143 results about "Clinical prognosis" patented technology

The invention relates to lung adenocarcinoma-related gene signatures and an application thereof. The invention relates to a group of 27 prognosis related gene signatures based on lung adenocarcinoma and a detection result of an expression level of the gene signatures in a clinical sample, a prediction value is calculated to evaluate clinical prognosis of lung adenocarcinoma, and the invention alsoprovides an application of the gene signatures. A system is used for preventing lung adenocarcinoma patient prognosis and guiding a clinical treatment decision, and a purpose of accurate or individualized medicine can be achieved. According to the system and different detection technical platforms, a corresponding 27 gene expression measuring kit is designed and exploited.

The invention relates to the technical field of biomedicines, discloses a human liver cancer marker and application thereof, and particularly relates to application of a GPT gene to diagnosis and treatment of hepatocellular carcinoma. By a gene chip data analysis and immunohistochemistry method, that the GPT gene is differentially expressed in a hepatocellular carcinoma tissue and a normal tissueis proved, and that expression of the GPT gene is closely related to clinical prognosis of a patient and the GPT gene can be used as an index for early diagnosing the hepatocellular carcinoma is confirmed. Through study on the expression of the GPT gene in liver cancer and a relationship between the GPT gene and the clinical prognosis, a new marker is provided for early diagnosis and prognostic judgment of the liver cancer so as to improve the early diagnosis rate of a liver cancer patient and improve the clinical prognosis of the patient.

The invention belongs to the field of prognosis estimation and canceration risk prediction on clinic of molecular biology, and particularly relates to application of a molecule of a detection ANO1 protein in the preparation of a kit or a detection agent for the prognosis estimation and precancerous disease progression risk prediction of esophageal squamous carcinoma. The molecule expressed by the detection ANO1 protein can be a nucleic acid, a protein or a compound, thus showing that the ANO1 protein can be used as a molecular marker for the prognosis estimation and precancerous disease progression risk prediction of the esophageal squamous carcinoma.

The invention belongs to the technical field of medical apparatuses and instruments and particularly relates to a series connection type thrombus extraction stent and a thrombus extraction device. Theseries connection type thrombus extraction stent comprises a front thrombus extraction stent and a back thrombus extraction stent which are serially connected along the same axis in a front-back wayafter being released, wherein each of the front thrombus extraction stent and the back thrombus extraction stent comprises a network tube shaped stent body formed by connecting multiple net holes, andthe stent bodies are closed up under the effect of an external force and are released for restoration after the external force disappears. The stent body included by the back thrombus extraction stent comprises a near end and a far end which are integrally formed and connected through smooth transition, the near end of the stent body in a released state is of a conical structure with a smaller near portion and a bigger far portion, and the far end is of a cylindrical structure. The stent body included by the front thrombus extraction stent comprises a near end, a middle main body portion anda far end which are integrally formed and connected through smooth transition, the near end of the stent body in a released state is of a conical structure with a smaller near portion and a bigger farportion, the middle main body portion is of a cylindrical structure, and the far end is a net bag shaped structure with a closed tail end. The overall outer diameter of the front thrombus extractionstent in the released state is smaller than the overall inner diameter of the back thrombus extraction stent. The series connection type thrombus extraction stent effectively extracts thrombus, prevents the thrombus from escaping, is high in thrombus extraction rate and good in clinical prognosis effect.

In a wide variety of human solid tumors, an aggressive, metastatic phenotype and poor clinical prognosis are associated with expression of the receptor tyrosine kinase. Met and its agonist ligand HGF. Disclosed herein are (a) mAbs and hybridoma cell lines that produce them, which mAbs antibodies are specific for Met and (b) combinations of anti-Met and anti-HGF mAbs. When detectably labeled, these antibodies are useful for imaging such tumors. Anti-Met mAb compositions and methods for scintigraphic detection, diagnosis, prognosis, monitoring and therapy of Met-bearing tumors are provided.

The invention belongs to the field of clinical prognosis in molecular biology and relates to an application of quantitative detection of a CPT1A gene or protein to prognosis of esophageal squamous cell carcinomas, and in particular relates to an application of a quantitative detection reagent of a CPT1A gene or protein in preparation of a prognosis kit of esophageal squamous cell carcinomas, a kit for prognosis of esophageal squamous cell carcinomas and a method for detecting CPT1A gene copy numbers or protein expression levels of esophageal squamous cell carcinomas patients. CPT1A gene copy number increase or protein overexpression prompts that the postoperative life cycles of the esophageal squamous cell carcinomas patients are short.

The invention discloses a 3D printing personalized talus surface replacement prosthesis, comprising a prosthesis made by 3D printing technology. The prosthesis includes a smooth joint surface for fitting to the subtalar articular surface and a part to cut away from the talus. The prosthesis further comprises a body between the smooth connecting surface and the rough contact surface, and the roughcontact surface is provided with a plurality of micropores which are fixedly connected to the talus by allowing the newly growing bone of the talus to protrude. The prosthesis is provided with a connecting piece for connecting it to the talus. The 3D printing personalized talus surface replacement prosthesis provided by the invention has talus surface replacement retaining all ligaments around thetalus, which not only maintains the stability of the ankle joint and the posterior foot, but also preserves the normal body sensation of the patient, and the clinical prognosis is predictable and good.

The invention discloses a molecular marker for clinical prognosis of pancreatic cancer. The molecular marker is one or more genes selected from LOC127841, LOC402377, GEMIN8P4 and SLC6A10P. The invention further discloses application of the molecular marker to preparation of a pancreatic cancer clinical prognosis reagent or a kit. The reagent or kit comprises one or more groups of primer sequences from specific amplification LOC127841, LOC402377, GEMIN8P4 and SLC6A10P. By using the one or more genes as the marker to detect pancreatic cancer, precision is improved greatly, early detection and prognosis evaluation can be achieved quickly and effectively, and the molecular marker is of great significance for diagnosis and treatment of pancreatic cancer.

Based on the discovery of a group of 11 prognostic related gene profiles in serous ovarian cancer and the detection of the expression level of the 11 prognostic related gene profiles in clinical tumorsamples, the prognostic score of a patient is calculated according to the prognostic correlation coefficient of a group of the genes to evaluate the clinical prognosis of ovarian cancer patients andrelated application of the clinical prognosis. The system can assist in evaluating the response of the ovarian cancer patients to treatment interventions, thus whether the patients benefit from chemical or targeted treatments or not is judged, treatment choice is conducted, excessive medical treatment is avoided, and the purpose of personalized treatment is achieved. According to the system and different detection technology platforms, corresponding 11 gene expression measurement kits are designed and developed.

The invention discloses a tumor microenvironment component marker combination and system for predicting nasopharyngeal carcinoma prognosis. The tumor microenvironment component marker combination comprises a cell cycle proliferation component and at least one of five immune cell components including macrophages, plasmacytoid dendritic cells, CLEC9A + dendritic cells, natural killer cells and plasma cells. According to some examples of the invention, the expression levels of different components in a nasopharyngeal carcinoma tumor microenvironment can be predicted by calculating the expressionlevels of respective feature genes of one tumor cell component and five immunocyte components, and clinical prognosis prediction can be performed on a nasopharyngeal carcinoma patient, so that individualized treatment is facilitated, and finally, survival benefits are brought to the patient.

The invention relates to a mouse anti-human CIAPIN1 monoclonal antibody for confirming multi-drug resistant gastric cancer, and a preparation method thereof. The invention is characterized in that the monoclonal antibody is obtained by adopting the hybrid tumor technology; the heavy chain is 1gG1; the light chain is k; the molecular weight is 39KD; and the affinity is 3.6x10. The preparation method comprises the following steps of: (1) synthesizing primers; (2) synthesizing single-chain DNA by carrying out reverse transcription on SGC-7901 / VCR general RNA of a human gastric-cancer multi-drug resistant cell; (3) expanding human CIAPIN1 gene cDNA by using the primers F and R and by adopting a PCR method; (4) constructing CIAPIN1 gene induction expression plasmids pET28-CIAPIN1 and pGEX-CIAPIN1; (5) constructing engineering bacteria B21-CIAPIN1 and DE3-CIAPIN1; (6) using the engineering bacteria B21-CIAPIN1 and DE3-CIAPIN1 to carry out prokaryotic expression and purification on CIAPIN1 protein; (7) using CIAPIN1 protein to immunize a 4-week-old Balb / C mouse so that mouse anti-human CIAPIN1 antibody is generated; and (8) using the serum of the immunized mouse to prepare the mouse anti-human CIAPIN1 monoclonal antibody. The invention can better identify multi-drug resistant gastric cancer and non-multi-drug resistant gastric cancer of clinical gastric cancer patients, and predict clinical prognosis of the gastric cancer patients.

In a wide variety of human solid tumors, an aggressive, metastatic phenotype and poor clinical prognosis are associated with expression of the receptor tyrosine kinase Met. Disclosed herein are (a) a monoclonal antibody named Met4, which antibody is specific for Met, and (b) a hybridoma cell line that produces Met4. The Met4 antibody is particularly useful for detecting Met in formalin-fixed tissue. Methods of using the Met4 antibody for detection, diagnosis, prognosis, and evaluating therapeutic efficacy are provided.

The invention belongs to the technical field of biological medicine, provides an application of ZNF750 in screening a targeted medicine for treating esophageal squamous cell carcinoma, provides a novel target for blocking the metastasis of esophageal squamous cell carcinoma cells or inhibiting the change of the esophageal squamous cell carcinoma cells, and provides a treatment clue for patients with esophageal squamous cell carcinoma with ZNF750 variation. The invention provides the application of ZNF750 in screening the targeted medicine for treating the esophageal squamous cell carcinoma. The esophageal squamous cell carcinoma is esophageal squamous cell carcinoma with ZNF750 gene mutation, deletion, inactivation variation or ZNF750 low expression. The targeted medicine treats the esophageal squamous cell carcinoma by inhibiting or blocking angiogenesis-related gene expression of a downstream target gene of ZNF750. The detection of ZNF750 mutation can divide the patients with esophageal squamous cell carcinoma into two groups of mutant type and wild type, and the medicine targeted to KDR can provide effective treatment selection for the patients with ZNF750 inactivation variationand improve the clinical prognosis.

The present invention concerns polymorphisms in the epidermal growth factor receptor (EGFR), gene. In some embodiments, the present invention is directed at compositions and methods involving single nucleotide polymorphisms (SNPs) in the promoter of the EGFR gene that affect EGFR expression. The identification of polymorphisms associated with EGFR expression or activity enables novel methods and compositions for evaluating the potential efficacy and toxicity of an EGFR-targeting therapeutic agent, predicting a patient's clinical prognosis, and evaluating a patient's risk of developing a disease that is associated with EGFR dysregulation.

The invention discloses an application of a group of gastric cancer genes. In the invention, based on a group of 53 prognosis related genes in gastric cancer and the detection results of the expression levels thereof in clinical samples, the score is calculated and predicted to evaluate clinical prognosis of gastric cancer as well as related application thereof. The system can help the gastric cancer patients in treatment selection and can predict the reaction to treatment intervention so as to judge whether the patients profit from chemical and targeted therapy, excessive medication is avoided, the medical cost is reduced, and finally, an aim of accurate or individualized medicine is achieved. According to the system and different detection technology platforms, corresponding 53 gene expression measurement kits are designed and developed.

The invention belongs to the technical field of medical devices and particularly relates to an artery capturing and thrombus extraction stent and a thrombus extraction device, wherein the thrombus extraction stent comprises a mesh-tube shaped stent body which is formed by connecting multiple meshes; the stent body comprises a proximal end, a middle main body part and a distal end which are integrally formed and are connected with one another in a smooth transition manner, folds under the action of an external force and the stent body is released and recovered after the external force is eliminated; the proximal end of the stent body is in an approximately triangular shape after being laid and spread; the middle main body part is in an approximately rectangular shape after being laid and spread; and the distal end is of a blast cap shaped structure after being laid and spread. When the stent body is in a releasing state, the proximal end is of a conical structure with smaller proximal portion and larger distal portion, the middle main body part is of a cylinder structure, and the distal end is of tuck net structure with closed tail end. The thrombus extraction device comprises the artery capturing and thrombus extraction stent and a push-pull guide wire; and the stent body can be recovered into a thrombus extraction micro-catheter under the action of the push-pull guide wire. The artery capturing and thrombus extraction stent and the thrombus extraction device provided by the invention can prevent thrombus from escaping, increases the thrombus capturing rate and thus improves clinical prognosis and the life quality of a patient.

The invention provides a diabetic retinopathy related gene polymorphism rapid detection kit. The kit comprises multiplex PCR pre-amplification primers and single base extension primer sequences of 23 single nucleotide polymorphism (SNP) sites relates to diabetic retinopathy, a human peripheral blood genome DNA extraction liquid, multiplex PCR pre-amplification reaction liquid, a negative control, a positive control, a pre-amplification product purification reagent, PCR product single base extension reaction solution liquid, and a extension product purification reagent. The invention also provided a preparation method of the kit. According to the invention, diabetic retinopathy related SNP sites are detected by using a gene sequencing method with relatively high sensitivity and specificity, such that genotypes of the 23 diabetic retinopathy related gene polymorphism sites can be detected rapidly, effectively, accurately, and economically. Therefore, a reference is provided for diabetic retinopathy early diagnosis and clinical prognosis.

The invention provides a triad trocar device for deep tissue puncture. The triad trocar device comprises a thick puncture needle, a puncture cannula and a fine puncture needle; in the puncture process, when shallow tissue is punctured, the tips of the thick puncture needle, the puncture cannula and the fine puncture needle are aligned; when deep tissue is punctured, the puncture cannula and the fine puncture needle extend out of the first end of the thick puncture needle and pierce into the deep tissue together, then the fine puncture needle is withdrawn, and a channel is established between the deep tissue and the exterior of the body of a subject through the puncture cannula. By means of the puncturing device and method, important tissue organ damage can be reduced when the deep tissue is punctured, the sensitivity of the deep tissue during puncturing is increased, and the success rate of puncturing is improved, so that clinical prognosis is improved, and the device and method can beapplied to clinical practice such as pericardial effusion puncture drainage and subclavicular vein puncture catheterization, and have high clinical application value.

The present invention provides a system for determining a postoperative recurrent risk of a single HBV related primary liver carcinoma within 1 year. The system comprises an input device, a computingdevice and an output device, the computing device comprises a storage and a processor, a computer program is stored in the storage, the processor is configured to execute the computer program stored in the storage to achieve an algorithm of a discrimination function. The discrimination function returns the postoperative recurrent risk of the single HBV related primary liver carcinoma within 1 yearthrough the history of drinking, glutamyl transpeptidase (GGT), total serum protein content (TP) and alpha fetoprotein (AFP). Through baseline clinical features of biochemistry, virology and immunology, the system provided by the invention can determine the postoperative recurrent risk of the single HBV related primary liver carcinoma within 1 year and provides basis for clinical prognosis.

The invention provides a kit for adult AML (acute myeloid leukemia) risk stratification and clinical prognosis evaluation and an application of CPNE3, namely a gene chip and the kit for conducting risk stratification or clinical prognosis evaluation on patients with adult AML, wherein primer pairs of calcium-dependent membrane combined proteins copine III genes are used, and the sequences of one of the primer pairs are shown as agactcccacgaaactcagg (SEQ ID NO:2) and ctgtgcgctcaacctcatac (SEQ ID NO:3) or complementary sequences thereof, and the primer pairs are used for detecting the expression level of calcium-dependent membrane combined proteins in adult AML cells or tissues.

The invention provides a Chinese medicine composition for improving a cardiac function after myocardial infarction. The Chinese medicine composition is prepared from the following materials in parts by weight: 20-70 parts of astragalus membranaceus, 5-20 parts of trichosanthes kirilowii maxim fruit, 5-20 parts of allium macrostemon, and 5-20 parts of pinellia ternate. Pharmacological experiments and clinical application proves that the Chinese medicine composition can be used for improving the cardiac function after a myocardial infarction PCI (percutaileous coronary intervention) operation and improving clinical prognosis of a sufferer.

The invention discloses a reagent for detecting specific immune response of mycobacterium tuberculosis and use thereof. The invention discloses an immune positive reagent Rv0733 of mycobacterium tuberculosis by a gamma interferon release assay and a serum enzyme-linked immune method. The reagent comprises antigen or polypeptide and analogues thereof for detecting the specific cellular immunity of a tuberculosis sufferer and humoral immune response level. After the mice are immunized by using the reagent disclosed by the invention, the mice can generate specific cell factors such as gamma interferon and the like, and an antibody. T cells of tuberculosis patients or normal people are stimulated by using the reagent in vitro, the quantity of gamma interferon release cells is detected, or the content of gamma interferon in supernatant is cultivated, the tuberculosis patients can be distinguished from the normal people, the detection sensitivity and specificity of the tuberculosis sufferer can be improved by detecting the specific antibody level of resisting the reagent in the peripheral serum, and the clinical prognosis conditions of the tuberculosis patients can be disclosed by utilizing an Rv0733 specific immune response contrast experiment in the process of tracking treatment of the tuberculosis sufferer.

The invention discloses a patient prognosis risk marker and application thereof. The marker can be used for diagnosis, detection and clinical prognosis evaluation of hematological malignant tumors, leukemia and particularly acute myelogenous leukemia. The invention further discloses a detection object of the marker and a method and kit for diagnosis, detection and clinical prognosis evaluation of hematological malignant tumors, leukemia and particularly acute myelogenous leukemia and application. According to computer algorithms and biological experimental verification, the TSEN34 gene is an independent risk factor of hematological malignant tumors, leukemia and particularly acute myelogenous leukemia and can be used for playing a major role in hierarchical diagnosis and prognosis evaluation independently or together with other markers, decision support can be provided for clinical treatment, and the basis is provided for treatment scheme selection or determination.

The invention belongs to the technical field of biological medicines, and provides an application of a zinc finger protein 750 gene in preparing a diagnosis reagent for esophageal squamous cell carcinoma, and the application solves the technical problems that in the prior art, the molecular targets of diagnosis and prognosis information of patients with esophageal squamous cell carcinoma are veryfew, and the judgment standards are different. ZNF750 gene coding region mutation and gene copy number deletion are used as molecular markers for diagnosing esophageal squamous cell carcinoma patients. The invention provides an application of the zinc finger protein 750 gene in preparing a prognostic reagent for evaluating the prognosis of the patient with the esophageal squamous cell carcinoma, and the ZNF750 coding region mutation and the gene copy number deletion are used as molecular markers for predicting the prognosis of the patient with the esophageal squamous cell carcinoma. The ZNF750mutation and the copy number deletion esophageal squamous cell carcinoma patients are judged to have poor clinical prognosis, and the esophageal squamous cell carcinoma patients without ZNF750 mutation or copy number are judged to have good clinical prognosis.

The invention provides a method of a biomarker for identifying renal transplantation prognosis and a detection kit for identifying the renal transplantation prognosis. The biomarker is a ratio of freemannose and glucose obtained by pre-column 1-phenyl-5-methyl pyrazolone (PMP) derivatization high performance liquid chromatography in serum. The detection method is a pre-column PMP derivatization high performance liquid chromatography method. The technical scheme has the advantages that the pretreatment is simple, the analysis time is short, the instrument price is reasonable, the conventionaluse requirements are met, the operation steps are simple and easy to learn, the accuracy of a detection result is high, only blood collection is needed, the needed serum amount is extremely small, theblood collection amount is smaller than 1 mL, and the like. The obtained result shows that the analysis method can quickly quantify the free mannose and glucose in the serum of a renal transplantation prognosis patient, and has very important significance for researching a relation between the free mannose and glucose in the serum and the renal transplantation prognosis, and finding a novel clinical prognosis monitoring marker for the renal transplantation prognosis.

The invention relates to a tumor genome copy number variation characteristic pattern recognition method and application thereof, and belongs to the technical field of gene diagnosis. According to themethod, systematic classification is carried out on tumor genome copy number variation characteristics, 80 numerical values of eight types of tumor genome copy number variation characteristics are specifically extracted, a copy number variation characteristic mode of a tumor sample is extracted by utilizing a non-negative matrix factorization algorithm, and then the tumor is typed according to thecopy number variation characteristic mode. Therefore, accurate prediction of clinical prognosis of tumors can be realized.

The present invention provides a method for determining the clinical prognosis of a human subject to the administration of a pharmaceutical composition comprising of stem cells (preferably mesenchymal stem cells), stromal cells, regulatory T-cells, fibroblasts and combinations thereof.