Application of pseudogene RPLP0P6 as liver cancer diagnosis marker

Abstract

The invention relates to the technical field of pseudogenes. The invention provides an application of a pseudogene RPLP0P6 as a liver cancer diagnosis marker, the nucleotide sequence of the pseudogene RPLP0P6 is as shown in SEQ ID NO.1, and the tumor is liver cancer. The invention discloses that the pseudogene RPLP0P6 can influence the self-renewal of liver cancer stem cells, verifies the action mode of the pseudogene RPLP0P6 on hsa-miR-497-5p / RPL32 axis on the cellular level, further confirms the influence of the pseudogene RPLP0P6 on the occurrence and development of liver cancer on the animal level, and does not have related research on the stemness regulation of the pseudogene RPLP0P6 in the liver cancer at present, which embodies the innovation of the pseudogene RPLP0P6. The research result of the invention provides new theoretical support for diagnosis and treatment of liver cancer, and has a relatively high application prospect.

Description

Technical Field

[0001] The present invention relates to the technical field of pseudogenes, and in particular to the application of the pseudogene RPLP0P6 as a diagnostic marker for liver cancer. Background Art

[0002] Hepatocellular carcinoma (HCC) is a common malignant tumor, accounting for about 90% of the total number of primary liver cancers and being the second most common cause of cancer-related deaths globally. The traditional treatment strategy for HCC is radical resection. However, due to the rapid proliferation and distant metastasis of liver cancer cells, etc., the recurrence rate of HCC is very high and the 5-year survival rate is low. The pathogenic factors of HCC include hepatitis infection (HBV or HCV), alcohol, aflatoxin B, metabolic alterations (insulin resistance, obesity, type II diabetes or non-alcoholic hepatitis), etc. These factors may induce DNA damage, epigenetic alterations and cancer-related gene mutations, leading to the silencing of tumor suppressor genes (such as TP53, CDH1, RASSF1) and the activation of oncogenes (such as MYC, VEGFA, MAPK7). In recent years, through the use of anti-hepatitis vaccines, screening of early biomarkers (such as alpha-fetoprotein), application of specific kinase inhibitors (such as Sorafenib and Regorafenib), surgical resection and liver transplantation and other treatment means, the deaths related to HCC have been reduced to a certain extent, but their curative effects are far from reaching the expected level. Therefore, in-depth study of the pathogenesis of HCC and finding new treatment targets or effective early diagnostic biomarkers are of great significance for improving the clinical diagnosis and treatment effect of HCC.

[0003] A pseudogene is a type of gene that cannot be expressed due to mutations, insertions or deletions in functional genes, and its transcriptional products are an important part of lncRNA. The term "pseudogene" was first proposed by Jacq et al. in 1977 when a copy of the 5S rRNA gene was found in Xenopus laevis, which had a 50-base truncation at the end and 14-base mismatches, rendering it non-functional. Since then, a large number of pseudogenes have been discovered in organisms from prokaryotes to eukaryotes. For a long time, pseudogenes were regarded as "junk genes", "evolutionary remnants" or "genomic fossils". However, in recent years, with the help of new generation sequencing technology and research on non-coding RNA, the functions of pseudogenes have been discovered in various cancers. Similar to ordinary lncRNA, lncRNA derived from pseudogenes can also play a key regulatory role in the occurrence and development of human cancers through the ceRNA mechanism of sponging miRNAs.

[0004] Studies have found that the pseudogene ANXA2P1 can promote the progression of hepatocellular carcinoma by regulating the expression of its parental gene ANXA2 through miRNA-376a-3p. The pseudogene PLGLA plays an anti-tumor role in hepatocellular carcinoma by regulating the miR-324-3p / GLYATL1 axis. The pseudogene PTTG3P promotes the growth and metastasis of liver cancer cells by upregulating PTTG1 and activating the PI3K / AKT signaling pathway. The pseudogene AKR1B10P1 promotes hepatocyte growth and epithelial-mesenchymal transition by directly adsorbing miR-138 to stabilize SOX4 expression.

[0005] Therefore, it will be of great significance to identify tumor-related pseudogenes and clarify their mechanisms of action. Summary of the Invention

[0006] The object of the present invention is to provide the application of the pseudogene RPLP0P6 as a diagnostic marker for liver cancer. Through this study, we will clarify the specific molecular mechanism by which the pseudogene RPLP0P6 regulates HCC. Targeting the pseudogene RPLP0P6 and its downstream key molecules may become a new strategy for the treatment of liver cancer.

[0007] To achieve the above object of the invention, the present invention provides the following technical solutions:

[0008] The present invention provides the application of the pseudogene RPLP0P6 as a tumor diagnostic marker, wherein the nucleotide sequence of the pseudogene RPLP0P6 is as shown in SEQ ID NO.1, and the tumor is liver cancer;

[0009] SEQ ID NO.1: ATGCCCAGGGAAGACAGGGCGACCTGGAAGTCCAACTACTTCCTTAAGATC ATCCAACTATTGGATGATTATCCAAAATGTTTCATCGTGGGAGCAGACAATGTGGGCTCCAAGCAGATGCAGCAGATCCGCATGTCCCTTCGCGGGAAGGTCGTGGTGCTGATGGGCAAGAACACCATGATGCGCAAGGCCATCCGAGGGCACCTGGAAAACAACCCAGCTCTGGAGAAACTGCTGCCTCATATCTGGGGGAATGTGGGCTTTGTGTTCACCAAGGAGGACCTCACTGAGATCAGGGACATGTTGCTGGCCAATAAGGTGCCAGCTGCTGCCCGTGCTGGTGCCATTGCCCCATGTGAAGTCACTGTGCCAGCCCAGAACACTGGTCTCGGGCCCGAGAAGACCTCCTTTTTCCAGGCTTTAGGTATCACCACTAAAATCTCCAGGGGCACCATTGAAATCCTGAGTGATGTGCAGCTGATCAAGACTGGAGACAAAGTGGGAGCCAGCGAAGCCACGCTGCTGAACATGCTCAACATCTCCCCCTTCTCCTTTGGGCTGGTCATCCAGCAGGTATTCGACAATGGCAGCATCTACAACCCTGAAGTGCTTGATAAAACAGAGGAAACTCTGCATTCTCGCTTCCTGGAGGGTGTCCGCAATGTTGCCAGTGTCTGTCTGCAGACTGGCTACCCAACTGTTGCATCAGTACCCCATTCTATCATCAACGGGTACAAACGAGTCCTGGCCTTGTCTGTGGAGACGGATTACACCTTCCCACTTGCTGAAAATGTCAAGGCCTTCTTGGCTGATCCATCTGCCTTTGTGGCTGCTGCCCCTGTGGCTGCTGACACCACAGCTGCTCCTGCTGCTGCTGCAGCCCCAGCTAAGGTTGAAGCCAAGGAAGAGTCGGAGGAGTCGGACGAGGATATGGGATTTGGTCTCTTTGACTAA。

[0010] The present invention also provides a primer set for detecting the pseudogene RPLP0P6, which includes RPLP0P6 primers, miR-497-5p primers, and RPL32 primers;

[0011] The RPLP0P6 primers include RPLP0P6-F and RPLP0P6-R. The nucleotide sequence of RPLP0P6-F is shown as SEQ ID NO.2, and the nucleotide sequence of RPLP0P6-R is shown as SEQ ID NO.3;

[0012] The miR-497-5p primers include miR-497-5p-RT, miR-497-5p-F, and miR-497-5p-R. The nucleotide sequence of miR-497-5p-RT is shown as SEQ ID NO.4, the nucleotide sequence of miR-497-5p-F is shown as SEQ ID NO.5, and the nucleotide sequence of miR-497-5p-R is shown as SEQ ID NO.6;

[0013] The RPL32 primers include RPL32-F and RPL32-R. The nucleotide sequence of RPL32-F is shown as SEQ ID NO.7, and the nucleotide sequence of RPL32-R is shown as SEQ ID NO.8.

[0014] The present invention also provides the application of the primer set in the preparation of a product for detecting the pseudogene RPLP0P6.

[0015] The present invention also provides a kit for detecting the pseudogene RPLP0P6, which contains the primer set.

[0016] Preferably, the kit also contains an shRNA plasmid for knocking down RPLP0P6.

[0017] The present invention also provides the application of the pseudogene RPLP0P6 in regulating the expression of miR-497-5p.

[0018] The present invention also provides the application of the pseudogene RPLP0P6 in regulating the expression of RPL32.

[0019] The present invention also provides the application of the pseudogene RPLP0P6 as a target for regulating the proliferation and stemness of liver cancer cells, wherein the tumor is liver cancer.

[0020] The present invention also provides the application of the pseudogene RPLP0P6 in enhancing the sensitivity to chemotherapy drugs, and the chemotherapy drug is oxaliplatin.

[0021] The present invention discloses that the pseudogene RPLP0P6 can affect the self-renewal of liver cancer stem cells, verifies the mode of action of the pseudogene RPLP0P6 on the hsa-miR-497-5p / RPL32 axis at the cellular level, and further confirms the influence of the pseudogene RPLP0P6 on the occurrence and development of liver cancer at the animal level. There is no relevant research on the regulation of stemness by the pseudogene RPLP0P6 in liver cancer at present, which reflects the innovation of the present invention. The research results of the present invention will provide new theoretical support for the diagnosis and treatment of liver cancer and have high application prospects. Brief Description of the Drawings

[0022] Figure 1 For bioinformatics analysis of the expression of the pseudogene RPLP0P6 in liver cancer and its correlation with the expression of stemness-related genes.

[0023] Figure 2 For the expression and localization of the pseudogene RPLP0P6 in liver cancer cells.

[0024] Figure 3 For the regulatory effects of the pseudogene RPLP0P6 on the proliferation, stem cell characteristics, and drug sensitivity of liver cancer cells.

[0025] Figure 4 For preliminary verification of the regulatory effect of the pseudogene RPLP0P6 on miR-497-5p.

[0026] Figure 5 For preliminary verification of the regulatory effect of miR-497-5p on RPL32.

[0027] Figure 6 For the effects of RPL32 on the proliferation, cell cycle, migration, and invasion of liver cancer cells.

[0028] Figure 7 For the regulatory effects of RPL32 on the colony formation, stem cell characteristics, and drug sensitivity of liver cancer cells. Detailed Description of the Invention

[0029] The technical solutions provided by the present invention are described in detail below in conjunction with the embodiments, but they should not be construed as limiting the protection scope of the present invention.

[0030] Example 1 Analysis of the Correlation between the Pseudogene RPLP0P6 / miR-497-5p / RPL32 Axis and the Occurrence and Development of Liver Cancer by Bioinformatics

[0031] 1. Pseudogene screening: Data mining was carried out through the TCGA database to screen for differentially expressed pseudogenes in liver cancer tissues and adjacent tissues, draw an expression map, and preliminarily determine the expression pattern of the pseudogene RPLP0P6 in liver cancer patients.

[0032] 2. Analysis of the expression of pseudogene RPLP0P6 and its correlation with the expression of tumor stemness-related genes: Analyze the expression of pseudogene RPLP0P6 through the TCGA database, as well as its correlation with the prognosis of liver cancer patients, and draw a correlation map; analyze the correlation between pseudogene RPLP0P6 and the expression of stem cell stemness-related genes c-Myc, SOX2, and Oct4 through the TCGA database.

[0033] 3. miRNA prediction and miR-497-5p expression analysis: Predict the miRNAs that bind to and are down-regulated in expression with pseudogene RPLP0P6 through the Starbase database, TargetScan website, and TCGA-LIHC database; analyze the expression of miR-497-5p in liver cancer tissues and adjacent tissues through the TCGA database; and analyze the correlation between the expression of miR-497-5p and the prognosis of liver cancer patients, and draw a correlation map.

[0034] 4. Prediction of miR-497-5p target genes: Predict the downstream target genes that bind to miR-497-5p through the mirDIP, starbase website, and TCGA-LIHC database; analyze the expression of RPL32 in liver cancer tissues and adjacent tissues through the TCGA database; and analyze the correlation between the expression of RPL32 and the prognosis of liver cancer patients, and draw a correlation map.

[0035] 5. Download the sequence of pseudogene RPLP0P6 (SEQ ID NO.1) in NCBI.

[0036] Example 2 Explore the expression and localization of the pseudogene RPLP0P6 / miR-497-5p / RPL32 axis in liver cancer cells and tissues

[0037] 1. Confirmation of the pseudogene RPLP0P6 sequence: Cultivate liver cancer cells SMMC-7721 and HuH-7 in vitro, extract total RNA, reverse transcribe it into cDNA, use PCR experiments to amplify the target fragment, and perform sequencing analysis.

[0038] 2. Localization analysis: Cultivate liver cancer cells SMMC-7721 and HuH-7 in vitro, use FISH experiments to detect the expression and localization of pseudogene RPLP0P6, and also separate the nucleus and cytoplasm of SMMC-7721, and use fluorescence quantitative PCR experiments to detect the expression of pseudogene RPLP0P6 in the nucleus and cytoplasm, further confirming the subcellular localization and expression of pseudogene RPLP0P6.

[0039] 3. Detection of the expression of the RPLP0P6 / miR-497-5p / RPL32 axis in hepatoma cells and normal hepatocytes: Eight human hepatoma cell lines, HCC-LM3, HepG2, huh-7, MHCC-97H, SMMC-7721, PLC / PRF / 5, SNU-182, and Li-7, and human normal hepatocytes THLE-2 were seeded into 6-well plates and cultured in vitro for 12 h. Cells were collected for total RNA extraction and reverse transcription, and the expression of the pseudogene RPLP0P6, miR-497-5p, and RPL32 was detected using fluorescence quantitative PCR. Using 18S RNA as an internal control, the relative expression levels were calculated using the 2 -ΔΔCt algorithm. The experiment was independently repeated 3 times. The primer information is shown in Table 2, the amplification system is shown in Table 3, and the amplification program is shown in Table 4.

[0040] Table 2 Sequence information

[0041]

[0042]

[0043] Table 3 Real-time quantitative PCR amplification system

[0044]

[0045] Table 4 Real-time quantitative PCR amplification program

[0046]

[0047] 4. Detection of the expression of the RPLP0P6 / miR-497-5p / RPL32 axis in clinical hepatoma and adjacent tissues: One hundred patients who underwent hepatoma surgery were selected, and 100 mg of hepatoma tissues and adjacent normal tissues resected during the operation were collected for total RNA extraction and reverse transcription. The expression of the pseudogene RPLP0P6, miR-497-5p, and RPL32 in human hepatoma and adjacent tissues was detected using fluorescence quantitative PCR, and the clinical pathological data of the patients, including age, gender, tissue differentiation grade, infiltration degree, TNM stage, etc., were collected to explore the correlation between the expression of the pseudogene RPLP0P6 / miR-497-5p / RPL32 axis and the prognosis of hepatoma patients. For fluorescence quantitative PCR, the primer information used is shown in Table 2, the amplification system is shown in Table 3, and the amplification program is shown in Table 4.

[0048] Example 3 Study on the regulatory effect of the pseudogene RPLP0P6 on the proliferation and stemness of hepatoma cells

[0049] 1. Regulatory effect of the pseudogene RPLP0P6 on the proliferation and stemness of hepatoma cells

[0050] (1) Vector construction and verification: Construct the pLKO.1-RPLP0P6 shRNA lentiviral vector (containing 3 different targets) and pLVX-CMV-RPLP0P6-pGK-puro. After the vector sequencing was correct, the plasmid was extracted in large quantities and endotoxin was removed. At the same time, SMMC-7721 cells were seeded into 6-well plates and were transiently transfected with the RPLP0P6 shRNA lentiviral vector and the RPLP0P6 overexpression lentiviral vector respectively. After culturing for 48 h, the cells were collected for total RNA extraction and reverse transcription. Fluorescence quantitative PCR experiments were used to detect the interference efficiency of RPLP0P6 shRNA and the overexpression efficiency of RPLP0P6, and an shRNA with the best interference effect was determined for subsequent research. The shRNA sequence information is shown in Table 5, and the RPLP0P6 overexpression primer sequence is shown in Table 6.

[0051] Table 5 Sequence information

[0052]

[0053]

[0054] Table 6 Primer information

[0055]

[0056] (2) Lentiviral infection and construction and verification of stable transfected cell lines: The constructed lentiviral vector was co-transfected with the lentiviral packaging plasmid into 293T cells. The cell supernatant 48 h after transfection was collected and filtered using a 0.45 μm filter. Ultracentrifugation was performed at 4 °C, 25000 rpm for 2 h to obtain concentrated virus, which was used to infect SMMC-7721 and HuH-7 cells, and puro antibiotic was used for screening. The virus infection efficiency was observed under a microscope.

[0057] (3) Experimental grouping: shRNANC, RPLP0P6 shRNA, Vector, RPLP0P6 OE.

[0058] (4) Detection of the expression of the RPLP0P6 / miR-497-5p / RPL32 axis: The expression of the pseudogene RPLP0P6, miR-497-5p and RPL32 was detected by fluorescence quantitative PCR experiments; the expression of the RPL32 protein was detected by Western Blot. The primer information for fluorescence quantitative PCR is shown in Table 2, the amplification system is shown in Table 3, and the amplification program is shown in Table 4.

[0059] (5) Effects of pseudogene RPLP0P6 on the proliferation and stemness of liver cancer: Detect the expression of stemness genes OCT-4, Nanog, and c-MYC by Western Blot; Detect the expression of stemness surface markers CD44 and CD133 by flow cytometry; Detect the proliferation ability of liver cancer cells by MTT and EdU assays, and plot the growth curve; Detect the apoptosis of liver cancer cells by Annexin V / PI flow cytometry and TUNEL assay; Detect the colony formation ability of liver cancer cells by colony formation assay; Detect the microsphere formation ability of human liver cancer cells by sphere formation assay and perform quantitative analysis.

[0060] 2. Effects of pseudogene RPLP0P6 on the chemosensitivity of liver cancer cells

[0061] (1) Cell grouping: shRNANC, RPLP0P6 shRNA, Vector, RPLP0P6 OE.

[0062] (2) Oxaliplatin treatment and MTT: Exogenously add different concentration gradients of oxaliplatin for 48 h to make the final concentrations 0, 5 μM, 10 μM, 15 μM, and 20 μM respectively. Use the MTT assay to detect the proliferation of liver cancer cells and calculate the IC50.

[0063] (3) Oxaliplatin treatment and colony formation assay: Exogenously add oxaliplatin for 48 h and use the colony formation assay to detect the effect on colony formation ability.

[0064] (4) Oxaliplatin treatment and sphere formation assay: Exogenously add oxaliplatin for 48 h, use the sphere formation assay to detect the effect on the microsphere formation ability of liver cancer cells and perform quantitative analysis.

[0065] Example 4 Study on the regulatory effect of the pseudogene RPLP0P6 / miR-497-5p / RPL32 axis on the proliferation and stemness of liver cancer cells at the cellular level

[0066] 1. Luciferase reporter gene assay: Construct pmirGLO-RPLP0P6 vector, pmirGLO-RPLP0P6-mut vector, pmirGLO-RPL32-3’UTR vector, pmirGLO-RPL32-3’UTR-mut vector, and synthesize miR-497-5p mimics and its control. Co-transfect the above vectors with miR-497-5p mimics and its control into SMMC-7721 cells and detect using a dual-luciferase reporter gene detection kit. The results are obtained by dividing the RLU value measured by Renilla luciferase by the RLU value measured by firefly luciferase. The sequence information of the luciferase reporter vector is shown in Table 7, and the sequence information of the mimics is shown in Table 8.

[0067] Table 7 Luciferase reporter vector sequence

[0068]

[0069] Table 8 mimics sequence information

[0070]

[0071] 2. Rescue experiment to verify the regulatory effect of the pseudogene RPLP0P6 / miR-497-5p / RPL32 axis on the growth, proliferation and stemness of hepatocellular carcinoma cells

[0072] (1) Experimental grouping: shRNANC, RPLP0P6 shRNA, RPLP0P6 shRNA + inhibitor-NC, RPLP0P6 shRNA + miR-497-5p inhibitor, RPLP0P6 shRNA + Vector, RPLP0P6 shRNA + RPL32OE. The constructed lentivirus was used to infect SMMC-7721 and HuH-7 cells according to the grouping. After 48 hours, relevant experiments were carried out. The siRNA sequence information is shown in Table 9, and the Inhibitor sequence information is shown in Table 10.

[0073] Table 9 siRNA sequence information

[0074]

[0075] Table 10 inhibitor sequence information

[0076] Plasmid Sequence information (5’→3’) Sequence number inhibitorNC CAGUACUUUUGUGUAGUACAA SEDIDNO.40 hsa-miR-497-5pinhibitor ACAAACCACAGUGUGCUGC SEDIDNO.41

[0077] (2) Detection of the expression of the RPLP0P6 / miR-497-5p / RPL32 axis: The expression of the pseudogene RPLP0P6, miR-497-5p and RPL32 was detected by fluorescence quantitative PCR experiment; the expression of RPL32 protein was detected by Western Blot.

[0078] (3) Effects of the pseudogene RPLP0P6 / miR-497-5p / RPL32 axis on the proliferation and stemness of hepatocellular carcinoma: The expression of stemness genes OCT-4, Nanog, c-MYC was detected by Western Blot; the expression of stemness surface markers CD44, CD133 was detected by flow cytometry; the proliferation ability of hepatocellular carcinoma cells was detected by MTT and EdU experiments, and the growth curve was drawn; the apoptosis of hepatocellular carcinoma cells was detected by Annexin V / PI flow cytometry and TUNEL experiment; the colony formation ability of hepatocellular carcinoma cells was detected by colony formation experiment; the ability of human hepatocellular carcinoma cells to form microspheres was detected by sphere formation experiment, and quantitative analysis was carried out.

[0079] (4) Effect of the pseudogene RPLP0P6 / miR-497-5p / RPL32 axis on the sensitivity of hepatocellular carcinoma cells to chemotherapeutic drugs: Different concentrations of oxaliplatin were added externally and treated for 48 h to make the final concentrations 0, 5 μM, 10 μM, 15 μM, and 20 μM respectively. The MTT assay was used to detect the proliferation of hepatocellular carcinoma cells, and the IC50 was calculated; the colony formation assay was used to detect the effect on colony formation ability; the spheroid formation assay was used to detect the effect on the spheroid formation ability of hepatocellular carcinoma cells, and quantitative analysis was performed.

[0080] Example 5 Verification of the mechanism of action of the pseudogene RPLP0P6 / miR-497-5p / RPL32 axis in the occurrence and development of liver cancer at the animal level

[0081] 1. Tumor formation in nude mice by in vivo serial dilution method: 70 SPF-grade immunodeficient NOD-SCID mice weighing 20 - 25 g were purchased, adaptively fed for 1 week, and randomly divided into 10 groups, 5 groups of shRNANC (10, 102, 103, 104, 105), and 5 groups of RPLP0P6 shRNA (10, 102, 103, 104, 105). The processed SMMC-7721 cells were injected according to the grouping for tumor formation in nude mice. The changes in tumor size were observed, the tumor growth was detected at different time points, the tumor volume was recorded, the tumor formation rate was detected. If the tumor formation rate was 100%, the tumor mass was detected, and the tumor inhibition rate was calculated, etc. After 12 weeks, the 10 groups of mice were sacrificed by cervical dislocation, and the subcutaneous tumor masses were taken for pathological examination.

[0082] 2. Verification of the effect of the pseudogene RPLP0P6 / miR-497-5p / RPL32 axis on the occurrence and development of liver cancer by functional complementation experiment at the animal level

[0083] (1) The experiment was divided into 4 groups: shRNANC, RPLP0P6 shRNA, RPLP0P6 shRNA + miR-497-5p inhibitor, RPLP0P6 shRNA + RPL32 OE.

[0084] (2) Tumor formation in nude mice: 40 SPF-grade immunodeficient NOD-SCID mice weighing 20 - 25 g were purchased, adaptively fed for 1 week, and the processed SMMC-7721 cells were injected according to the above grouping for tumor formation in nude mice. The changes in the body weight and tumor size of the mice were observed, the tumor growth was detected at different time points, the tumor volume was recorded, the tumor formation rate was detected. If the tumor formation rate was 100%, the tumor mass was detected, and the tumor inhibition rate was calculated, etc. After 7 weeks, the 4 groups of mice were sacrificed by cervical dislocation, and the subcutaneous tumor masses were taken for subsequent molecular and pathological staining.

[0085] (3) Detection of the expression of the RPLP0P6 / miR-497-5p / RPL32 axis: The expression of the pseudogene RPLP0P6, miR-497-5p, and RPL32 was detected by fluorescence quantitative PCR experiments; the expression of the RPL32 protein was detected by Western Blot. The primer information for fluorescence quantitative PCR is shown in Table 2, the amplification system is shown in Table 3, and the amplification program is shown in Table 4.

[0086] (4) Detection of stemness genes: The expression of stemness genes OCT-4, Nanog, and c-MYC in tissues was detected by Western Blot.

[0087] (5) Sphere formation and flow cytometry detection: Fresh mouse tumor tissues were taken, and the tissue samples were digested and lysed with tissue lysate or trypsin to separate the tumor cells. The sphere-forming ability of mouse tumor tissue cells was detected by the sphere formation assay; the expression of stem cell surface markers CD44 and CD133 was detected by flow cytometry.

[0088] (6) Pathological staining: Tumor tissue samples were paraffin-embedded and sectioned. Hematoxylin and eosin (HE) staining was used to detect the tumorigenicity of subcutaneous tumor tissues; immunohistochemistry was used to detect the expression and distribution of Ki-67 to verify the proliferation ability of tumor cells; TUNEL staining was used to verify the apoptosis of liver cancer cells.

[0089] Experimental results

[0090] 1. Bioinformatics analysis of the expression of the pseudogene RPLP0P6 in liver cancer and its correlation with the expression of stemness-related genes

[0091] First, the situation of the pseudogene RPLP0P6 in liver cancer samples was analyzed through the TCGA database, and it was preliminarily determined that the pseudogene RPLP0P6 was significantly highly expressed in liver cancer patients ( Figure 1 A and B); further analysis of the correlation between the expression of the pseudogene RPLP0P6 and the prognosis of liver cancer patients found that patients with high expression of the pseudogene RPLP0P6 had a poor prognosis ( Figure 1 C); at the same time, it was found that RPLP0P6 was significantly positively correlated with the expression of tumor stemness-related genes c-Myc, SOX2, and Oct4 ( Figure 1 D-F). In addition, the sequence of the pseudogene RPLP0P6 (SEQ ID NO.1) was downloaded from NCBI, and the Version was ENST00000394878.2.

[0092] Figure 1For the results of bioinformatics analysis of the expression of the pseudogene RPLP0P6 in liver cancer and its correlation with the expression of stemness-related genes, where A shows the mRNA expression levels of the pseudogene RPLP0P6 in liver cancer and normal tissue samples analyzed by the wTCGA database; B shows the mRNA expression levels of the pseudogene RPLP0P6 in paired liver cancer samples analyzed by the TCGA database; C shows the correlation between the expression of the pseudogene RPLP0P6 and the prognosis of liver cancer patients analyzed by the TCGA database; D-F show the correlation analysis between the pseudogene RPLP0P6 and the expression of tumor stem cell stemness-related genes c-Myc, SOX2, and Oct4.

[0093] 2. Expression and localization of the pseudogene RPLP0P6 in liver cancer cells

[0094] To determine the expression and localization of the endogenous pseudogene RPLP0P6 in human liver cancer cell line SMMC-7721, we used fluorescence in situ hybridization (FISH) technique to determine the subcellular localization of the pseudogene RPLP0P6 by comparing the localization of control probes 18S and U6. The results showed that the pseudogene RPLP0P6, like 18S, was localized in the cytoplasm ( Figure 2 ), thus its function in the cytoplasm could be further explored.

[0095] Figure 2 The results of the expression and localization of the pseudogene RPLP0P6 in liver cancer cells. The expression and localization of the pseudogene RPLP0P6 in SMMC-7721 cells were detected by FISH experiment, with 18S RNA and U6 as internal references, where 18S RNA represents the cytoplasm and U6 represents the nucleus, and DAPI stains the nucleus.

[0096] 3. Regulatory effects of the pseudogene RPLP0P6 on the proliferation, stem cell characteristics, and drug sensitivity of liver cancer cells

[0097] To explore the effects of the pseudogene RPLP0P6 on the functions of liver cancer cells, we constructed a stable knockdown cell line of SMMC-7721 with pseudogene RPLP0P6 shRNA, and detected the regulatory effects of the pseudogene RPLP0P6 on the proliferation, stem cell self-renewal, and chemoresistance of human liver cancer cells through CCK8, chemotherapeutic drug sensitivity experiment, plate cloning, and spheroid formation experiments to clarify the cellular functions of the pseudogene RPLP0P6. The results showed that in SMMC-7721 cells, compared with the control group, the pseudogene RPLP0P6 shRNA group showed a significant knockdown efficiency at the mRNA level ( Figure 3 A), and the pseudogene RPLP0P6 shRNA could significantly inhibit the growth rate of liver cancer cells ( Figure 3 B), improve the chemosensitivity to oxaliplatin ( Figure 3 C), and inhibit the colony formation rate (Figure 3 D and E) and spheroid formation ability ( Figure 3 F and G).

[0098] Figure 3 Results of the regulatory effects of the pseudogene RPLP0P6 on the proliferation, stem cell characteristics, and drug sensitivity of hepatocellular carcinoma cells. A shows the knockdown efficiency of the pseudogene RPLP0P6 shRNA detected by fluorescence quantitative PCR. B shows the proliferation ability of SMMC-7721 cells with knockdown of the pseudogene RPLP0P6 shRNA and control cells detected by CCK8 assay. Time points of 0, 24 h, 48 h, and 72 h were selected to plot the growth curve. C shows the effect of knockdown of the pseudogene RPLP0P6 on the drug sensitivity of oxaliplatin in SMMC-7721 hepatocellular carcinoma cells detected by MTT assay, and the IC50 was determined. D and E show the colony formation ability of SMMC-7721 cells with knockdown of the pseudogene RPLP0P6 shRNA and control cells detected by plate cloning assay, and quantitative analysis was performed. F and G show the spheroid formation ability of SMMC-7721 cells with knockdown of the pseudogene RPLP0P6 shRNA and control cells detected by spheroid formation assay, and quantitative analysis was performed. Scale bar: 100 μm; ***p < 0.001, ****p < 0.0001; NC: control.

[0099] 4. Preliminary verification of the regulatory effect of the pseudogene RPLP0P6 on miR-497-5p

[0100] Since the pseudogene RPLP0P6 is located in the cytoplasm, it is very likely to exert a ceRNA regulatory mode and thus affect the function of hepatocellular carcinoma cells. To verify this, we predicted the miRNAs that bind to the pseudogene RPLP0P6 through the Starbase database and TargetScan website, and intersected them with the miRNAs significantly downregulated in TCGA-LIHC. Finally, 2 miRNAs were found to possibly interact with the pseudogene RPLP0P6 ( Figure 4 A), namely miR-497-5p and hsa-miR 214-3p, and a significant negative correlation between miR-497-5p and the pseudogene RPLP0P6 was confirmed through correlation analysis ( Figure 4 B and C); the situation of the pseudogene miR-497-5p in liver cancer samples was analyzed through the TCGA database, and it was preliminarily determined that miR-497-5p was significantly lowly expressed in liver cancer patients ( Figure 4 D and E); further analysis of the correlation between the expression of miR-497-5p and the prognosis of liver cancer patients found that patients with low expression of miR-497-5p had a poor prognosis ( Figure 4 F); then, we used a dual-luciferase reporter gene assay to prove the interaction between the pseudogene RPLP0P6 and miR-497-5p ( Figure 4G and H), and the fluorescence quantitative PCR experiment was used to prove that the pseudogene RPLP0P6 could regulate the expression of miR-497-5p( Figure 4 I).

[0101] Figure 4 To preliminarily verify the results of the regulatory effect of the pseudogene RPLP0P6 on miR-497-5p, A was to use the Starbase database, TargetScan website, and TCGA-LIHC database to predict the miRNAs that bind to the pseudogene RPLP0P6 and are down-regulated in expression; B and C were the correlation analyses of hsa-miR-497-5p and hsa-miR214-3p with the pseudogene RPLP0P6 respectively; D was the analysis of the miR-497-5p expression level in liver cancer and normal tissue samples by the TCGA database; E was the analysis of the miR-497-5p expression level in paired liver cancer samples by the TCGA database; F was the analysis of the correlation between miR-497-5p expression and the prognosis of liver cancer patients by the TCGA database; G and H were the luciferase reporter gene experiments to detect the interaction between RPLP0P6 and hsa-miR-497-5p in SMMC-7721 liver cancer cells after transfection with RPLP0P6 3'UTRWT and RPLP0P6 3'UTR Mutant followed by transfection with NC or hsa-miR-497-5p mimics respectively; F was the fluorescence quantitative PCR experiment to detect the expression of hsa-miR-497-5p in SMMC-7721 cells with knockdown of the pseudogene RPLP0P6 shRNA and control cells. Scale bar: 100 μm; ***p < 0.001, ns: no significant difference; NC: negative control.

[0102] 5. Preliminary verification of the regulatory effect of miR-497-5p on RPL32

[0103] Bioinformatics analysis results showed that the pseudogene RPLP0P6 had the greatest correlation with ribosomal proteins in liver cancer. Therefore, we used the mirDIP and starbase websites to predict the downstream target genes that bind to miR-497-5p, intersected them with the target genes significantly up-regulated in TCGA-LIHC, and then intersected them with ribosomal proteins. Finally, 5 target proteins were determined to interact with miR-497-5p( Figure 5 A), namely RPL13, RPL14, RPL28, RPL32, and UBA52. Gene expression heat map analysis found that RPL32 had the highest expression level in liver cancer( Figure 5 B); TCGA database analysis showed that RPL32 was highly expressed in liver cancer tissue samples( Figure 5 C); Further analysis of the correlation between RPL32 expression and the prognosis of liver cancer patients found that there were differences in the prognosis of patients with high RPL32 expressionFigure 5 D); Through correlation analysis, it was shown that the expression of RPL32 was negatively correlated with that of miR-497-5p ( Figure 5 E), and positively correlated with the expression of the pseudogene RPLP0P6 ( Figure 5 E and F). Then, we respectively demonstrated the interaction between RPL32 and miR-497-5p through luciferase reporter gene assays ( Figure 5 G and H). In addition, the positive correlation between the expression of the pseudogene RPLP0P6 and RPL32 was confirmed by fluorescence quantitative PCR ( Figure 5 I).

[0104] Figure 5 To preliminarily verify the results of the regulatory effect of miR-497-5p on RPL32, A was to take the intersection of ribosomal proteins through the mirDIP, starbase websites, and the TCGA-LIHC database to predict the downstream target genes binding to hsa-miR-497-5p; B was the heatmap analysis of 5 ribosomal proteins, RPL13, RPL14, RPL28, RPL32, and UBA52 in liver cancer; C was the analysis of the expression of RPL32 in paired liver cancer and normal tissue samples in the TCGA database; D was the analysis of the correlation between RPL32 expression and the prognosis of liver cancer patients in the TCGA database; E and F were the correlation analyses of RPL32 with miR-497-5p and the pseudogene RPLP0P6; G and H were the detection of the interaction between RPLP0P6 and hsa-miR-497-5p in SMMC-7721 liver cancer cells after transfection with RPL32 3'UTRWT and RPL32 3'UTRMutant followed by transfection with NC or hsa-miR-497-5p mimics respectively by luciferase reporter gene assays; I was the detection of the mRNA expression of RPL32 in SMMC-7721 cells with knockdown of the pseudogene RPLP0P6 shRNA and control cells by fluorescence quantitative PCR. Scale bar: *p<0.05, ***p<0.001, ns: no significant difference.

[0105] 6. Effects of RPL32 on the proliferation, cycle, migration, and invasion of liver cancer cells

[0106] To explore the effects of RPL32 on the functions of liver cancer cells, we knocked down the expression of RPL32 with siRNA in the SMMC-7721 cell line, and detected the effects of RPL32 knockdown on the proliferation, cycle, migration, and invasion of human liver cancer cells by CCK8, flow cytometry, and Transwell assays. The results showed that compared with the control group, in SMMC-7721 cells with knockdown of RPL32, RPL32 siRNA showed obvious knockdown efficiency at the mRNA and protein levels ( Figure 6A and B); and knockdown of RPL32 can significantly inhibit the growth rate of hepatocellular carcinoma cells ( Figure 6 C), cell cycle arrest at the G0 / G1 phase ( Figure 6 D and E), a significant decrease in the number of migrating cells (6F and G), and a significant decrease in the number of invasive cells (6H and I).

[0107] Figure 6 . Results of the effects of RPL32 on the proliferation, cycle, migration and invasion of hepatocellular carcinoma cells. A shows the knockdown efficiency of RPL32 detected by fluorescence quantitative PCR; B shows the knockdown efficiency of RPL32 detected by Western Blot; C shows the proliferation ability of SMMC-7721 cells with RPL32 knockdown and control cells detected by CCK8 assay. Time points of 0, 24h, 48h, and 72h were selected to draw the growth curve; D and E show cell cycle detection by flow cytometry; F and G show cell migration detection by Transwell; H and I show cell invasion detection by Transwell; Scale bar: 100μm; ***p<0.001, ****p<0.0001; NC: control.

[0108] 7. Regulatory effects of RPL32 on the colony formation, stem cell characteristics and drug sensitivity of hepatocellular carcinoma cells

[0109] Further detection of the regulatory effects of RPL32 on the colony formation, stem cell characteristics and drug sensitivity of hepatocellular carcinoma cells. The results showed that, compared with the control group, in SMMC-7721 cells with RPL32 knockdown, knockdown of RPL32 could significantly inhibit the colony formation rate ( Figure 7 A and C), reduce the expression of the stemness gene CD44 ( Figure 7 B and D), and increase the chemosensitivity to oxaliplatin ( Figure 7 E).

[0110] Figure 7 Results of the regulatory effects of RPL32 on the colony formation, stem cell characteristics and drug sensitivity of hepatocellular carcinoma cells. A and C show the colony formation ability detected by plate colony assay and quantitative analysis; B and D show the expression of the stemness gene CD44 detected by flow cytometry; E shows the effect of RPL32 knockdown on the drug sensitivity of oxaliplatin detected by MTT assay and determination of IC50. Scale bar: 100μm; ***p<0.001, ****p<0.0001; NC: control.

[0111] As can be seen from the above embodiments, the present invention provides the use of the pseudogene RPLP0P6 as a liver cancer diagnostic marker. The nucleotide sequence of the pseudogene RPLP0P6 is shown in SEQ ID NO.1, and the tumor is liver cancer. The present invention reveals that the pseudogene RPLP0P6 can affect the self-renewal of liver cancer stem cells, verifies the action mode of the pseudogene RPLP0P6 on the hsa-miR-497-5p / RPL32 axis at the cellular level, and further confirms the influence of the pseudogene RPLP0P6 on the occurrence and development of liver cancer at the animal level. There is currently no relevant research on the regulation of stemness by the pseudogene RPLP0P6 in liver cancer, which reflects the innovation of the present invention. The research results of the present invention will provide new theoretical support for the diagnosis and treatment of liver cancer and have high application prospects.

[0112] The above are only the preferred embodiments of the present invention. It should be pointed out that for those of ordinary skill in the art, without departing from the principle of the present invention, several improvements and modifications can be made, and these improvements and modifications should also be regarded as the protection scope of the present invention.

Claims

1. Application of pseudogene RPLP0P6 as a tumor diagnostic marker, characterized in that: The nucleotide sequence of the pseudogene RPLP0P6 is shown in SEQ ID NO.1, and the tumor is liver cancer.

2. A primer set for detecting the pseudogene RPLP0P6, characterized in that: The primer set includes RPLP0P6 primer, miR-497-5p primer and RPL32 primer; The RPLP0P6 primers include RPLP0P6-F and RPLP0P6-R, the nucleotide sequence of RPLP0P6-F is shown in SEQ ID NO.2, and the nucleotide sequence of RPLP0P6-R is shown in SEQ ID NO.3; The miR-497-5p primers include miR-497-5p-RT, miR-497-5p-F and miR-497-5p-R, the nucleotide sequence of miR-497-5p-RT is shown in SEQ ID NO.4, the nucleotide sequence of miR-497-5p-F is shown in SEQ ID NO.5, and the nucleotide sequence of miR-497-5p-R is shown in SEQ ID NO.6; The RPL32 primers include RPL32-F and RPL32-R, the nucleotide sequence of RPL32-F is shown in SEQ ID NO.7, and the nucleotide sequence of RPL32-R is shown in SEQ ID NO.

8.

3. Use of the primer set according to claim 2 in preparing a product for detecting the pseudogene RPLP0P6.

4. A kit for detecting pseudogene RPLP0P6, characterized in that: The kit contains the primer set according to claim 2.

5. The kit according to claim 4, characterized in that The kit also contains a shRNA plasmid for knocking down RPLP0P6.

6. Application of pseudogene RPLP0P6 in regulating miR-497-5p expression.

7. Application of pseudogene RPLP0P6 in regulating RPL32 expression.

8. Use of the pseudogene RPLP0P6 as a target for regulating the proliferation and stemness of liver cancer cells, characterized in that: The tumor is liver cancer.

9. Application of pseudogene RPLP0P6 in improving sensitivity of chemotherapeutic drugs, characterized in that: The chemotherapy drug is oxaliplatin.

Images