RT-PCR (Reverse Transcription-Polymerase Chain Reaction) freeze-dried microsphere containing dye and application thereof

Abstract

The invention discloses a dye-containing RT-PCR (reverse transcription-polymerase chain reaction) freeze-dried microsphere and application thereof, the freeze-dried microsphere is formed by a virus amplification primer probe, a buffer solution and dye in a freeze-drying manner, and the dye is one of amaranth, carmine or trypan blue. When the freeze-dried microspheres are used and subpackaged in a freeze dryer, various types of freeze-dried microspheres can be freeze-dried at a time through the visual difference in color, marking on a container is not needed, the use efficiency and the subpackaging efficiency of the freeze dryer can be effectively improved, the time cost is reduced, the dyed freeze-dried microspheres can be stored for 30 days at the temperature of 45 DEG C and the humidity of 80%, and the freeze-dried microspheres have good color fastness. The appearance and the PCR performance are not influenced, and the requirement of normal-temperature transportation is completely met.

Description

Technical Field

[0001] The present invention relates to the field of biotechnology, and particularly to an RT-PCR freeze-dried microsphere containing a dye and its application. Background Art

[0002] In the actual use process of biological agents, high requirements are placed on the activity of the active substances therein. The enzyme activity is easily damaged in a high-temperature environment, which affects the test results. The method of low-temperature storage and cold-chain transportation has a high cost, and the shelf life is generally only 12 months. At present, nucleic acid detection products gradually adopt vacuum freeze-drying technology to achieve room-temperature transportation and storage, and the freeze-dried microsphere form is relatively widespread.

[0003] The freeze-dried microspheres have a high yield and are suitable for various packaging materials, such as centrifuge tubes, eight-connected tubes, microfluidic chips, and flow cytometry tubes, etc. However, the freeze-dried microspheres are light in weight and prone to generating static electricity, which is not easy to control during the actual dispensing process. Moreover, the current freeze-dried microspheres on the market are basically white small balls. If multiple components or systems are produced and packaged simultaneously, it is easy to cause confusion between the systems. Therefore, it is necessary to distinguish different types of freeze-dried microspheres to improve the packaging efficiency.

[0004] The freeze-dried microspheres on the market are basically white microspheres. After the production is completed, they cannot be visually distinguished, and the freeze-dried balls are prone to generating static electricity and are easy to break away from the packaging, increasing the dispensing difficulty. Therefore, only single-system dispensing can be carried out, and it is necessary to mark on the packaging in advance, resulting in low dispensing efficiency. If different small balls are mixed during dispensing or the packaging is not marked in time, it is difficult to distinguish with the naked eye, which will cause serious material losses.

[0005] Most RT-PCRs adopt the probe method. Dyes with emission wavelengths similar to those of the fluorescent modification groups used in the probes will affect the light collection, thereby affecting the performance of PCR. Therefore, how to stain the PCR freeze-dried microspheres of human papillomavirus without affecting the PCR performance is still a technical problem that those skilled in the art urgently need to solve. Summary of the Invention

[0006] In view of the above technical problems, the present invention provides an RT-PCR freeze-dried microsphere containing a dye and its application. To achieve the above object of the present invention, the following technical solutions are proposed:

[0007] On the one hand, the present invention relates to an RT-PCR freeze-dried microsphere containing a dye, which is freeze-dried from a virus amplification primer probe, a buffer solution, and a dye, and the dye is one of amaranth, carmine, or trypan blue.

[0008] In a preferred embodiment of the present invention, the virus is human papillomavirus or dengue fever; preferably human papillomavirus. The present invention has confirmed through experimental results that the three dyes, amaranth, carmine, and trypan blue, have no influence on the amplification efficiency and detection limit of the human papillomavirus system. After accelerating for 30 days at 45°C and 80% RH, there is no abnormality in appearance, the redissolution is qualified, and the PCR performance is consistent with that of the freeze-dried microspheres stored at -20°C, indicating that the above three dyes fully meet the staining requirements of the freeze-dried microspheres of the human papillomavirus PCR system and can be distinguished from other freeze-dried microspheres.

[0009] In a preferred embodiment of the present invention, the dye is specifically amaranth at 0.05 - 0.1 w / v‰, carmine at 0.03 - 0.08 w / v‰, or trypan blue at 0.1 - 0.2 w / v‰.

[0010] On the other hand, the present invention relates to a combination set of RT-PCR freeze-dried microspheres containing dyes, which includes a combination of at least 2 (preferably 4) of the RT-PCR freeze-dried microspheres without staining, stained with amaranth, carmine, or trypan blue. The above 3 dyes have obvious distinguishability, do not interfere with the light collection process in PCR amplification, and do not affect the performance of RT-PCR.

[0011] On the other hand, the present invention also includes the application of the above-mentioned RT-PCR freeze-dried microspheres containing dyes. The RT-PCR freeze-dried microspheres are used for freeze-drying and / or sub-packaging, and the RT-PCR freeze-dried microspheres do not have other labels.

[0012] Advantages of the present invention

[0013] 1. During the use of the freeze-dryer and the sub-packaging process, various types of freeze-dried microspheres can be freeze-dried at one time through the intuitive color difference, without the need to mark on the container, which can effectively improve the use efficiency and sub-packaging efficiency of the freeze-dryer and reduce the time cost.

[0014] 2. The 3 dyes screened out in the present invention have good stability. The freeze-dried microspheres after staining are stored at 45°C and 80% humidity for 30 days, and the appearance and PCR performance are not affected, fully meeting the requirements of normal temperature transportation. Description of the drawings

[0015] Figure 1 It is a photo of 3 kinds of microspheres mixed together, and the photo shows that various microspheres can be clearly distinguished by naked eye observation. Detailed implementation manners

[0016] To further understand the present invention, the technical solutions in the embodiments of the present invention will be clearly and completely described below in conjunction with the embodiments of the present invention. Obviously, the described embodiments are only a part of the embodiments of the present invention, rather than all of the embodiments. All other embodiments obtained by those of ordinary skill in the art based on the embodiments of the present invention without creative efforts shall fall within the protection scope of the present invention.

[0017] Unless otherwise specified, the reagents involved in the embodiments of the present invention are all commercially available products and can be obtained through commercial channels.

[0018] 1. Preparation of all-premixed RT-PCR amplification reagents

[0019] 1.1 The all-premixed components include detection buffer, enzyme, primer probe and dye;

[0020] 1.2 The dyes mainly include one or several combinations of the following categories:

[0021] Single-component dyes: amaranth (0.05 - 0.1‰), safranin (0.05 - 0.1‰), carmine (0.03 - 0.08‰), sunset yellow (0.1 - 0.5%), lemon yellow (0.1 - 0.5%) and trypan blue (0.1 - 0.2‰).

[0022] Two-component dyes: Combination 1: trypan blue (0.1 - 0.2‰): sunset yellow (0.1 - 0.5%) = 1:5 - 1:10; Combination 2: trypan blue (0.1 - 0.2‰): lemon yellow (0.1 - 0.5%) = 1:5 - 1:10.

[0023] Example 1 Dengue freeze-dried reagent

[0024] 1. Preparation of dengue liquid reagent

[0025]

[0026] The primer probe sequences are shown in the following table:

[0027] Upstream primer F: ATGGACTTGAGCTTAKAGAGAG Downstream primer R: GATCTGTGCCAGGAATCATG Probe DEN: TCGTGAYTCGCTGCGACAATAAGGTCAT

[0028] 2. Freeze-drying

[0029] Freeze-drying is carried out according to the following freeze-drying curve

[0030] Step Shelf temperature Ramp-up / ramp-down time Hold time Pressure Pre-freezing -40℃ 60 min 120 min \ Sublimation -30℃ 10 min 360 min 20 Pa Desorption 30℃ 60 min 180 min 10 Pa

[0031] 3. Performance detection

[0032] 3.1 Appearance

[0033]

[0034] 3.2 Redissolution

[0035] All groups were redissolved within 1 minute, and the solution was clear and transparent, without obvious foam and foreign matters.

[0036] 3.3 PCR Performance

[0037] 3.3.1 Amplification Efficiency Test: Using the lyophilized microspheres without added dye as the control, the dengue fever quality control product was diluted to 10 4 / 10 3 / 10 2 / 10 copies / μL for testing, and the amplified Ct values are shown in the following table:

[0038]

[0039]

[0040] 3.3.2 Detection Limit Test: Using the lyophilized reagent without added dye as the control, the dengue fever quality control product was diluted to 10 copies / μL for testing, and the results are shown in the following table:

[0041]

[0042]

[0043] 3.3.3 Accelerated Stability Test

[0044] The unstained white lyophilized microspheres and the lyophilized microspheres stained with amaranth and trypan blue were placed in a thermostatic and humid incubator (45°C, 80% RH) for accelerated experiments. They were placed for 10, 20, and 30 days respectively, using the lyophilized reagent stored at -20°C as the control (i.e., the accelerated duration is 0 days), observing the appearance changes of the lyophilized microspheres, and conducting tests on amplification efficiency and the lowest detection limit.

[0045] 3.3.3.1 Appearance:

[0046] The appearance of the accelerated lyophilized microspheres was consistent with that of the lyophilized microspheres stored at -20°C. All microspheres could be redissolved within 1 minute, and the redissolved solution was clear and transparent, without obvious foreign matters.

[0047]

[0048]

[0049] 3.3.3.2 PCR Performance results are as follows:

[0050]

[0051] 4. Results

[0052] Based on the above test results, neither amaranth nor trypan blue has an impact on the amplification efficiency and detection limit of the dengue fever system. After 30 days of acceleration at 45°C and 80% RH, there are no abnormalities in appearance, the redissolution is qualified, and the PCR performance is consistent with that of the freeze-dried microspheres stored at -20°C, indicating that the above two dyes fully meet the staining requirements of the dengue fever system and can be distinguished from other freeze-dried microspheres.

[0053] Example 2 Human Papillomavirus Freeze-Dried Reagent

[0054] 1. Preparation of Human Papillomavirus Liquid Reagent

[0055]

[0056] The primer and probe sequences are shown in the following table:

[0057]

[0058]

[0059] 2. Freeze-drying is carried out according to the following freeze-drying curve

[0060] Step Shelf temperature Ramp-up / ramp-down time Hold time Pressure Pre-freezing -40℃ 60 min 120 min Sublimation -30℃ 10 min 360 min 20 Pa Desorption 30℃ 60 min 180 min 10 Pa

[0061] 3. Performance Detection

[0062] 3.1 Appearance

[0063]

[0064] 3.2 Redissolution All groups are redissolved within 60 seconds, the solution is clear and transparent, without obvious foam and foreign matters.

[0065] 3.3 PCR Performance

[0066] 3.3.1 Amplification Efficiency Test: Using the freeze-dried microspheres without added dye as a control, the human papillomavirus quality control products are diluted to 10 3 / 10 2 / 10 / 1 copy / μL for testing. Among them, the ROX channel represents 13 high-risk types, the VIC channel represents 5 medium-risk types, and the FAM channel represents 6 low-risk types. The amplified Ct values are shown in the following table:

[0067]

[0068]

[0069]

[0070] 3.3.2 Detection Limit Test: Using the freeze-dried microspheres without added dye as a control, the human papillomavirus quality control product was diluted to 1 copy / μL for testing, and the results are shown in the following table:

[0071]

[0072]

[0073]

[0074] 3.3.3 Accelerated Stability Test

[0075] The unstained white freeze-dried microspheres and the freeze-dried microspheres stained with amaranth, carmine, and trypan blue were placed in a thermostatic and humid incubator (45°C, 80% RH) for an accelerated experiment. They were placed for 10, 20,

[0076] 30 days respectively. The freeze-dried microspheres stored at -20°C were used as a control (i.e., the accelerated duration was 0 days), the appearance changes of the freeze-dried microspheres were observed, and the amplification efficiency and the lowest detection limit were tested.

[0077] 3.3.3.1 Appearance:

[0078] The appearance of the accelerated freeze-dried microspheres was consistent with that of the freeze-dried microspheres stored at -20°C. All microspheres could be redissolved within 1 minute, and the redissolved solution was clear and transparent without obvious foreign matters.

[0079] 3.3.3.2 PCR Performance Results are as follows:

[0080]

[0081]

[0082]

[0083]

[0084] 4. Results

[0085] Based on the above test results, the three dyes, amaranth, carmine, and trypan blue (photos of the freeze-dried microspheres labeled with the three dyes are as Figure 1 shown) have no influence on the amplification efficiency and detection limit of the human papillomavirus system. After 30 days of acceleration at 45°C and 80% RH, there is no abnormality in appearance, the redissolubility is qualified, and the PCR performance is consistent with that of the freeze-dried microspheres stored at -20°C, indicating that the above three dyes fully meet the staining requirements of the human papillomavirus system and can be distinguished from other freeze-dried microspheres.

[0086] In addition, although carmine has an impact on the dengue fever system, it has no impact on the human papillomavirus. Here, "has an impact" means having a negative impact on the detection limit and detection rate through experimental testing.

Claims

1. A dye-containing RT-PCR freeze-dried microsphere, wherein the freeze-dried microsphere is formed by freeze-drying a viral amplification primer probe, a buffer solution and a dye, and the dye is one of amaranth, carmine or trypan blue.

2. The dye-containing RT-PCR freeze-dried microsphere according to claim 1, wherein the virus is human papillomavirus or dengue fever.

3. The dye-containing RT-PCR freeze-dried microsphere according to claim 1, wherein the virus is human papillomavirus.

4. The dye-containing RT-PCR freeze-dried microsphere according to any one of claims 1-3, wherein the specific dye is 0.05-0.1 w / v‰ of amaranth, 0.03-0.08 w / v‰ of carmine or 0.1-0.2 w / v‰ of trypan blue.

5. A combination set of dye-containing RT-PCR freeze-dried microspheres, which comprises a combination of at least two of the RT-PCR freeze-dried microspheres without staining, stained with amaranth, carmine or trypan blue, and the RT-PCR freeze-dried microsphere is formed by freeze-drying a viral amplification primer probe, a buffer solution and a dye.

6. A combination set of dye-containing RT-PCR freeze-dried microspheres, which comprises a combination of four of the RT-PCR freeze-dried microspheres without staining, stained with amaranth, carmine or trypan blue, and the RT-PCR freeze-dried microsphere is formed by freeze-drying a viral amplification primer probe, a buffer solution and a dye.

7. The application of the dye-containing RT-PCR freeze-dried microsphere according to any one of claims 1-4, wherein the RT-PCR freeze-dried microsphere is used for freeze-drying and / or sub-packaging, and the RT-PCR freeze-dried microsphere does not have other labels.

Images