SNP molecular marker of psmc2 gene associated with antibody level of african swine fever virus, primer and application

By detecting the G/A polymorphism 22 bp upstream of the transcription start site of the PSMC2 gene in breeding pigs, the problem of identifying breeding pigs with high antibody levels in existing technologies has been solved, improving the breeding efficiency and disease resistance of breeding pigs and enabling more accurate assessment of immune response.

CN120060495BActive Publication Date: 2026-03-17YANGTZE UNIVERSITY
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202510348782.6
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Priority Date
2025-02-27
Filing Date
2025-03-24
Publication Date
2026-03-17
Estimated Expiration
2045-03-24

AI Technical Summary

Technical Problem

Existing technologies are insufficient to effectively identify SNP molecular markers associated with African swine fever virus antibody levels, limiting the efficiency and disease resistance of breeding pigs and leading to uncertainty in African swine fever virus control measures.

Method used

We provide SNP molecular markers and primer sets for the PSMC2 gene associated with African swine fever virus antibody levels. Genotypes of breeding pigs are detected by PCR amplification and sequencing, especially the G/A polymorphism located 22 bp upstream of the transcription start site of the porcine PSMC2 gene, to identify breeding pigs with high antibody levels.

Benefits of technology

It improves the efficiency of breeding pig selection, reduces feeding and time costs, and enables more accurate assessment of the immune response of breeding pigs, providing a means of preventing and controlling African swine fever virus.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120060495B_ABST
    Figure CN120060495B_ABST
Patent Text Reader

Abstract

The present application relates to the technical field of molecular marker, and particularly relates to a SNP molecular marker, primers and application associated with the antibody level of African swine fever virus. The SNP molecular marker is located at 22bp upstream of the transcription start site of the pig PSMC2 gene with the gene version number of NM_001245008.1, and has G / A polymorphism. The SNP molecular marker provided by the present application is closely associated with the antibody level of African swine fever virus of pigs. Compared with the pigs with the genotype of GA and AA at the site, the pigs with the genotype of GG have higher antibody level of African swine fever virus in serum. The SNP molecular marker can be applied to identify high-quality pigs resistant to African swine fever virus, so as to improve the breeding efficiency of breeding pigs and effectively improve the economic benefits of feeding pigs.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of molecular marker technology, specifically relating to SNP molecular markers, primers, and their applications that are associated with African swine fever virus antibody levels. Background Technology

[0002] African swine fever (ASF) is a highly contagious disease of pigs caused by the African swine fever virus (ASFV). Clinically, it manifests as high fever, lethargy, anorexia, cyanosis of the skin, and hemorrhage in various organs. This disease poses a serious threat to the pig farming industry.

[0003] The development of vaccines against African swine fever virus (ASFV) remains challenging. While traditional inactivated vaccines offer high safety, they suffer from poor immunogenicity and fail to provide complete protection after vaccination. ELISA antibody testing can accurately and promptly determine the level of viral antibodies in pigs, assessing herd immunity and thus aiding in the development of ASF control measures. Studies show that p72 and p30 proteins are important antigenic proteins that elicit humoral immune responses during ASFV infection. Antibodies against p72 protein can prevent viral adsorption, while antibodies against p30 protein can prevent viral endocytosis. Therefore, these proteins are often used as important biomarkers for serological diagnosis and vaccine development related to ASFV.

[0004] High expression of the p30 protein can be observed 2 to 4 hours after African swine fever virus (ASFV) infection and persists throughout the entire infection cycle. P30 antibodies can be detected 8–12 days after ASFV infection, about one week earlier than other protein antibodies, indicating early infection status; however, its duration is short and antibody levels decline rapidly. P72 gene expression occurs late in the viral infection process and is regulated by the late viral promoter. P72 antibodies can be detected on day 17 after ASFV infection, exhibiting long duration and high levels, marking persistent infection or the formation of immunity. After vaccination with inactivated ASFV vaccine, the levels of ASFV antibodies produced in pig herds vary considerably; approximately 67% of individuals have high levels providing complete protection, while the remainder have low levels that do not provide complete protection. Therefore, it is necessary to identify SNP molecular markers related to antibody formation pathways and apply them to the breeding of pigs with high ASFV antibody levels. Antibody-level-related SNP marker-assisted selection is one possible approach to prevent the spread of ASF. Summary of the Invention

[0005] To address the aforementioned technical problems, this invention provides SNP molecular markers, primers, and applications of the PSMC2 gene associated with African swine fever virus antibody levels, aiming to provide new technical means for the genetic improvement of breeding pigs.

[0006] This invention first provides a SNP molecular marker for the PSMC2 gene associated with African swine fever virus antibody levels and its application in breeding pig identification; secondly, it provides a primer set for amplifying the SNP molecular marker of the PSMC2 gene associated with African swine fever virus antibody levels, the application of the primer set, and specific application methods.

[0007] The first aspect of the present invention provides an SNP molecular marker for the PSMC2 gene associated with African swine fever virus antibody levels. The SNP molecular marker is located 22 bp upstream of the transcription start site of the porcine PSMC2 gene with gene version number NM_001245008.1 and has G / A polymorphism; the frequency of the G allele is greater than that of the A allele.

[0008] Preferably, the nucleotide sequence of the promoter region of the porcine PSMC2 gene is shown in SEQ ID NO.1:

[0009] TGACCATCGTTATCACTGTATTGGCAGCAGGCTCAAAAATTGAAACCACCTACTTTCTCATCCCTTGTTAACATCAAATTAATGAACAACTCCTATTTACCTTCACTCTATTTGTAAATCTAGCCCGTACTCATCGCGTAACTAATTATGCTACGTACTTCACACTGTTATTTTATGCACCCACAATGCTGTGAGTTCACGGGGAAATTAACACCAAAATTCAAGAAATTACCCAAGAGTACAGAGTAAAT GATTAAAGCAGGATTTAAACTCAGCACCTGAGCCTGAGTTGGTCTTGAAATCTGTTGCTCGGGGAACTGCCCATGGTGCGGGACCAGGTTAGACCTTAGACCAACGCTTCCTTCCAACAGGAAAT CCCACGTACTGTCATTAACTGCGATCTGAAGCCAGCGCGGGTCCAGAGCGCTCTTCCGCCTGGCGCGGCTGTAAAAGGGCCCGCAGATCCAGCTTTACTTCCGGTGGGGAAGGGAGAGGGAGGG.

[0010] Preferably, the antibody level is the antibody level of p72 protein.

[0011] A second aspect of the present invention provides a primer set for amplifying the SNP molecular marker of the PSMC2 gene associated with African swine fever virus antibody levels, wherein the nucleotide sequence of the upstream primer is shown in SEQ ID NO.2 and the nucleotide sequence of the downstream primer is shown in SEQ ID NO.3.

[0012] SEQ ID NO. 2: CTAGCCCGTACTCATCGCGTA.

[0013] SEQ ID NO. 3: TAGCCCCACAAAAGCGACGGA.

[0014] A third aspect of the present invention provides a kit for detecting the SNP molecular marker genotype of the PSMC2 gene associated with African swine fever virus antibody levels, the kit comprising the primer set described in the second aspect of the present invention.

[0015] Furthermore, the kit also includes DNA extraction reagents, DNA purification reagents, PCR reaction reagents, agarose solution, electrophoresis buffer, and staining solution.

[0016] The fourth aspect of this invention provides the application of the above-described SNP molecular markers, primer sets, or kits in the identification of breeding pigs.

[0017] The fifth aspect of this invention provides a method for identifying breeding pigs, comprising the following steps:

[0018] Using porcine genomic DNA as a template, PCR amplification was performed using the primer set described in the second aspect of this invention to obtain PCR products.

[0019] The PCR products were subjected to agarose gel electrophoresis and sequencing.

[0020] The levels of African swine fever virus (ASFV) antibodies in the serum of breeding pigs with the GG genotype (G / A polymorphism at 22 bp upstream of the transcription start site of the PSMC2 gene) were higher than those in the serum of breeding pigs with the GA or AA genotypes.

[0021] Furthermore, the reaction system for PCR amplification is as follows.

[0022] 10 μL of 2×Taq Master Mix, 1 μL of DNA template, 0.5 μL of upstream primer, 0.5 μL of downstream primer, and 8 μL of ddH2O.

[0023] Furthermore, the reaction procedure for PCR amplification is as follows.

[0024] Pre-denaturation at 93-95℃ for 5 min; denaturation at 93-95℃ for 30 s, annealing at 57-60℃ for 20 s, extension at 72℃ for 20 s, repeat 39 times; extension at 72℃ for 5 min, store at 4℃.

[0025] In summary, compared with the prior art, the present invention has the following advantages and effects:

[0026] This invention provides a SNP molecular marker associated with African swine fever virus (ASFV) antibody levels. The SNP marker is located 22 bp upstream of the transcription start site of the porcine PSMC2 gene (version NM_001245008.1) and exhibits G / A polymorphism. This invention, through in-depth research on key genes in the porcine antigen presentation pathway, provides for the first time a novel site significantly correlated with ASFV antibody levels. Validation revealed that the G / A mutation 22 bp upstream of the transcription start site of the PSMC2 gene is negatively correlated with ASFV antibody levels in porcine serum.

[0027] The SNP molecular markers provided by this invention can be applied to the identification and selection of African swine fever-resistant breeding pigs, thereby improving breeding efficiency, enhancing animal health, and reducing unnecessary feeding and time costs. Furthermore, the molecular markers provided by this invention also have significant scientific value for studying the molecular mechanisms affecting African swine fever virus antibody levels. Attached Figure Description

[0028] Figure 1 Correlation analysis of the expression levels of MECP2 target genes in lymph nodes with MECP2 binding sites; Figure 1 In the diagram, Figure A shows the weighted image of transcription factor binding sites (Gene-set), where the blue curves represent the weighting functions for each transcription factor binding site; Figure B shows the weighted image of gene expression levels (Gene-list), where the blue curves represent the weighting functions for each gene expression level; Figure C shows the correlation analysis between unweighted gene expression levels and unweighted transcription factor binding sites, where the blue curves represent the unweighted fitting curves between transcription factor binding site scores and gene expression levels; Figure D shows the correlation analysis between weighted gene expression levels and weighted transcription factor binding sites, where the blue curves represent the weighted fitting curves between transcription factor binding site scores and gene expression levels. The green dots represent the two-dimensional distribution of binding site scores and gene expression levels of MECP2 target genes, with the diameter of the green dots representing the weighting values.

[0029] Figure 2 The sequencing results of three pigs with different PSMC2 genotypes were compared; the yellow box indicates the G-22A mutation site, and the blue box indicates the MECP2 binding site of the PSMC2 gene.

[0030] Figure 3 Figure showing the effect of the PSMC2 gene G-22A mutation site on the antibody level trait of African swine fever virus;

[0031] Figure 3 Figure A shows the effect of the PSMC2 gene G-22A mutation on p72 antibody levels; Figure B shows the effect of the PSMC2 gene G-22A mutation on p30 antibody levels. The vertical axis represents the African swine fever virus antibody level (S / N), and the horizontal axis represents the genotype. a, b, and c represent the groups in the multiple comparison results, and different letters indicate significant differences between groups, p < 0.05. Detailed Implementation

[0032] To enable those skilled in the art to better understand and implement the technical solutions of the present invention, the present invention will be further described below in conjunction with specific embodiments and accompanying drawings.

[0033] Unless otherwise specified, all reagents used in this invention are commercially available, and all methods used are conventional techniques in the art.

[0034] Antigen presentation is closely related to traits such as antibody levels, disease resistance, and health in animals. SNP molecular marker-assisted selection is an important method in modern domestic pig breeding engineering. However, the number of SNP molecular markers that are directly related to the antibody level of African swine fever virus is still relatively small, which limits the application of SNP molecular marker breeding technology in the improvement of African swine fever-resistant breeding pigs.

[0035] This invention first utilizes transcriptome sequencing and Grit / Flaver software analysis to identify the differentially expressed transcription factor MECP2 associated with African swine fever virus infection, and PSMC2 is one of the key target genes of MECP2. The function of PSMC2 is related to antigen presentation. By comparing resequencing data from 30 Duroc × Landrace × Large White pigs, a G / A polymorphism was found 22 bp upstream of the transcription start site of the PSMC2 gene in pigs. Primers were designed for this specific region, and sequence amplification was performed. Sequencing revealed that the genotype frequency of the PSMC2 gene at this SNP site showed a trend of GG>GA>AA. Subsequently, it was verified that the SNP molecular markers provided by this invention are negatively correlated with the level of African swine fever antibodies in pig serum and are easily detectable.

[0036] Example 1: Obtaining the PSMC2 gene fragment and SNP molecular markers

[0037] Transcriptome sequencing was performed on 3 African swine fever virus-infected pigs and 3 control pigs. The expression levels of infected and control genes were compared based on the transcriptome results. The expression level of each differentially expressed gene was measured. Weighted Kendall correlation statistics using Grit / Flaver software were used to detect the correlation between the expression level of each differentially expressed gene and the binding sites of target genes of each transcription factor in pigs.

[0038] The results are as follows Figure 1 As shown, for target genes containing MECP2 binding sites, the higher the binding site score, the higher the expression level. The expression level and transcription factor binding site score are significantly positively correlated (p < 0.05). Among these, PSMC2, a target gene of MECP2, is one of the key genes involved in antigen presentation.

[0039] Comparison of resequencing data from 30 Duroc × Landrace × Large White pigs revealed a G / A polymorphism in the PSMC2 gene promoter region, 22 bp upstream of the transcription start site. Sequencing was then performed on three individuals with different genotypes using the Sanger method, and the comparison results are as follows. Figure 2 As shown, the yellow box indicates the G-22A mutation site, and the blue box indicates the MECP2 binding site.

[0040] Blood samples were collected from 206 African swine fever virus-positive pigs at a farm in Jingzhou City, Hubei Province. Whole-genome DNA was extracted from the 206 blood samples using a peripheral blood DNA extraction kit (purchased from Beijing Solarbio).

[0041] Based on the PSMC2 gene nucleotide sequence published in the GenBank database, the PSMC2 gene version number is NM_001245008.1. The promoter region of the PSMC2 gene was compared online, and specific primers for this region were designed using Oligo software. PCR amplification was performed using genomic DNA from 206 individuals as templates. The nucleotide sequence of the PSMC2 gene promoter region is shown in SEQ ID NO.1.

[0042] SEQ ID NO.1:

[0043] TGACCATCGTTATCACTGTATTGGCAGCAGGCTCAAAAATTGAAACCAC

[0044] CTACTTTCTCATCCCTTGTTAACATCAAATTAATGAACAACTCCTATTTACC

[0045] TTCACTCTATTTGTAAATCTAGCCCGTACTCATCGCGTAACTAATTATGCTA

[0046] CGTACTTCACACTGTTATTTTATGCACCCACAATGCTGTGAGTTCACGGGG

[0047] AAATTAACACCAAAATTCAAGAAATTACCCAAGAGTACAGAGTAAATGAT

[0048] TAAAGCAGGATTTAAACTCAGCACCTGAGCCTGAGTTGGTCTTGAAATCT

[0049] GTTGCTCGGGGAACTGCCCATGGTGCGGGACCAGGTTAGACCTTAGACCA

[0050] ACGCTTCCTTCCAACAGGAAATCCCACGTACTGTCATTAACTGCGATCTGA

[0051] AGCCAGCGCGGGTCCAGAGCGCTCTTCCGCCTGGCGCGGCTGTAAAAGGGCCCGCAGATCCAGCTTTACTTCCGGTGGGGAAGGGAGAGGGAGGG.

[0052] The upstream primer sequence of the PSMC2 gene is shown in SEQ ID NO.2; the downstream primer sequence is shown in SEQ ID NO.3.

[0053] SEQ ID NO. 2: CTAGCCCGTACTCATCGCGTA.

[0054] SEQ ID NO. 3: TAGCCCCACAAAAGCGACGGA.

[0055] Table 1 shows the specific parameters of the PCR reaction system.

[0056] Table 1 PCR reaction system

[0057] Element Content, μL 2×TaqMasterMix 10 Upstream primer, 10 μM 0.5 Downstream primer, 10 μM 0.5 DNA template 1.0 <![CDATA[ddH2O]]> 8.0

[0058] Table 2 shows the PCR amplification procedure.

[0059] Table 2 PCR amplification program

[0060]

[0061] Four μL of each PCR product was taken for agarose gel electrophoresis. After imaging, the PCR products containing a single band were sent to Shanghai Bioengineering Co., Ltd. for sequencing. SeqMan software was used to compare and analyze the sequencing results, identify the mutation sites in the sequences, and record the mutation type of the corresponding site A-22G in each individual.

[0062] The G-22A mutation site in the PSMC2 gene manifested as three genotypes in 206 pigs tested, with genotype frequencies of GG: 0.84; GA: 0.13; and AA: 0.03, showing a trend of GG>GA>AA. The frequency of allele G was 0.92, while the frequency of allele A was 0.08, indicating that the frequency of allele G was greater than that of allele A.

[0063] Example 2: Validation of SNP molecular markers associated with African swine fever virus antibody levels

[0064] To establish the relationship between the PSMC2 gene and the level of African swine fever virus (ASFV) antibodies, enzyme-linked immunosorbent assay (ELISA) was used to determine the antibody levels of ASFV p72 and p30 in 206 blood samples from Example 1. The results were expressed as the S / N ratio (sample OD450nm value / average OD450nm value of negative controls), with a higher S / N value indicating a lower antibody level. The results showed that 153 breeding pigs had higher p72 antibody levels, 53 breeding pigs had lower p72 antibody levels, and the p30 antibody level was lower than the p72 antibody level.

[0065] The association analysis of SNP sites in the PSMC2 gene and African swine fever virus antibody levels was performed using the ANOVA program in R 4.1 software. The results are as follows: Figure 3 As shown, the S / N value of African swine fever virus p72 antibody in the serum of GG genotype pigs was 0.46±0.05, that of GA genotype was 0.50±0.06, and that of AA genotype was 0.63±0.05. The serum p72 antibody levels showed a significant difference between GG, GA, and AA (p<0.05). The S / N value of African swine fever virus p30 antibody in the serum of GG genotype pigs was 0.50±0.05, that of GA genotype was 0.53±0.06, and that of AA genotype was 0.60±0.07. The p30 antibody levels in the serum of pigs of all genotypes were not high.

[0066] The overall level of p30 antibodies was low, and significantly lower than that of p72 antibodies. This difference may be related to the weaker immunogenicity of the p30 antigen or lower antibody production efficiency. Given that p72 antibodies have higher levels and better stability, and can more accurately reflect the true state of the immune response, this invention selects p72 antibody levels as a correlation indicator to improve the reliability of molecular markers.

[0067] The technical features of the above embodiments can be combined in any way. For the sake of brevity, not all possible combinations of the technical features in the above embodiments are described. However, as long as there is no contradiction in the combination of these technical features, they should be considered to be within the scope of this specification.

[0068] The embodiments described above are merely illustrative of several implementations of the present invention, and while the descriptions are relatively specific and detailed, they should not be construed as limiting the scope of the invention patent. It should be noted that those skilled in the art can make various modifications and improvements without departing from the concept of the present invention, and these all fall within the protection scope of the present invention. Therefore, the protection scope of this invention patent should be determined by the appended claims.

Claims

1. Use of a primer set of SNP molecular markers associated with antibody levels of African swine fever in the preparation of a reagent for identifying antibody levels of African swine fever, characterized in that, The SNP molecular marker is located at 22bp upstream of a transcription start site of a promoter region of a pig PSMC2 gene with a G / A polymorphism, and the pig PSMC2 gene has a gene version number of NM_001245008.

1. The nucleotide sequence of the upstream primer of the primer set is shown in SEQ ID NO. 3, and the nucleotide sequence of the downstream primer is shown in SEQ ID NO.

4. The antibody level is the antibody level of the p72 protein.

2. Use according to claim 1, characterized in that, The nucleotide sequence of the promoter region of the pig PSMC2 gene is shown in SEQ ID NO.

1.

3. Use of the primer set according to claim 1 in the preparation of a kit for detecting the genotype of a SNP molecular marker associated with the level of antibodies against African swine fever, characterized in that, The antibody level is the antibody level of the p72 protein.

4. Use according to claim 3, characterized in that, The kit further comprises a DNA extraction reagent, a DNA purification reagent, a PCR reaction reagent, an agarose solution, an electrophoresis buffer, and a staining solution.

5. Use of the primer set as claimed in claim 1 or the kit as claimed in claim 3 in the selection of breeding pigs, characterized in that, The boars with the GG genotype are selected as parents to improve the antibody level of the offspring to African swine fever virus.

6. A method of boar identification, characterized in that, The method comprises the following steps: The DNA template of the pig is subjected to PCR amplification by using the primer set in claim 1 to obtain a PCR product; The PCR product is subjected to agarose gel electrophoresis and sequencing; It is detected that the African swine fever serum antibody level of the boar with the GG genotype at 22bp upstream of the transcription start site of the promoter region of the pig PSMC2 gene is higher than the African swine fever serum antibody level of the boar with the AG or AA genotype.

7. The method of claim 6, wherein, The reaction system of the PCR amplification is as follows: 2x Taq MasterMix 10μL, DNA template 1.0μL, upstream primer 0.5μL, downstream primer 0.5μL, and ddH2O 8.0μL.

8. The method of claim 6, wherein, The reaction procedure of the PCR amplification is as follows: 93~95℃ pre-denaturation for 5min; 93~95℃ denaturation for 30s, 57~60℃ annealing for 20s, 72℃ extension for 20s, 39 cycles; 72℃ extension for 5min, and 4℃ preservation.