Corn phosphatidyl phospholipase C4 and its coding gene and application thereof in enhancing disease resistance
By transferring the maize phosphatidylphospholipase C4 gene into rice, the problem of the susceptibility of rice varieties to disease resistance was solved, achieving broad-spectrum resistance to rice blast and bacterial blight without affecting yield.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- CHINA AGRI UNIV
- Filing Date
- 2025-02-21
- Publication Date
- 2026-06-05
AI Technical Summary
The resistance of existing rice varieties to rice blast and bacterial blight is susceptible to the evolution of pathogens, and the transfer of disease-resistant genes poses a challenge to yield.
By transferring the maize phosphatidylphospholipase C4 (ZmPIPLC4ef) gene into rice, cross-species transformation can enhance rice's resistance to rice blast and bacterial blight while maintaining yield.
This study demonstrated that the ZmPIPLC4ef gene achieves broad-spectrum resistance to rice blast and bacterial blight without affecting rice yield, thus proving its effectiveness in enhancing rice disease resistance.
Smart Images

Figure HDA0005282105180000011 
Figure HDA0005282105180000012 
Figure HDA0005282105180000021
Abstract
Description
Technical Field
[0001] This invention belongs to the field of genetic engineering technology, specifically relating to the corn phosphatidylphospholipase C4 gene and its application in enhancing disease resistance. Background Technology
[0002] Rice (Oryza sativa) is one of the three major food crops alongside wheat (Triticum aestivum) and maize (Zea mays), providing food for more than half of the world's population. Therefore, ensuring sustainable rice production is crucial for global food security. However, this crop is increasingly threatened by various diseases, including rice blast caused by the ascomycete Magnaportheoryzae and bacterial blight caused by the Gram-negative fungus Xanthomonas oryzae pv. oryzae (Savary S, Willocquet L, Pethybridge SJ, Esker P, McRoberts N, Nelson A (2019) The global burden of pathogens and pests on major foodcrops. Nature Ecology & Evolution 3(3):430–439). Developing resistant cultivars offers a cost-effective and environmentally sustainable strategy for managing these diseases. However, the rapid evolution of pathogens often erodes the inherent resistance of cultivars. Therefore, expanding the genetic base through cross-species transfer of disease-resistant genes provides a promising, sustainable, and environmentally friendly approach to enhancing the disease resistance of rice.
[0003] PIPLCs are ubiquitous enzymes that hydrolyze the phosphodiester bonds in phosphatidylinositol (such as phosphatidylinositol-4,5-bisphosphate (PIP2) located in the inner leaf of the cell membrane) to generate two secondary messengers (inositol-1,4,5-triphosphate [IP3] and diacylglycerol [DAG]) (Arisz SA, Testerink C, Munnik T (2009) Plant PA signaling via diacylglycerol kinase. Biochimica et Biophysica Acta 1791:869–875). IP3 diffuses from the plasma membrane to the cell membrane and binds to the IP3 receptor (Ca) on the endoplasmic reticulum (ER). 2+ (Channel) Combining. This combination causes the channel to open, allowing Ca to... 2+ Released from the ER into the cytoplasm (Murray SC, et al. (2023) Genetic modification can improve crop yields - but stop overselling it. Nature 621(7979):470–473). Cell membrane Ca 2 A surge in NADPH levels activates NADPH oxidase, leading to the production of reactive oxygen species (ROS). The resulting ROS regulates the calcium... 2+ This channel forms a positive feedback loop. DAG can still resist the plasma membrane and is phosphorylated by DAG kinase (DGK) to produce phosphatidic acid. It has been reported that both Arabidopsis PIPLC1 and rice PIPLC4 contain EF-hand-like domains, which can regulate cytoplasmic calcium... 2+ Levels modulate salt tolerance (Li L, Wang F, Yan P, Jing W, Zhang C, Kudla J, Zhang W (2017) A phosphoinositide-specific phospholipase C pathway elicits stress-induced Ca 2+ signals and confers salttolerance to rice. New Phytologist 214(3):1172–1187; 40(8):1317–1331).
[0004] Here we report a phosphorylated inositol lipase C4 ef Gene (ZmPIPLC4) ef (GenBank accession number Zm00001d007229) Transplantation from maize to rice yields resistance to rice blast and bacterial blight without affecting yield. ZmPIPLC4 ef Successful cross-species transformation in rice demonstrates its potential as a valuable genetic resource to enhance resistance to fungal and bacterial pathogens without affecting crop yield. This study highlights the importance of leveraging maize genetic diversity to improve rice's resistance to epidemics, thereby contributing to sustainable agricultural practices. Summary of the Invention
[0005] The purpose of this invention is to expand the genetic base of rice through cross-species transfer of disease-resistant genes, providing a promising, sustainable, and environmentally friendly method for enhancing the disease resistance of rice.
[0006] Based on this, the present invention provides an application of the maize gene phosphatidylphospholipase C4, which can confer broad resistance to transgenic rice without affecting rice yield, and can serve as a candidate gene to provide elements for disease-resistant breeding.
[0007] Specifically, this invention provides the application of maize phosphatidylphosphatase C4 or its encoding gene in enhancing plant disease resistance, wherein the maize phosphatidylphosphatase C4 protein is the protein shown in 1) or 2) below:
[0008] 1) A protein consisting of the amino acid residue sequence of SEQ ID No. 2 in the sequence listing;
[0009] 2) A protein derived from SEQ ID No. 1 with one or more amino acid residues of the amino acid sequence of SEQ ID No. 2 in the sequence listing replaced and / or deleted and / or added, and having the function of corn phosphatidylphospholipase C4.
[0010] The cDNA nucleotide sequence of the encoding gene is shown in 1), 2), or 3) below:
[0011] 1) The nucleotide sequence of SEQ ID No. 1 in the sequence listing;
[0012] 2) A nucleotide sequence that can hybridize with the DNA sequence described in 1) under stringent conditions;
[0013] 3) A nucleotide sequence that has more than 90% homology with the nucleotide sequence of SEQ ID No.:1 in the sequence listing and that encodes a protein that functions as the corn phosphatidylphospholipase C4 gene.
[0014] The preferred plant is rice.
[0015] The disease resistance refers to the resistance of rice to rice blast caused by Magnaphalium oryzae and / or rice bacterial blight caused by Xanthomonas oryzae.
[0016] The present invention also provides a method for improving plant disease resistance, which involves transferring the encoding gene of maize phosphatidylphospholipase C4 shown in SEQ ID No. 2 into plants and screening to obtain transgenic plants with improved disease resistance.
[0017] Wherein, the plant is rice, and the disease resistance refers to the resistance of rice to rice blast caused by Magnaphalthe oryzae and / or rice bacterial blight caused by Xanthomonas oryzae.
[0018] This invention cloned phosphatidylphosphatase 4 (GenBank accession number Zm00001d007229) from maize and named it ZmPIPLC4. ef Gene. The cDNA of this gene is 1764 bp, and its nucleotide sequence is shown in SEQ ID NO:1 of the sequence listing; it encodes a 587 aa protein, and its amino acid sequence is shown in SEQ ID NO:2 of the sequence listing. The protein contains three domains: the X and Y catalytic domains of phospholipase C (PLCXc and PLCYc) and the conserved region 2 (C2) of protein kinase C (…). Figure 1 This trigonal domain structure is conserved in plant and animal PIPLCs (Abd-El-Haliem AM, Joosten MH (2017) Plant phosphatidylinositol-specific phospholipase C at the center of plant innate immunity. Journal of Integrative Plant Biology 59(3):164–179.); however, ZmPIPLC4ef differs from other PIPLCs in that it lacks an EF-hand-like domain at its N-terminus, which is involved in calcium ion binding. Similar to plant and animal PIPLCs, the catalytic X and Y domains of ZmPIPLC4ef form a (βα)8-barrel structure, similar to the barrel structure of trisaccharide phosphatidylisomerases ( Figure 2 ).
[0019] To study ZmPIPLC4 ef Whether ZmPIPLC4 is localized to the plasma membrane like typical PIPLCs, we transiently co-expressed ZmPIPLC4 in tobacco leaves under the control of the 35S promoter via agricultural infiltration. ef -GFP and AtPIP2-mCherry (plasma membrane markers). ZmPIPLC4 ef The GFP signal of -GFP and the RFP signal of AtPIP2-RFP overlap on the plasma membrane of tobacco epidermal cells. Figure 3 A). We further used ZmPIPLC4 ef -GFP transfected maize protoplasts and stained with the endocytosis / membrane tracer FM4-64. In maize protoplasts, ZmPIPLC4... ef-GFP's GFP signal overlaps with FM4-64 ( Figure 3 B) confirms ZmPIPLC4 ef Location on the plasma membrane.
[0020] To evaluate ZmPIPLC4 ef Regarding its role in cross-species disease resistance, we generated overexpression of ZmPIPLC4 under the control of the Ubi promoter. ef Transgenic lines of the japonica rice cultivar Zhonghua 11 (ZH11), including OsZmPIPLC4 ef -1、OsZmPIPLC4 ef -8 and OsZmPIPLC4 ef -14( Figure 4 Select OsZmPIPLC4 ef -8 and OsZmPIPLC4 ef -14 line (T2) was further evaluated. The yield components of the transgenic line and ZH11 were rigorously evaluated in accordance with the randomized complete block design and related best practices outlined by Khaipho-Burch et al. (2023) and Wang et al. (2023) Genetic modification can improve crop yields-but stopoversellingit. Nature 621(7979):470–473; Wang Y, Yue J, Yang N, Zheng C, Zheng Y, Wu X, Yang J, Zhang H, et al. (2023). An ERAD-related ubiquitin-conjugating enzyme boosts broad-spectrum disease resistance and yield in rice. Nature Food 4(9):774–787. Comparative analysis of the yield components of harvested crops revealed that the transgenic line (OsZmPIPLC4) ef -8 and OsZmPIPLC4 ef -14) and ZH11 in ear length ( Figure 5 A) Grain size ( Figure 5 B, C), 1000-grain weight ( Figure 5 D; p>0.01) and weight of grains per pouch ( Figure 5There were no significant differences in E; p>0.01, etc. These results indicate that ZmPIPLC4 ef Expression of these genes did not negatively affect grain yield in the transgenic rice lines. We further evaluated the resistance of these transgenic lines to major fungal and bacterial diseases affecting rice production. We compared ZH11 and OsZmPIPLC4... ef -8 and OsZmPIPLC4 ef Phenotypic analysis was performed on the responses of the -14 transgenic lines to rice blast strain SZ5 and bacterial blight pathogen PXO99A. The transgenic lines exhibited quantitative resistance to rice blast; six days after inoculation, the number of rice blast lesions on inoculated leaves decreased. Figure 6 A) Leaf area significantly reduced due to rice blast (OsZmPIPLC4) ef -8 and OsZmPIPLC4 ef The lesion area at -14 cm² was 0.28 cm². 2 and 0.24cm 2 ZH11 is 1.29cm. 2 ()( Figure 6 B; p<0.001). Similarly, the transgenic lines showed quantitative resistance to bacterial wilt (B; p<0.001). Figure 7 A), the lesion length significantly decreased after 14 dpi (OsZmPIPLC4). ef -8 and OsZmPIPLC4 ef The lesion lengths for -14 were 0.50 cm and 0.34 cm, respectively, while those for ZH11 were 2.50 cm. Figure 7 B; p<0.001). These data confirm that OsZmPIPLC4 ef It can generate broad-spectrum, cross-variety resistance without causing yield loss.
[0021] Beneficial effects of the present invention
[0022] 1.OsZmPIPLC4 ef When transgenic rice plants were inoculated with rice blast fungus and rice xanthomonas oryzae under the same conditions, the disease incidence was significantly reduced compared with wild-type Zhonghua 11, and the area and length of lesions were significantly decreased, indicating that the gene has a certain degree of broad resistance to rice pathogens.
[0023] 2.OsZmPIPLC4 ef When assessing yield, the transgenic rice plants showed no significant differences from the wild-type Zhonghua 11 in terms of panicle length, thousand-grain weight, grain weight per plant, and grain length, indicating that the gene does not affect rice yield. Attached Figure Description
[0024] Figure 1 ZmPIPLC4 ef Protein domains.
[0025] Figure 2 ZmPIPLC4 ef Protein 3D structure prediction.
[0026] Figure 3 ZmPIPLC4 ef Localization in tobacco (A) and protoplasts (B), Bars = 20 μm.
[0027] Figure 4 RT-PCR detection of transgenic rice expression efficiency.
[0028] Figure 5 To assess the yield of genetically modified rice, consider (A) panicle length; (B, C) grain size; (D) thousand-grain weight; and (E) grain weight per panicle (Bars = 1 cm).
[0029] Figure 6 (A) Image of rice leaves inoculated with rice blast fungus (B) Measurement of lesion area.
[0030] Figure 7 (A) Image of rice leaves inoculated with Xanthomonas oryzae (B) Measurement of lesion length. Detailed Implementation
[0031] The following specific embodiments further illustrate the present invention to provide a better understanding of it. Where specific techniques or conditions are not specified in the embodiments, they are performed according to the techniques or conditions described in the literature in this field or according to the product instructions. Reagents or instruments whose manufacturers are not specified are all commercially available conventional products.
[0032] Example 1, Phosphatidylphospholipase 4 (ZmPIPLC4) ef ) and the acquisition of its encoding gene.
[0033] This invention cloned phosphatidylphosphatase 4 (GenBank accession number Zm00001d007229) from maize and named it ZmPIPLC4. ef Gene. The cDNA of this gene is 1764 bp, and its nucleotide sequence is shown in SEQ ID NO:1 of the sequence listing; it encodes a 587 aa protein, and its amino acid sequence is shown in SEQ ID NO:2 of the sequence listing. The protein contains three domains: the X and Y catalytic domains of phospholipase C (PLCXc and PLCYc) and the conserved region 2 (C2) of protein kinase C (…). Figure 1 This trigonal domain structure is conserved in plant and animal PIPLCs (Abd-El-Haliem et al., 2017); however, ZmPIPLC4 efUnlike other PIPLCs, ZmPIPLC4 lacks an EF-hand-like domain at its N-terminus, which is involved in calcium ion binding. Similar to plant and animal PIPLCs, ZmPIPLC4... ef The catalytic X and Y domains form a (βα)8-barrel structure, similar to the barrel structure of trisaccharide phosphate isomerases. Figure 2 ).
[0034] Leaves of corn leaf 478 were collected, and after being cryogenically ground in liquid nitrogen, RNA was extracted from the leaves using the TRNzol Universal Total RNA Extraction Reagent (DP424) from Tiangen Biotech. The RNA was then reverse transcribed into cDNA using the HiScript III 1st Strand cDNA Synthesis Kit from Vazyme.
[0035] Using the above cDNA as a template, the target fragment was amplified by PCR: The pCAMBIA1300-ZmPIPLC4ef-eGFP fragment was amplified using primers F1: TacaccaaatcgactctagaATGGGCACCACGTAC and R1: CCCTTGCTCACCATcccgggGGCAAACTCGAAACG for constructing the localization vector; the pCAMBIA1390U-ZmPIPLC4 fragment was amplified using primers F2: TACTTCTGCACTAGGTACCATGGGCACCACGTAC and R2: TTAGAATTCCCGGGGATCCGGCAAACTCGAAACG for constructing the localization vector; ef Fragments are used to construct overexpression vectors.
[0036] The total PCR reaction volume was 50 μL, and the reaction mixture was as follows: 25 μL of 2×Phanta Max Master Mix, 2 μL of forward primer (10 μM), 2 μL of negative primer (10 μM), 1 μg of template, and ddH2O to bring the volume to 50 μL.
[0037] The PCR amplification program was as follows: pre-denaturation at 95℃ for 3 min; denaturation at 95℃ for 15 sec, annealing at 58℃ for 15 sec, extension at 72℃ for 2 min, 35 cycles; extension at 72℃ for 5 min; storage at 4℃.
[0038] Sequencing of the PCR amplification products showed that the obtained pCAMBIA1300-ZmPIPLC4 ef -eGFP and pCAMBIA1390U-ZmPIPLC4 ef All contain ZmPIPLC4 as shown in sequence 1 ef sequence.
[0039] Example 2, ZmPIPLC4 ef Subcellular localization
[0040] To investigate whether ZmPIPLC4ef is localized to the plasma membrane like typical PIPLCs, we transiently co-expressed ZmPIPLC4 in tobacco leaves under the control of the 35S promoter using an agricultural infiltration method. ef -GFP and AtPIP2-mCherry (plasma membrane markers).
[0041] The specific method is as follows:
[0042] I. Construction of Subcellular Localization Expression Vectors
[0043] OsZmPIPLC4 was amplified from the cDNA of leaves of maize cultivar Ye478. ef The plasmid pCAMBIA1300 was cloned into the pCAMBIA1300 plasmid. Specifically, the pCAMBIA1300-ZmPIPLC4 obtained in Example 1 was cloned into the pCAMBIA1300 plasmid. ef A recombinant expression vector for subcellular localization was obtained by inserting it between the XbaI and SmaI enzyme recognition sites of pCAMBIA1300; the sequence was correctly verified, and it was named pCAMBIA1300-ZmPIPLC4.
[0044] II. Subcellular localization in tobacco
[0045] The pCAMBIA1300-ZmPIPLC4-eGFP vector was transformed into Agrobacterium GV3101. The transformed Agrobacterium was then cultured in LB liquid medium (containing 50 mg / L kanamycin and 100 mg / L rifampin) until OD200. 600 The bacterial culture was centrifuged at 5000 rpm for 5 min to approximately 0.6, and the cells were collected. The cells were gently resuspended in a prepared MMA solution (10 mM MgCl2, 10 mM MES, 200 μM AS). The bacterial concentration was adjusted to OD200. 600 =0.6, after standing at room temperature for 1-3 hours, it was injected into tobacco leaves of about four weeks in size for transient expression. After 48 hours, fluorescence was observed and photographed using a confocal microscope (Leica SP8). The results showed that ZmPIPLC4... ef The GFP signal of -GFP and the RFP signal of AtPIP2-RFP overlap on the plasma membrane of tobacco epidermal cells. Figure 3 A).
[0046] III. Subcellular localization in maize
[0047] The pCAMBIA1300-ZmPIPLC4-eGFP plasmid was also used to transform into maize protoplasts. The GFP signal of ZmPIPLC4-eGFP in protoplasts was captured by laser scanning confocal microscopy 16-20 hours after infiltration. FM4-64 was used as a membrane marker in the confocal experiments.
[0048] We further used ZmPIPLC4 ef -GFP transfected maize 478 protoplasts and stained with the endocytosis / membrane tracer FM4-64. In maize protoplasts, ZmPIPLC4... ef -GFP's GFP signal overlaps with FM4-64 ( Figure 3 B) confirms ZmPIPLC4 ef Location on the plasma membrane.
[0049] Example 3, ZmPIPLC4 ef Disease resistance test
[0050] 1. Transfer to ZmPIPLC4 ef Construction of rice overexpression vector
[0051] OsZmPIPLC4 was amplified from the cDNA of maize cultivar Ye 478 leaves according to the method in Example 1. ef The plasmid pCAMBIA1390U was cloned into the pCAMBIA1390U plasmid. Specifically, the pCAMBIA1390U-ZmPIPLC4 obtained in Example 1 was cloned into the pCAMBIA1390U plasmid. ef The recombinant expression vector for rice transformation was obtained by inserting it between the KpnI and BamHI enzyme recognition sites of pCAMBIA1390U; the sequence was correctly verified and named pCAMBIA1390U-ZmPIPLC4.
[0052] II. Convert to ZmPIPLC4 ef Rice harvest
[0053] Add 1 μL of plasmid pCAMBIA1390U-ZmPIPLC4 to 50 μL of EHA105 / GV3101 Agrobacterium competent cells, mix thoroughly, incubate in liquid nitrogen for 5 min, at 37℃ for 5 min, and on ice for 5 min. After transformation, add 1 mL of LB liquid medium (without antibiotics), mix thoroughly, and transfer to a 1.5 mL centrifuge tube. Incubate in a shaker at 30℃ and 180 rpm for 3 h. Inoculate 100 μL of the activated Agrobacterium culture onto LB solid medium and incubate in the dark at 30℃ for 48 h.
[0054] Select rice grains without mold spots and with normal sprouts. Disinfect with 75% alcohol for 1 min, then rinse with sterile water for 1 min each time; disinfect with 15% sodium hypochlorite for 20 min, then rinse with sterile water 3 times for 1 min each time. Inoculate the disinfected Zhonghua 11 rice grains into induction medium and culture at 26℃ under light for 20 days. Pick Agrobacterium and prepare OD. 600 Use 0.2% Agrobacterium resuspension to pick up callus and place it in an Erlenmeyer flask. Add Agrobacterium resuspension and infect for 10-15 minutes. Discard the bacterial solution and inoculate the callus onto co-culture medium. Co-culture at 20°C for 48-72 hours. After culture, the callus was inoculated into hygromycin B medium and cultured at 26℃ for 20-30 days; positive callus was inoculated into secondary screening medium, and single-clonal callus was selected during the callus picking process and cultured at 26℃ for 7-10 days; positive callus was inoculated into differentiation medium and cultured at 25-27℃ under light for 15-20 days. After differentiating into 2-5cm shoots, it was inoculated into rooting medium and cultured at 30℃ under light for 7-10 days; leaves of transgenic plants were taken, gDNA was extracted, and hyg(481)F:CTGCCCGCTGTTCTACAACCGG and hyg(481)R:GGAGCATATACGCCCGGAGTC were used as detection primers. Transgenic plants that were verified by PCR were positive seedlings and used for subsequent propagation experiments.
[0055] To determine the transgenic expression efficiency of T2 seedlings, RNA was extracted from rice leaves using the aforementioned RNA extraction method and converted into cDNA. The corresponding detection primer was then synthesized: qZmPIPLC4. ef -F:GTGAAGGTGTACATGGGCGA and qZmPIPLC4 ef -R: CTCGATCGCGTTGGTCTTCT is the gene detection primer; qOsActin-F: TCCATCTTGGCATCTCTCAG and qOsActin-R: GTACCCTCATCAGGCATCTG are the internal control primers for semi-quantitative RT-PCR to verify ZmPIPLC4. ef Presence and expression of ZmPIPLC4 in T2 transgenic lines. Validated overexpression of ZmPIPLC4 was obtained. ef Transgenic lines of the japonica rice cultivar Zhonghua 11 (ZH11), including OsZmPIPLC4 ef -1、OsZmPIPLC4 ef -8 and OsZmPIPLC4 ef -14.
[0056] Reagents used in the above conversion process:
[0057] Induction medium: 100 mL N6max stock solution (10x), 10 mL N6min stock solution (100x), 100x Fe 2+ 10 mL of EDTA stock solution, 10 mL of 100x Vitamin stock solution, 2.5 mL of 2,4-D stock solution, 0.6 g of Proline, 0.8 g of CH4, 30 g of Sucrose, and 3 g of Phytagel were added to adjust the pH to 5.8 with KOH, and the volume was brought up to 1 L with ddH2O. The mixture was then autoclaved.
[0058] Suspension culture medium: 12.5 mL of N6max stock solution (10x), 1.25 mL of N6min stock solution (100x), Fe 2+ - 1.25 mL of EDTA stock solution (100x), 2.5 mL of Vitamin stock solution (100x), 0.15 g of Proline, 0.2 g of CH4, 0.625 mL of 2,4-D stock solution, and 5 g of Sucrose. Adjust the pH to 5.2 with KOH, bring the volume to 250 mL, and autoclave. When using, add 5 mL of 50% glucose and 250 μL of AS stock solution.
[0059] Co-culture medium: 12.5 mL N6max stock solution (10x), 1.25 mL N6min stock solution (100x), Fe 2+ 1.25 mL of EDTA stock solution (100x), 2.5 mL of Vitamin stock solution (100x), 0.625 mL of 2,4-D stock solution, 0.15 g of Proline, 0.2 g of CH4, 7.5 g of Sucrose, and 2 g of Agar powder were added to adjust the pH to 5.6 with KOH and brought the volume to 250 mL. The mixture was then autoclaved. Before use, 5 mL of 50% glucose and 250 μL of AS stock solution were added.
[0060] Screening medium: 25 mL N6 stock solution (10x), 2.5 mL N6 stock solution (100x), Fe 2+ 2.5 mL of EDTA stock solution (100x), 2.5 mL of Vitamin stock solution (100x), 0.625 mL of 2,4-D stock solution, 0.15 g of Proline, 0.2 g of CH4, 7.5 g of Sucrose, and 2 g of Agar powder are added to 200 mL of distilled water. The pH is adjusted to 6.0 with KOH, and the volume is brought to 250 mL. The solution is then autoclaved. Before use, 250 μL of Hn (50 mg / mL) and 500 μL of Cn (250 mg / mL) are added.
[0061] Differentiation medium: MSmax stock solution (10x) 100ml, MSmin stock solution (100x) 10ml, Fe2+-EDTA stock solution (100x) 10ml, Vitamin stock solution (100x) 10ml, KT stock solution 2.0ml, NAA stock solution 0.2ml, Proline 0.6g, CH 0.8g, D-sorbitol 30g, Sucrose 30g, Phytagel 3.0g. First, add 900ml of distilled water, adjust the pH to 5.8 with KOH, bring the volume to 1L, and autoclave.
[0062] Rooting medium: 50 mL MSmax stock solution (10x), 5 mL MSmin stock solution (100x), 5 mL Fe2+-EDTA stock solution (100x), 5 mL Vitamin stock solution (100x), 20 g Sucrose, 3 g Phytagel, adjust pH to 5.8 with KOH, bring volume to 1 L, and autoclave.
[0063] MSmax stock solution (10x): NH4NO3 16.5g, KH2PO4 1.7g, KNO3 19.0g, MgSO4·7H2O 3.7g, CaCl2·2H2O 4.4g, bring to a final volume of 1L.
[0064] MSmin stock solution (100x): MnSO4·4H2O 2.23g, ZnSO4·7H2O 0.86g, H3BO3 0.62g, KI 0.083g, Na2MoO4·2H2O 0.025g, CoCl2·6H2O 0.0025g, CuSO4·5H2O 0.0025g, Na2MoO4·2H2O to a final volume of 1L, store at room temperature.
[0065] N6max stock solution (10x): KNO3 28.3g; KH2PO4 4.0g; (NH4)2SO4 4.63g; MgSO4·7H2O 1.85g; CaCl2·2H2O 1.66g, diluted to 1L.
[0066] N6 min Mother liquor (100x): MnSO4·4H2O 0.44g; ZnSO4·7H2O 0.15g; H3BO3 0.16g; KI 0.08g, dissolve them one by one, and add ddH2O to make up to 1L.
[0067] Fe2+-EDTA stock solution (100x): Dissolve 2.78g of FeSO4·7H2O in 300mL of ddH2O, and separately dissolve 3.73g of Na2 EDTA·2H2O in 300mL at 70℃. Mix the two solutions, incubate at 70℃ for 2h, and make up to 1L. Store at 4℃ in the dark.
[0068] Vitamin stock solution (100x): Nicotinic acid 0.1g, Pyridoxine HCl (VB6) 0.1g, Thiamine HCl (VB1) 0.1g, Glycine 0.2g, Inositol 10g, dissolve and bring to a final volume of 1L, store at 4℃.
[0069] 2,4-D stock solution (1 mg / mL): Add 100 mg of 2,4-D to 1 mL of 1 M KOH and stir for 5 min. Then add 10 mL of ddH2O and stir until 2,4-D is completely dissolved. Make up to 100 mL and store at 4 °C.
[0070] IAA stock solution (1 mg / mL): Add 100 mg of IAA to 1 mL of 1 M KOH and stir until the IAA is completely dissolved. Make up to 100 mL with ddH2O and store at 4°C protected from light.
[0071] NAA stock solution (1 mg / mL): Add 100 mg of NAA to 1 mL of 1 M KOH and stir until NAA is completely dissolved. Make up to 100 mL with ddH2O and store at 4°C protected from light.
[0072] 1M KOH stock solution: Dissolve 5.6g KOH in 100mL ddH2O and store at room temperature.
[0073] 0.15% HgCl2: Dissolve 1.5g of HgCl2 in ddH2O and bring the volume to 1000mL. Add 1,000μL of water between 20°C, mix well, and store in the dark at room temperature.
[0074] 200mM AS stock solution: Dissolve 0.39g AS in 10ml DMSO, aliquot and store at -20℃.
[0075] 250mg / ml Cn: Dissolve 2.5g of Cn in a clean bench with sterile ddH2O to a final volume of 10mL, and store at -20℃. 50% Glucose: Dissolve 50g of glucose in ddH2O, bring the volume to 100ml, sterilize at 121℃ for 15min, and store at 4℃.
[0076] III. Rice Infection Experiment
[0077] To evaluate ZmPIPLC4 efRegarding its role in cross-varietal disease resistance, we generated overexpression of ZmPIPLC4 under the control of the Ubi promoter. ef Transgenic lines of the japonica rice cultivar Zhonghua 11 (ZH11), including OsZmPIPLC4 ef -1、OsZmPIPLC4 ef -8 and OsZmPIPLC4 ef -14( Figure 4 Select OsZmPIPLC4 ef -8 and OsZmPIPLC4 ef The -14 strain (T2) was further evaluated.
[0078] We evaluated the resistance of these transgenic lines to major fungal and bacterial diseases affecting rice production. We compared ZH11 and OsZmPIPLC4. ef -8 and OsZmPIPLC4 ef -14 strains were effective against Magnaphalthe oryzae strain SZ5 (awarded by Professor Peng Youliang of the College of Plant Protection, China Agricultural University, Wang Y, Yue J, Yang N, Zheng C, Zheng Y, Wu X, Yang J, Zhang H, et al. (2023). An ERAD-related ubiquitin-conjugating enzyme boosts broad-spectrum disease resistance and yield in rice. Nature Food 4(9):774–787; available to the public from China Agricultural University) and Xanthomonas oryzae strain PXO99A (awarded by Associate Professor Cui Fuhao of the College of Plant Protection, China Agricultural University, Mou B, Zhao G, Wang J, Wang S, He F, Ning Y, Li D, Zheng X, Cui F, Xue F, Zhang S, Sun W. The OsCPK17-OsPUB12-OsRLCK176 module regulates immune...). Phenotypic analysis was performed on the response to homeostasis in rice. PlantCel36(4):987–1006; available to the public from China Agricultural University. The leaves of the T2 transgenic lines (OsZmPIPLC4-8 and OsZmPIPLC-14) and the parent line Zhonghua 11 (ZH11) of O. sativa cv. were sprayed with inoculation after 28 days of planting.
[0079] After SZ5 was cultured on OMA for 7-10 days, conidia were collected, centrifuged at 3000g for 30s, washed three times with ddH2O, and counted using a hemocytometer. A conidial suspension (1×10⁻⁶ / mL) was prepared. 5 One conidium containing 0.025% Tween 20 was used to phenotype the rice blast response 6 days post-inoculation (dpi). Lesion area was measured using ImageJ after six days.
[0080] Strains PXO99A were incubated upside down on NA plates at 28°C for 48 hours. Using NA liquid medium, the cells were shaken at 200 rpm for 12 hours, then collected at 8000 rpm for 2 minutes. The cells were then suspended in 10 mM MgCl2, and the concentration was adjusted to OD before inoculation. 600 =0.8. The virulence was assessed by the leaf-cutting method. Rice leaves that were 6-8 weeks old were selected for inoculation. The scissors were immersed in the bacterial solution and the cut ends were inoculated. The disease incidence of rice was observed regularly during the period. The length of the lesion was measured at 14 dpi. The method for calculating the ratio of the lesion length to the total leaf length was as described above (Khaipho-Burch M, Cooper M, Crossa J, de Leon N, Holland J, Lewis R, McCouch S, Murray SC, et al. (2023) Genetic modification can improve crop yields - but stop overselling it. Nature 621(7979):470–473.).
[0081] The transgenic lines showed quantitative resistance to rice blast, and six days after inoculation, the number of rice blast lesions on the inoculated leaves decreased. Figure 6 A) Leaf area significantly reduced due to rice blast (OsZmPIPLC4) ef -8 and OsZmPIPLC4 ef The lesion area at -14 cm² was 0.28 cm². 2 and 0.24cm 2 ZH11 is 1.29cm. 2 ()( Figure 6 B; p<0.001).
[0082] Similarly, transgenic lines showed quantitative resistance to bacterial wilt. Figure 7 A), the lesion length significantly decreased after 14 dpi (OsZmPIPLC4). ef -8 and OsZmPIPLC4 ef The lesion lengths for -14 were 0.50 cm and 0.34 cm, respectively, while those for ZH11 were 2.50 cm. Figure 7B; p<0.001). These data confirm that OsZmPIPLC4 ef It can generate broad-spectrum, cross-variety resistance without causing yield loss.
[0083] Example 3: Yield Assessment
[0084] Following the randomized complete block design and related best practices outlined by Khaipho-Burch et al. (2023) and Wang et al. (2023), the yield components of the transgenic lines and ZH11 were rigorously evaluated. ZH11 and OsZmPIPLC4 were randomly selected. ef -8 and OsZmPIPLC4 ef Mature seedlings of the -14 line were measured, including yield components such as panicle length, thousand-grain weight, and grain diameter, and evaluated according to the standard methods outlined by Khaipho-Burch et al. (Khaipho-Burch M, Cooper M, Crossa J, de Leon N, Holland J, Lewis R, McCouch S, Murray SC, et al. (2023) Genetic modification can improve crop yields-but stop overselling it. Nature 621(7979):470–473.) and Wang et al. (Wang Y, Yue J, Yang N, Zheng C, Zheng Y, Wu X, Yang J, Zhang H, et al. (2023) An ERAD-related ubiquitin-conjugating enzyme boosts broad-spectrum disease resistance and yield in rice. Nature Food 4(9):774–787.). The experiment used a randomized complete design with three biological replicates.
[0085] Comparative analysis of the yield components of harvested crops revealed that the transgenic line (OsZmPIPLC4) ef -8 and OsZmPIPLC4 ef -14) and ZH11 in ear length ( Figure 5 A) Grain size ( Figure 5 B, C), 1000-grain weight ( Figure 5 D; p>0.01) and weight of grains per pouch ( Figure 5 There were no significant differences in E; p>0.01, etc. These results indicate that ZmPIPLC4 efThe expression of [specific ingredient] does not have a negative impact on the grain yield of transgenic rice lines.
[0086] The specific embodiments of the present invention have been described in detail above, but they are only examples, and the present invention is not limited to the specific embodiments described above. For those skilled in the art, any equivalent modifications and substitutions to this utility model are also within the scope of the present invention. Therefore, all equivalent changes and modifications made without departing from the spirit and scope of the present invention should be covered within the scope of the present invention.
Claims
1. The application of maize phosphatidylphospholipase C4 or its encoding gene in enhancing plant disease resistance, wherein the maize phosphatidylphospholipase C4 protein is a protein composed of the amino acid residue sequence of SEQ ID No. 2 in the sequence listing; the plant is rice, and the disease resistance is the resistance of rice to blast fungus (…). Magnaporthe oryzae Rice blast caused by Xanthomonas oryzae and / or by Xanthomonas rice ( Xanthomonas oryzae Resistance to bacterial leaf blight in rice caused by ) 2. The application according to claim 1, characterized in that: The cDNA nucleotide sequence of the encoding gene is as shown in SEQ ID No. 1 of the sequence listing.
3. A method for improving plant disease resistance, comprising transferring the encoding gene of maize phosphatidylphosphatase C4 shown in SEQ ID No. 2 into plants, and screening for transgenic plants with improved disease resistance; wherein the disease resistance is the resistance of rice to rice blast fungus (… Magnaporthe oryzae Rice blast caused by Xanthomonas oryzae and / or by Xanthomonas rice ( Xanthomonas oryzae Resistance to bacterial leaf blight in rice caused by )
Citation Information
Patent Citations
Rice adiponectin receptor OsPLS3 protein as well as coding gene and application thereof
CN119613517A
Corn NAC transcription factor and application thereof in enhancing disease resistance
CN120098099A