber with PBS: Use a cotton swab dipped in PBS to gently wipe off the non-migrated cells inside the chamber, and fix it in absolute methanol for 20 minutes.
[0087] (7) Discard the absolute methanol, stain the chamber with 0.1% crystal violet for 20 minutes.
[0088] (8) Rinse off the excess crystal violet under tap water, invert the chamber to dry, observe the migration situation under a microscope, and count and analyze.
[0089] The steps of the cell invasion assay are the same as those of the above cell migration assay, but the used Transwell chamber is different. The invasion chamber contains Matrigel, and the invasion time is 30 hours.
[0090] According to the method of Example 5, the cervical cancer HeLa cells with KDM2B knockout were used to detect the relevant cytological behaviors. The cell migration experiment showed that in the empty vector control cells without KDM2B knockout (containing endogenous KDM2B in the cells), overexpression of ZNF496 could significantly inhibit the migration of cervical cancer HeLa cells. However, after knocking out KDM2B, the inhibitory ability of overexpressed ZNF496 on the migration of cervical cancer HeLa cells was weakened ( Figure 5 as shown in A). The cell invasion experiment showed that overexpression of ZNF496 could significantly inhibit the invasion ability of cervical cancer HeLa cells. After knocking out KDM2B, the inhibitory ability of overexpressed ZNF496 on the invasion of cervical cancer HeLa cells was weakened ( Figure 5 as shown in B). This indicates that ZNF496 inhibits the migration and invasion of cervical cancer cells in a KDM2B-dependent manner, and ZNF496 and KDM2B jointly play a role in inhibiting the migration and invasion of cervical cancer cells.
[0091] Example 6 KDM2B inhibits the migration and invasion of cervical cancer cells in a ZNF496-dependent manner
[0092] Using the cervical cancer HeLa cells with ZNF496 knockout, the cell migration experiment and the cell invasion experiment were used to detect whether the effect of KDM2B on the migration and invasion of cervical cancer cells depends on ZNF496. The specific operation steps refer to the method of Example 5.
[0093] According to the method of Example 6, the cervical cancer HeLa cells with ZNF496 knockout were used to detect the relevant cytological behaviors. The cell migration experiment showed that in the empty vector control cells without ZNF496 knockout (containing endogenous ZNF496 in the cells), overexpression of KDM2B could significantly inhibit the migration of cervical cancer HeLa cells. However, after knocking out ZNF496, the inhibitory ability of overexpressed KDM2B on the migration of cervical cancer HeLa cells was weakened ( Figure 6 as shown in A). The cell invasion experiment showed that overexpression of KDM2B could significantly inhibit the invasion ability of cervical cancer HeLa cells. After knocking out ZNF496, the inhibitory ability of overexpressed KDM2B on the invasion of cervical cancer HeLa cells was weakened ( Figure 6 as shown in B). This indicates that KDM2B inhibits the migration and invasion of cervical cancer cells in a ZNF496-dependent manner, and KDM2B and ZNF496 jointly play a role in inhibiting the migration and invasion of cervical cancer cells.
[0094] Example 7 The effect of combined overexpression of ZNF496 and KDM2B on the proliferation of cervical cancer cells
[0095] The cell proliferation experiment was applied, and the specific steps are as follows:
[0096] (1) Seed cervical cancer HeLa cells in 6-well plates in advance. When the confluence reaches 70-80%, transiently transfect the empty control plasmid, pCMV-Myc-ZNF496 expression plasmid, pCMV-Myc-KDM2B expression plasmid, and co-transfect the ZNF496 expression plasmid and KDM2B expression plasmid simultaneously.
[0097] (2) After 24 h, digest the cells with trypsin, neutralize in the medium, transfer them into 1.5 mL centrifuge tubes, and centrifuge at 800 rpm for 3 min.
[0098] (3) Discard the upper layer of the medium, resuspend the cells with an appropriate amount of medium, pipette and disperse them evenly, then aspirate 10 μL into a new 1.5 mL centrifuge tube, add trypan blue staining solution, mix well, and then aspirate 10 μL and add it to the cell counting chamber to count the viable cell number.
[0099] (4) Seed 3,000 cells per well in 96-well plates, set three replicates for each group, and set for a total of 5 days. Dilute the cells in proportion and transfer them into 96-well plates, 100 μL of cell suspension per well.
[0100] (5) After seeding the cells in 96-well plates, add 10 μL of CCK8 reagent per well 4 h later, and add 3 blank wells as controls at the same time. Incubate in the incubator for 2 h.
[0101] (6) Detect the absorbance at 450 nm.
[0102] (7) Continuously detect the absorbance at the same time period for 5 days, taking the value of the first day as 1, and analyze the proliferation situation.
[0103] According to the method of Example 7, the results of the cell proliferation experiment showed that the inhibitory effect of the combined overexpression of ZNF496 and KDM2B on the proliferation rate of cervical cancer cells was significantly higher than that of the single expression of ZNF496 or KDM2B on the proliferation rate of cells ( Figure 7 ).
[0104] Example 8 Effect of the combined overexpression of ZNF496 and KDM2B on the apoptosis of cervical cancer cells
[0105] Apply the cell apoptosis experiment, and the specific steps are as follows:
[0106] (1) Seed cervical cancer HeLa cells in 12-well plates in advance. When the confluence reaches 70-80%, transiently transfect the empty control plasmid, pCMV-Myc-ZNF496 expression plasmid, pCMV-Myc-KDM2B expression plasmid, and co-transfect the ZNF496 expression plasmid and KDM2B expression plasmid simultaneously.
[0107] (2) Collect the cells after 48 h. Transfer the culture medium to a 1.5 mL EP tube, make a mark, wash it once with 1 mL PBS, discard the PBS, add 300 μL of trypsin to digest the cells, and discard the trypsin.
[0108] (3) Transfer the original culture medium in step (1) to a 12-well plate one by one, gently pipette the cells down, transfer them to an EP tube, and centrifuge at 70×g for 3 - 5 min.
[0109] (4) Discard the culture medium, resuspend the cells with 1×PBS (wash the cells to prevent interference of the culture medium with subsequent staining), and centrifuge at 70×g for 3 - 5 min.
[0110] (5) Discard the supernatant, and resuspend the cells by adding 200 μL of staining binding solution.
[0111] (6) Add 5 μL of AnnexinV-FITC staining solution, and then add 10 μL of propidium iodide (PI) staining solution, and mix well.
[0112] (7) Wrap it with tin foil to avoid light, incubate for 15 - 20 min, and during the incubation, the cells can be resuspended every 5 min to make the staining more sufficient.
[0113] (8) Filtration: Filter the cell suspension with a filter membrane (to prevent cell clusters from clogging the flow cytometer), and then perform on-machine detection.
[0114] (9) Result analysis and statistics.
[0115] According to the method of Example 8, the results of the cell apoptosis experiment showed that the apoptosis rate of cervical cancer cells induced by the combined overexpression of ZNF496 and KDM2B was significantly higher than that induced by the single expression of ZNF496 or KDM2B ( Figure 8 ).
[0116] The above are only the preferred embodiments of the present invention. It should be noted that for those of ordinary skill in the art, without departing from the principle of the present invention, several modifications or alterations can still be made, and these modifications and alterations should also be regarded as the protection scope of the present invention.
Claims
1. Application of ZNF496 protein combined with KDM2B protein in the treatment of cervical cancer.
2. Application of ZNF496 protein and its interacting protein KDM2B in inhibiting the malignant biological behavior of cervical cancer cells.
3. Drug preparation for overexpression of ZNF496 protein combined with KDM2B protein.
4. The drug according to claim 3, characterized in that: The drug is used in the precise individualized treatment of cervical cancer.
5. The drug according to claim 3, characterized in that: The drug is used in inhibiting the migration and invasion of cervical cancer cells.
6. The drug according to claim 3, characterized in that: The drug is used in inhibiting the proliferation rate of cervical cancer cells.
7. The drug according to claim 3, characterized in that: The drug is used in inducing apoptosis rate of cervical cancer cells.