Detection kit for detecting JAK2V617F mutation

By providing a detection kit for the JAK2V617F mutation, and utilizing specific primers and fluorescent PCR technology, the difficulty in identifying PV in diagnosis has been solved, enabling rapid and convenient PV diagnosis and identification, and improving the accuracy of detection.

CN120966962APending Publication Date: 2025-11-18SHANDONG MAIZI BIOTECHNOLOGY CO LTD
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202511185681.8
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-08-22
Publication Date
2025-11-18

AI Technical Summary

Technical Problem

In the current technology, the diagnosis of PV mainly relies on clinical manifestations, laboratory tests and pathological morphological analysis. There is a lack of effective JAK2 gene mutation detection methods, which makes it difficult to differentiate PV from reactive hyperplasia, and there is a lack of treatment methods that can change the course of the disease.

Method used

A detection kit for detecting the JAK2V617F mutation is provided, comprising inner primer pairs, outer primer pairs, and a specific probe for specifically amplifying the JAK2V617F mutant gene, combined with PCR reaction buffer and real-time PCR technology, to detect the mutation in blood samples through a closed-tube reaction.

Benefits of technology

It enables rapid and convenient diagnosis and identification of PV, improves the sensitivity and specificity of detection, reduces the risk of contamination, and is suitable for clinical prognosis assessment.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure BDA0005562036970000051
    Figure BDA0005562036970000051
  • Figure BDA0005562036970000052
    Figure BDA0005562036970000052
Patent Text Reader

Abstract

The invention discloses a detection kit for detecting JAK2V617F mutation, which is characterized by comprising: a JAK2V617F detection reagent, which comprises an inner primer pair, an outer primer pair and a specific probe for specifically amplifying a JAK2V617F mutant gene; the internal reference detection reagent comprises a primer pair and a probe of an internal reference gene; the PCR reaction buffer solution comprises a reaction mixed solution and a HotstartTaq enzyme; the kit comprises a positive control, a known proportion of V617F mutant DNA, a negative control, a JAK2V617F wild type DNA, a positive control and a known proportion of V617F mutant DNA. Compared with the prior art, the invention has the advantage of providing the detection kit for detecting JAK2V617F mutation, which can be used for diagnosis, identification and clinical prognosis of PV.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of reagent kit technology, specifically to a reagent kit for detecting the JAK2V617F mutation. Background Technology

[0002] Myeloproliferative neoplasm (MPN) is a group of hematopoietic stem cell tumors that are characterized by the proliferation of a particular cell line on the basis of generalized bone marrow cell proliferation, exhibiting continuous and excessive proliferation.

[0003] Clinically, based on the different cell lineages that predominate in proliferation, it is divided into four types: polycythemia vera (PV), which is dominated by erythroid lineage proliferation; essential thrombocythemia (ET), which is dominated by megakaryocyte lineage proliferation; primary myelofibrosis (PMF), which is dominated by profibroblast proliferation; and chronic myeloid leukemia (CML), which is dominated by granulocytic lineage proliferation.

[0004] PV is a clonal, chronic myeloproliferative neoplasm characterized primarily by abnormal proliferation of erythrocytes. PV is a chronic disease with a long course, and its routine diagnosis currently relies on a comprehensive assessment of clinical manifestations, laboratory tests, and pathological morphology. Because reactive hyperplasia and MPN share the same laboratory characteristic of increased peripheral blood cell counts, and given the atypical clinical symptoms of MPN, differentiating between different types of MPN and reactive hyperplasia has always been a challenging clinical problem.

[0005] In 2016, the WHO revised its primary and secondary diagnostic criteria for PV, officially incorporating JAK2 gene mutation testing into the primary diagnostic criteria for PV. Currently, PV treatment primarily focuses on preventing complications such as thrombosis, and there is a lack of drugs that can alter the natural course of PV or prevent its progression to MF / AML. Because there is no specific treatment for PV, prevention remains the main focus, making its diagnosis particularly important. Summary of the Invention

[0006] The technical problem to be solved by the present invention is to overcome the above-mentioned technical defects and provide a detection kit for JAK2V617F mutation that can be used for the diagnosis, identification and clinical prognosis of PV.

[0007] To solve the above-mentioned technical problems, the technical solution provided by the present invention is: a detection kit for JAK2V617F mutation, comprising:

[0008] The JAK2V617F detection reagent includes inner primer pairs, outer primer pairs, and specific probes for specifically amplifying the JAK2V617F mutant gene;

[0009] Internal reference detection reagents, including primer pairs and probes for the internal reference gene;

[0010] PCR reaction buffer, including reaction mixture and HotstartTaq enzyme;

[0011] Positive control, known proportion of V617F mutant DNA

[0012] Negative control, JAK2 V617F wild-type DNA.

[0013] Preferably, in the JAK2V617F detection reagent:

[0014] The forward primer Tm value of the inner primer pair is 68.5℃, and the reverse primer Tm value is 69.2℃.

[0015] The forward primer Tm value of the outer primer pair is 56.67℃, and the reverse primer Tm value is 58.65℃;

[0016] The Tm value of the probe for the JAK2V617F mutant gene was 65.19℃.

[0017] Preferably, the inner primer pair sequence in the JAK2V617F detection reagent is:

[0018] Positive: TCTCACAAGCATTTGGTTTTAAATTATGGAGTATCTT;

[0019] Reverse: CTTTTAACTTCATTGCTTTCCTTTTTCACAAGA.

[0020] Preferably, the sequence of the outer primer pair in the JAK2V617F detection reagent is as follows:

[0021] Positive: TGGTTTTAAATTATGGAGTATGTT;

[0022] Reverse: CTACAGTGTTTTCAGTTTCAAAAA.

[0023] Preferably, the specific probe sequence in the JAK2V617F detection reagent is:

[0024] HEX-AAATTCAGTTTCAGGATCACAGCTAGG-BHQ1.

[0025] Preferably, in the internal reference detection reagent:

[0026] The forward primer Tm value is 57.06℃, and the reverse primer Tm value is 57.69℃.

[0027] The probe's Tm value is 64.09℃.

[0028] Preferably, the internal reference gene is β-actin, and the primer pair sequence of the internal reference gene is as follows:

[0029] Positive: ATGAAGGCTTTTGGTCTC;

[0030] Reverse: ACTCTGGGTAAGGACAAG;

[0031] The internal reference gene probe sequence is as follows:

[0032] FAM-AAATGAGGCCAAGTGTGACTTTG-BHQ1.

[0033] Preferably, the reaction mixture comprises 1 mM MgCl2, 10 mM Tris-HCl, 50 mM KCl, 0.1% Triton X-100, 200 μM dNTP, 0.25 pmol of each primer, and 0.1 pmol of each probe primer.

[0034] The advantages of this invention compared with the prior art are as follows: the reagent kit provided by this invention only requires the collection of the patient's blood during detection, and the operation is convenient and quick, with good sensitivity and specificity, and has good application value and prospects.

[0035] Only a fluorescent PCR instrument is needed; closed-tube reaction reduces the risk of contamination.

[0036] The kit is used to first enrich the mutant template with inner primers at a high annealing temperature, and then amplify the mutant template with outer primers at a low annealing temperature while collecting signals, thus improving the detection limit of the kit. Detailed Implementation

[0037] The present invention will now be described in further detail.

[0038] A JAK2V617F mutation detection kit uses DNA extracted from blood samples as a template and employs an amplification arrest mutation system combined with TaqMan real-time PCR technology to detect JAK2 V617F mutations in the samples. Mutation detection for each sample is performed in the same tube. This kit determines the presence or absence of mutations by comparing the Ct values ​​of the positive control and the sample wells.

[0039] Includes: JAK2V617F detection reagent, including inner primer pairs, outer primer pairs, and specific probes for specifically amplifying the JAK2V617F mutant gene;

[0040] Internal reference detection reagents, including primer pairs and probes for the internal reference gene;

[0041] PCR reaction buffer, including reaction mixture and HotstartTaq enzyme;

[0042] Positive control, known proportion of V617F mutant DNA

[0043] Negative control, JAK2 V617F wild-type DNA.

[0044] In specific implementation of the present invention,

[0045] DNA sequence

[0046] JAK2 V617F wild-type sequence

[0047] TCTCACAAGCATTTGGTTTTAAATTATGGAGTATGTGTCTGTGGACGAGAGTAAGTAAAACTACAGGCTTTCTAATGCCTTTCTCAGAGCATCTGTTTTTGTTTATAGAAAATTCAGTTTCAGGATCACAGCTAGGTGTCAGTGTAAACTATAATTTAACAGGAGTTAAGTATTTTTGAAACTGAAAACACTGTAGGACTATTCAGTTATATCTTGTGAAAAAGGAAAGCAATGAAGTTAAAAG

[0048] JAK2 V617F Wild-type Sequence 2

[0049] CATGCTGAAAGTAGGAGAAAGTGCATCTTTATTATGGCAGAGAGAATTTTCTGAACTATTTATGGACACAGTCAAACAACAATTCTTTGTACTTTTTTTTTTCCTTAGTCTTTCTTTGAAGCAGCAAGTATGATGAGCAAGCTTTCTCACAAGCATTTGGTTTTAAATTATGGAGTATGTGTCTGTGGAGACGAGAGTAAGTAAA

[0050] TCTGCACATTCTTAATTCTTTAGCAAGTGTTATTTAAAGGCTACATCCATCTACCTCAGTTTCCTATATCTATCTCTGACATCTACCTCTAGTTGTACTTCTGTCCTCTATTTCAGGTGTTATGGGTCAAGCCTGTTTGACTGGCATTATTCATGATTCCTGTACCACTCTTGCTCTCTCTCACTTTGATCTCCATATTCCAGGCTTACACAGGGGTTTCCTCAGAACGTTGATGGCAGTTGCAGGTCCATATAAAGGGACCAAAGCACATTGTATCCTCATCTATAGTCATGCTGAAAGTAGGAGAAAGTGCATCTTTATTATGGCAGAGAGAATTTTCTGAACTATTTATGGACAACAGTCAAACAACAATTCTTTGTACTTTTTTTTTTCCTTAGTCTTTCTTTGAAGCAGCAAGTATGATGAGCAAGCTTTCTCACAAGCATTTGGTTTTAAATTATGGAGTATGTGTCTGTGGAGACGAGAGTAAGTAAAACTACA

[0051] JAK2F3 forward primer: aCGCACGCCAACATCATGCTGAAAGTAGGAGAAAGTG 61.54ACGCACGCCAACATGGACAACAGTCAAACAACAA

[0052] GACAACAGTCAAACAACA / GATTC

[0053] JAK2R3 reverse primer: aCGCACGCCAACATTTTACTTACTCTCGTCTCCACAGAA 61.21

[0054] TTACTCTCGTCTCCACAGAA

[0055] Adapter 3: ATCCAGTACAAGAAAGCCTC

[0056] JAK2F4: GACAACAGTCAAACAACAATTC 58.88

[0057] JAK2F4C: ACAACAGTCAAACAACCATTC 59.57

[0058] JAK2R4: TTACTCTCGTCTCCACAGAA 59.91

[0059] JAK2R4T: TTACTCTCGTCTCCACATAA 57.48

[0060] JAK2R4A: TTACTCTCGTCTCCACAAAA 58.59

[0061] JAK2R4AG:TTACTCTCGTCTCGACAAAA 58.69

[0062] JT3:ATCCAGTACAAGAAAGCCTC 59.39

[0063] JAK2F5:ATCCAGTACAAGAAAGCCTCGACAACAGTCAAACAACAATTC

[0064] JAK2F5C:ATCCAGTACAAGAAAGCCTCACAACAGTCAAACAACCATTC

[0065] JAK2R5: ATCCAGTACAAGAAAGCCTCTTACTCTCGTCTCCACAGAA

[0066] JAK2R6: ATCCAGTACAAGAAAGCCTCTTACTCTCGTCTCCACAAAA

[0067] JAK2RddC: TACTTACTCTCGTCTCCACAAA-ddC

[0068] Placeholder: Thio - A*C*A*GACACATACTCC - MGB 50.10

[0069] JAK2P3:FAM - CTTGCTCATCATACTTGCTGCTTCA - BHQ1 65.76

[0070] JT4:CAGTTCTACAACTTCCTCAACC 60.90

[0071] JAK2F6: CAGTTCTACAACTTCCTCAACCACAACAGTCAAACAACCATTC

[0072] JAK2P2 Probe Primer: FAM - TGAAGCAGCAAGTATGATGAGCAAG - BHQ1 65.76

[0073] TGCTGCTTCAAAGAAAGACTAAGGA 64.62

[0074] TTGCTCATCATACTTGCTGCTTC 63.74

[0075] CTCATCATACTTGCTGCTTCAAAGAAAG 64.81

[0076] Adapter 2: aCGCACGCCAACAT 58.70

[0077] TTATGGAGTATGTGTCTGTGGAGACGAGAGTAAGTAAAACTACAGGCTTTCTAATGCCTTTCTCAGAGCATCTGTTTTTGTTTATATAGAAAATTCAGTTTCAGGATCACAGCTAGGTGTCAGTGTAAACTATAATTTAACAGGAGTTAAGTATTTTTGAAACTGAAAACACTGTAGGACTATTCAGTTATATCTTGTGAAAAAGGAAAGCAATGAAGTTAAAAGTAGAAGGTTACAATGCCCAAACAATAGAGTATTATAGTAAACAAATGTCTATAAAACATTTTGTGTTCATGATAGCAAAAGAGATTATGGCAGGTTCAACATAACATTGGAATAACTGGCCTTTTCAGTACAAA

[0078] JAK2 V617F mutant sequence

[0079] TCTCACAAGCATTTGGTTTTAAATTATGGAGTATGTTTCTGTGGAGACGAGAGTAAGTAAAACTACAGGCTTTCTAATGCCTTTCTCAGAGCATCTGTTTTTGTTTATATAGAAAATTCAGTTTCAGGATCACAGCTAGGTGTCAGTGTAAACTATAATTTAACAGGAGTTAAGTATTTTTGAAACTGAAAACACTGTAGGACTATTCAGTTATATCTTGTGAAAAAGGAAAGCAATGAAGTTAAAAG

[0080] JAK2 V617F mutant sequence 2

[0081] CATGCTGAAAGTAGGAGAAAGTGCATCTTTATTATGGCAGAGAGAATTTTCTGAACTATTTATGGACACAGTCAAACAACAATTCTTTGTACTTTTTTTTTTCCTTAGTCTTTCTTTGAAGCAGCAAGTATGATGAGCAAGCTTTCTCACAAGCA

[0082] TTTGGTTTTAAATTATGGAGTATGTTTCTGTGGAGACGAGAGTAAGTAAA

[0083] TTTACTTACTCTCGTCTCCACATAA

[0084] Primer and probe sequences:

[0085] Table 1 Primers for JAK2V617F mutation detection

[0086]

[0087] JAK2F2:TCAGTGTAAACTATAATTTAACAGG 56.67

[0088] JAK2R2':CCTGTTAAATTATAGTTTACACTGA 56.97

[0089] JAK2F6:AAAGGTATCGAGAGGAGTTCAGTGTAAACTATAATTTAACAGG

[0090] JAK2R6:AAAGGTATCGAGAGGAGTCCTGTTAAATTATAGTTTACACTGA

[0091] Preliminary establishment of the PCR reaction system:

[0092] Table 2. ARMS fluorescent PCR reaction system (40 μL)

[0093]

[0094] The 35 μL reaction mixture includes: 1 mM MgCl2, 10 mM Tris-HCl, pH 9.0, 50 mM KCl, 0.1% Triton X-100, 200 μM dNTP, 0.25 pmol of each primer, and 0.1 pmol of each probe primer.

[0095] ARMS-PCR reaction procedure

[0096] ARMS-PCR reaction procedure: Step 1: 95℃ for 5 min, 1 cycle; Step 2: 95℃ for 20 s, 68℃ for 20 s, 17 cycles; Step 3: 95℃ for 20 s, 60℃ for 20 s, 50 cycles. Fluorescence signals are collected during Step 3. When using a fluorescence PCR instrument, all reactions are performed in the same sealed tube.

[0097] Preparation of wild-type and mutant plasmids

[0098] Standard positive templates: The wild-type JAK2 V617 sequence and the mutant JAK2 V617F sequence were synthesized by Shanghai Sangon Biotech Co., Ltd., respectively, to obtain wild-type and mutant plasmids.

[0099] Standard negative template: The negative control standard is sterile water without nucleic acid.

[0100] ARMS-PCR Sensitivity Assay

[0101] The mutant plasmid standard was serially diluted and thoroughly mixed at concentrations of 50%, 10%, 5%, 1%, 0.5%, 0.1%, 0.05%, 0.01%, 0.005%, 0.001%, negative control, and blank control compared to the wild-type plasmid standard. Based on the principle that 1 copy of human genomic DNA is approximately equal to 3 pg, wild-type and mutant DNA were added separately. Following the PCR reaction system and procedure established for this project, 4.7 μL of the above-mentioned mixed template was used for each experiment, with three replicates per sample, to analyze the detection sensitivity.

[0102] ARMS-PCR Specificity Assay

[0103] Wild-type plasmid standards were prepared in series of doses: 5 ng, 10 ng, 15 ng, 20 ng, 25 ng, 30 ng, 35 ng, 40 ng, 45 ng, 50 ng, positive control, and blank control. Each group was tested in triplicate to detect non-specific amplification CT values. Then, specific detection was performed according to the PCR reaction system and procedure established for this project.

[0104] Internal reference excerpt:

[0105] ATGAAGGCTTTTGGTCTCCCTGGGAGTGGGTGGAGGCAGCCAGGGCTTACCTGTACACTGACTTGAGACCAGTTGAATAAAAGTGCACACCTTAAAAAATGAGGCCAAGTGTGACTTTGTGGTGTGGCTGGGTTGGGGGCAGCAGAGGGTGAACCCTGCAGGAGGGTGAACCCTGCAAAAGGGTGGGG CAGTGGGGGCCAACTTGTCCTTACCCAGAGT

[0106] Working principle of the invention:

[0107] Normal genes: DNA double helix arranged in an orderly manner, performing normal physiological functions.

[0108] Abnormal genes: The DNA double helix exhibits disordered structure and arrangement in certain specific regions, appearing in the form of point mutations, deletions, translocations, rearrangements, etc.

[0109] ARMS technology is used, a novel method developed from PCR for detecting point mutations in DNA. Its basic principle is that Taq DNA polymerase lacks 3'→5' exonuclease activity. Therefore, for primers with mismatched 3' ends, extension occurs at a slower rate than with primers that pair normally. When the number of mismatched bases reaches a certain level or the conditions become too stringent, the 3' end bases cannot extend due to difficulties in forming phosphodiester bonds, terminating the reaction and resulting in the absence of a specific length of amplified fragment. This indicates that the template DNA does not contain a mutation corresponding to the 3' end of the primer. If the PCR result yields a specific length of amplified fragment, it indicates that the template DNA contains a mutation corresponding to the 3' end of the primer.

[0110] The present invention and its embodiments have been described above. This description is not restrictive. In short, if a person skilled in the art is inspired by this description and designs a similar structure and embodiment without departing from the spirit of the present invention, such design should fall within the protection scope of the present invention.

Claims

1. A detection kit for JAK2V617F mutation, characterized in that: include: The JAK2V617F detection reagent includes inner primer pairs, outer primer pairs, and specific probes for specifically amplifying the JAK2V617F mutant gene; Internal reference detection reagents, including primer pairs and probes for the internal reference gene; PCR reaction buffer, including reaction mixture and HotstartTaq enzyme; Positive control, known proportion of V617F mutant DNA Negative control, JAK2 V617F wild-type DNA.

2. The detection kit for JAK2V617F mutation according to claim 1, characterized in that: In the JAK2V617F detection reagent: The forward primer Tm value of the inner primer pair is 68.5℃, and the reverse primer Tm value is 69.2℃. The forward primer Tm value of the outer primer pair is 56.67℃, and the reverse primer Tm value is 58.65℃; The Tm value of the probe for the JAK2V617F mutant gene was 65.19℃.

3. The detection kit for JAK2V617F mutation according to claim 2, characterized in that: The sequence of the inner primer pair in the JAK2V617F detection reagent is as follows: Positive: TCTCACAAGCATTTGGTTTTAAATTATGGAGTATCTT; Reverse: CTTTTAACTTCATTGCTTTCCTTTTTCACAAGA.

4. The detection kit for JAK2V617F mutation according to claim 2, characterized in that: The sequence of the outer primer pair in the JAK2V617F detection reagent is as follows: Positive: TGGTTTTAAATTATGGAGTATGTT; Reverse: CTACAGTGTTTTCAGTTTCAAAAA.

5. The detection kit for JAK2V617F mutation according to claim 2, characterized in that: The specific probe sequence in the JAK2V617F detection reagent is: HEX-AAATTCAGTTTCAGGATCACAGCTAGG-BHQ1.

6. The detection kit for JAK2V617F mutation according to claim 1, characterized in that: In the internal reference detection reagent: The forward primer Tm value is 57.06℃, and the reverse primer Tm value is 57.69℃. The probe's Tm value is 64.09℃.

7. The detection kit for JAK2V617F mutation according to claim 6, characterized in that: The internal reference gene is β-actin, and the primer pair sequence of the internal reference gene is as follows: Positive: ATGAAGGCTTTTGGTCTC; Reverse: ACTCTGGGTAAGGACAAG; The internal reference gene probe sequence is as follows: FAM-AAATGAGGCCAAGTGTGACTTTG-BHQ1.

8. A detection kit for JAK2V617F mutation according to any one of claims 1-7, characterized in that: The reaction mixture includes 1 mM MgCl2, 10 mM Tris-HCl, 50 mM KCl, 0.1% Triton X-100, 200 μM dNTP, 0.25 pmol of each primer, and 0.1 pmol of each probe primer.