SNP (Single Nucleotide Polymorphism) molecular marker for influencing content of yak immunoglobulin M and application of SNP molecular marker
By screening and verifying the SNP molecular markers at base 42437268 on chromosome 15 of the yak reference genome, the problem of disease problems in yak breeding was solved, especially by detecting the content of immunoglobulin M, which provides new marking resources for yak disease-resistant breeding.
Patent Information
- Application Number
- CN202510119969.9
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-01-25
- Publication Date
- 2025-06-03
AI Technical Summary
The prior art is difficult to effectively solve the disease problems in the yak breeding industry, especially the drug resistance problems caused by drug use, and there is relatively little research on molecular markers related to yak immunity.
The SNP molecular marker at base 42437268 on chromosome 15 of the yak reference genome LU_Bosgru_v3.0 version, the mutated base of this marker is A or G, which is used to detect the content of yak immunoglobulin M.
It was found that the content of immunoglobulin M in yak individuals with genotype AA and GG was significantly higher than that in yak individuals with genotype AG, and new SNP molecular marker resources were provided for non-diagnostic purposes for marker assisted selection of yak immune traits and yak assisted breeding.
Smart Images
Figure CN120082655A_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the technical field of biological detection, and particularly relates to an SNP molecular marker affecting the content of yak immunoglobulin M and its application. Background Art
[0002] As an indigenous animal on the Qinghai-Tibet Plateau and the only bovine species adapted to high altitudes, yaks play an important role in the local animal husbandry. However, the yak breeding industry is facing a major challenge to their health posed by diseases, and the existing prevention and control measures have limitations. In this context, using DNA molecular marker technology to explore genetic markers closely related to the disease resistance of yaks, and then assisting in disease-resistant breeding work, is a forward-looking and innovative research direction.
[0003] Yaks grow in alpine and complex grassland ecosystems, which makes them vulnerable to various diseases. These diseases not only threaten the lives of yaks but also cause significant economic losses to farmers. Although measures such as improving feeding management, using drugs and vaccines can prevent some diseases to a certain extent, the spread of infectious diseases is still difficult to be effectively controlled. More seriously, the widespread use of drugs may lead to the emergence of drug resistance, which in turn affects the safety and quality of livestock products.
[0004] With the rapid development of DNA molecular marker technology, it has laid a foundation for people to study the genetic mechanism of yak disease resistance at the molecular level. Screening and obtaining molecular markers closely related to yak disease resistance, these markers will be more effectively used for the screening and assistance of yak disease-resistant breeding. However, the current research on molecular markers related to yak immunity is still relatively scarce. Therefore, further strengthening basic research and applied research to reveal more genetic markers related to yak disease resistance, using DNA molecular marker technology to screen SNP molecular markers related to yak disease resistance, and applying them to the practice of disease-resistant breeding is one of the important ways to solve the disease problems in the yak breeding industry. Summary of the Invention
[0005] The purpose of the present invention is to provide an SNP molecular marker affecting the content of yak immunoglobulin M and its application.
[0006] In order to achieve the above invention purpose, the present invention provides the following technical solutions:
[0007] The present invention also provides an SNP molecular marker for detecting the content of yak immunoglobulin M, and the SNP molecular marker is located at the 42437268th base on chromosome 15 of the yak reference genome LU_Bosgru_v3.0 version, and the mutated base is A or G.
[0008] Preferably, according to the molecular marker alleles, yaks have three genotypes: AA, AG, or GG;
[0009] The content of immunoglobulin M in yak individuals with genotypes AA and GG is significantly higher than that in yak individuals with genotype AG.
[0010] The present invention also provides the application of the SNP molecular marker in the preparation of a product for detecting the content of immunoglobulin M in yaks.
[0011] The present invention also provides the application of the SNP molecular marker in the preparation of a product for yak assisted breeding.
[0012] The present invention also provides a primer pair for the SNP molecular marker for detecting the content of immunoglobulin M in yaks, and the primer pair is shown as SEQ ID NO.1 - 2;
[0013] The SNP molecular marker is located at the 42,437,268th base on chromosome 15 of the yak reference genome LU_Bosgru_v3.0 version, and the mutated base is A or G.
[0014] The present invention also provides the application of the primer pair in the preparation of a product for detecting the content of immunoglobulin M in yaks.
[0015] The present invention also provides the application of the primer pair in the preparation of a product for yak assisted breeding.
[0016] The present invention also provides a kit for detecting the content of immunoglobulin M in yaks, including a reagent for detecting the SNP molecular marker or the primer pair.
[0017] The present invention also provides a kit for yak assisted breeding, including a reagent for detecting the SNP molecular marker or the primer pair.
[0018] The present invention provides an SNP molecular marker affecting the content of yak immunoglobulin M and its application. The SNP molecular marker for detecting the content of yak immunoglobulin M is located at the 42,437,268th base on chromosome 15 of the yak reference genome LU_Bosgru_v3.0 version, and the mutated base is A or G; when the 42,437,268th base on chromosome 15 is A, the yak genotype is AA or AG; when the 42,437,268th base on chromosome 15 is G, the yak genotype is GG; through the correlation analysis of different genotypes with the contents of IgA, IgG, and IgM, it is found that the content of immunoglobulin M in yak individuals with the genotypes AA and GG is significantly higher than that in yak individuals with the genotype AG (p<0.05). By detecting the base at the 42,437,268th nucleotide site on chromosome 15 of the yak, the IgM content of the yak individual can be judged. The present invention provides a new SNP molecular marker resource for marker-assisted selection of yak immune traits for non-diagnostic purposes, providing a basis for yak assisted breeding. Brief Description of the Drawings
[0019] Figure 1 is the PCR amplification product; where M represents Marker.
[0020] Figure 2 is the peak map and sequence obtained after the PCR product is purified and sequenced. Detailed Embodiments
[0021] The present invention provides an SNP molecular marker for detecting the content of yak immunoglobulin M. The SNP molecular marker is located at the 42,437,268th base on chromosome 15 of the yak reference genome LU_Bosgru_v3.0 version, and the mutated base is A or G;
[0022] The sequence including this SNP molecular marker is shown in SEQ ID NO:3, and the SNP molecular marker is located at the 338th position of this sequence.
[0023] SEQ ID NO:3: GCAGGAGATAGTTGGCATACTCAAAATATCCAAATCAAACACTAAAAATTATTTGTACCAGTTTGGTTATGTTAATTACTTTGATTGATATTTGGATTTGACATAAGGCAAGAGAGGAAAAAAAAAACTTTTTCACTGTATTTCCAAATATCATTCTCTACTTAAACATAATGAAAATGTTCCATTTTTAAAACAAATTGTGATGAGTGAGGAAAAGTGGACATTTACAATAATATGGAGCTAAAGAGATCAATGTGCAAGCGAAATAAATCACACCAACCACAGCAAAGTCTGATCTTCATCCAAAGAATGTGATGATGTGTATATGATTGTATTG G AAGGGAGTCTTTTAATATGAGATCCTTCCTGAAAACCAAATTATTATTTTCAACAAGTACTGCTCTCAACCAAATGAAAGCAGCATTGAATAAAATTGCCCAGGATTATTAGACAATAGCAAATACATAAAGTGCCATCAAATTTGGCCTTAGAGTACAAAATAAAGCAGGTCAAAGGCTAAGAGAGTTTTACTGAGAGCTCACTGACCACTCTTCCAATG。
[0024] The primer pair for amplifying SEQ ID NO:3 is shown as SEQ ID NO.1 - 2;
[0025] Forward primer SEQ ID NO.1: 5'-GCAGGAGATAGTTGGCATA-3';
[0026] Reverse primer SEQ ID NO.2: 5'-CATTGGAAGAGTGGTCAGT-3'.
[0027] In the present invention, the amplification system is: 2×L-Exp Taq Master Mix (dye plus) 12.5 μL, RNase free water 8.5 μL, forward primer 1 μL, reverse primer 1 μL, template DNA 2 μL.
[0028] In the present invention, the amplification program is: 98°C for 2 min; 98°C for 10 s, 54.5°C for 30 s, 72°C for 10 s, for a total of 35 cycles; 72°C for extension for 2 min.
[0029] The technical solutions provided by the present invention will be described in detail below in conjunction with the embodiments, but they should not be construed as limiting the protection scope of the present invention.
[0030] Example 1
[0031] 1 Sample collection
[0032] Taking female Yaks as the detection object, 5 mL of fasting Yak blood samples were collected from the pasture in Jiali County, Nagqu City, Tibet Autonomous Region into clean coagulant-promoting vacuum blood collection tubes, left standing for 30 min, then centrifuged at 3500 r / min for 10 min, and the supernatant was aspirated into a PE tube, sealed and stored in a low-temperature refrigerator at -20 °C; another 5 mL of blood sample was added to a blood collection tube containing EDTA-K2 anticoagulant, quickly mixed after blood sample collection, placed in a sampling box containing ice packs for temporary storage, and frozen and stored in a refrigerator at -20 °C after being transported back to the laboratory for DNA extraction.
[0033] 2 Main reagents and instruments
[0034] EDTA-K2 vacuum blood collection tubes were purchased from Jiangsu Yuli Medical Instrument Co., Ltd.; blood genomic DNA extraction kits were purchased from Tiangen Biochemical Technology (Beijing) Co., Ltd.; NanoDrop 2000 spectrophotometers were purchased from Thermo Fisher Scientific Company, USA; DL2000 Marker, agarose, and nucleic acid dyes were all purchased from Beijing Solarbio Science & Technology Co., Ltd.; 2×L-Exp Taq MasterMix (dye plus) was purchased from Hunan Aikery Biotechnology Co., Ltd.; electrophoresis apparatuses were purchased from Beijing Liuyi Instrument Factory; PCR apparatuses were purchased from BioRad Company. Immunoglobulin A (IgA) (MB-4907A), Immunoglobulin G (IgG) (MB-4616A), and Immunoglobulin M (IgM) (MB-4908A) detection kits were purchased from Jiangsu Enzyme-linked Immunosorbent Assay Biotechnology Co., Ltd.
[0035] 3 Methods
[0036] 3.1 Detection of immunoglobulins IgA, IgG, and IgM
[0037] According to the IgA, IgG, and IgM detection kits of Jiangsu Enzyme Biotechnology Co., Ltd., the double antibody one-step sandwich method was used for determination. First, the required strips were taken out from the aluminum foil bag after equilibration at room temperature for 20 minutes, and the remaining strips were sealed with a self-sealing bag and returned to 4°C. Set up standard wells and sample wells, and add 50μL of different concentrations of standard wells to each standard well; first add 10μL of the sample to be tested to the sample well, and then add 40μL of sample diluent; blank wells are not added. In addition to the blank wells, 100μL of horseradish peroxidase (HRP)-labeled detection antibody is added to each well of the standard well and sample well, and the reaction wells are sealed with a sealing film, and incubated at 37°C water bath or constant temperature box for 60min. Discard the liquid, pat dry on absorbent paper, fill each well with washing solution, let stand for 1min, shake off the washing solution, pat dry on absorbent paper, and repeat the washing 5 times (you can also use a plate washer to wash the plate). Add 50μL of substrate A and B to each well and incubate at 37°C in the dark for 15min. Add 50 μL of stop solution to each well, and measure the OD value of each well at a wavelength of 450 nm within 15 minutes. Finally, draw a standard curve: in an Excel worksheet, use the concentration of the standard as the horizontal axis and the corresponding OD value as the vertical axis to draw a linear regression curve of the standard, and calculate the IgA, IgG, and IgM concentration values of each sample according to the curve equation.
[0038] 3.2 Extraction of genomic DNA from blood
[0039] The blood genome extraction kit of Tiangen Biochemical Technology (Beijing) Co., Ltd. was used to extract genomic DNA from the blood samples. The extracted DNA was placed under an ultraviolet spectrophotometer to detect the concentration and purity. The concentration was >20ng / μL and OD 260 / OD 280 A value between 1.7 and 1.9 meets the experimental requirements and can be stored at -20°C for future use.
[0040] 3.3 Primer design
[0041] Referring to the chromosome 15 sequence of the yak genome LU_Bosgru_v3.0 version, the Primers online tool provided by the NCBI website was used to design specific primers, including the g42437268A>GSNP site.
[0042] Primer sequences
[0043] F: 5'-GCAGGAGATAGTTGGCATA-3' (SEQ ID NO: 1);
[0044] R: 5'-CATTGGAAGAGTGGTCAGT-3' (SEQ ID NO: 2).
[0045] The length of the amplified fragment was 559 bp, and the primers were synthesized by Beijing Qingke Biotechnology Co., Ltd.
[0046] 3.4 PCR amplification and sequencing
[0047] PCR amplification system 25 μL: 2×L-Exp Taq MasterMix (dye plus) 12.5 μL, RNase free water 8.5 μL, upstream primer 1 μL, downstream primer 1 μL, template DNA 2 μL.
[0048] PCR amplification program: 98°C for 2 min; 98°C for 10 s, 54.5°C for 30 s, 72°C for 10 s, for a total of 35 cycles; extension at 72°C for 2 min.
[0049] The PCR products were tested by 1% agarose gel electrophoresis. After the PCR products passed the agarose gel electrophoresis test, they were sequenced by direct sequencing, and the sequencing was completed by Beijing Qingke Biotechnology Co., Ltd. Figure 1 shown. Figure 1 It shows that the length of the sequence obtained by PCR amplification is 559bp. After sequencing, it is found that the nucleotide sequence at position 338 of the amplified product (the 42437268th base on chromosome 15 of the genome LU_Bosgru_v3.0 version) has an A / G mutation. The amplified product band is clear without any mixed bands and has good specificity. The site was preliminarily identified as the SNP marker site of yak and named g42437268A>G SNP. The sequence obtained by PCR amplification is shown in SEQ ID NO:3, and the 338th position of the sequence is a G mutation. The fragment size of the PCR amplified product meets the expected size, and the next step of the experiment can be carried out.
[0050] SEQ ID NO:3
[0051] GCAGGAGATAGTTGGCATACTCAAAATATCCAAATCAAACACTAAAAATTATTTGTACCAGTTTGGTTATGTTAATTACTTTGATTGATATTTGGATTTGACATAAGGCAAGAGAGGAAAAAAAAAACTTTTTCACTGTATTTCCAAATATCATTCTCTACTTAAACA TAATGAAAATGTTCCATTTTTAAAACAAATTGTGATGGTGAGGAAAAGTGGACATTTACAATAATATGGAGCTAAAGAGATCAATGTGCAAGCGAAATAAATCACACCAACCACAGCAAAGTCTGATCTTCATCCAAAGAATGTGATGATGTGTATATGATTGTATTG GAAGGGAGTCTTTTAATATGAGATCCTTCCTGAAAACCAAATTATTATTTTCAACAAGTACTGCTCTCAACCAAATGAAAGCAGCATTGAATAAAATTGCCCAGGATTATTAGACAATAGCAAATACATAAAGTGCCATCAAATTTGGCCTTAGAGTACAAAATAAAGCAGGTCAAAGGCTAAGAGAGTTTTACTGAGAGCTCACTGACCACTCTTCCAATG
[0052] The sequencing results of the PCR products were aligned using the bioinformatics software MEGA 11.0, the sequencing peak maps were analyzed, and genotyping was completed.
[0053] 4 Statistical analysis
[0054] According to the gene typing results, the number of individuals with different genotypes at each locus was counted. The gene frequency, genotype frequency, effective number of alleles (Ne), locus heterozygosity (He), and Hardy-Weinberg equilibrium test of the g42437268A>G gene were calculated using the Popgen32 software, and the polymorphic information content was calculated using the PIC (polymorphism information content) calculation software. The general linear model in the IBM SPSS Statistics 26 software was used to analyze the association between different genotypes of yaks and immunoglobulins IgA, IgG, and IgM, and the results were expressed as "mean ± standard error".
[0055] 5 Results
[0056] 5.1 PCR amplification and sequencing results
[0057] The amplification products of the g42437268A>G SNP locus on chromosome 15 of yaks were detected using 1% agarose gel (see Figure 1 ), the bands were clear without heterozygous bands, the specificity was good, and the fragment size of the PCR product was 559 bp, which was consistent with the expected size, and the next experiment could be carried out.
[0058] The peak maps and sequences obtained after purification and sequencing of the PCR products are shown in Figure 2 . As can be seen from Figure 2 , an A-G mutation occurred at the g42437268A>G SNP locus, and there were three genotypes: AA, AG, and GG.
[0059] 5.2 Statistical analysis results
[0060] Analyze the genotype and allele frequencies of the g42437268A>G SNP locus on chromosome 15 of yaks from the perspective of population genetics. As shown in Table 1, at the g42437268A>G SNP locus, the frequency of the A allele was 58.1%, showing a dominant allele. By χ 2 The adaptability test showed that the SNP locus was in Hardy-Weinberg equilibrium (P>0.05) (Table 1). The expected heterozygosity of this locus was 0.487, and the PIC was 0.368. Since 0.25<PIC<0.50, it belonged to moderate polymorphism.
[0061] Table 1 Polymorphism of the g42437268A>G SNP locus on chromosome 15 of yaks
[0062]
[0063] 5.3 Association analysis of different genotypes with IgA, IgG, and IgM
[0064] The general linear model in IBM SPSS Statistics 26 software was used to analyze the association between different genotypes of yaks and the contents of immunoglobulins IgA, IgG, and IgM. The results showed that the content of immunoglobulin M in yak individuals with genotypes AA and GG was significantly higher than that in yak individuals with genotype AG (p<0.05). There were no significant differences in immunoglobulins IgA and IgG among individuals with genotype AG (p>0.05). The results are shown in Table 2.
[0065] Table 2 Correlation analysis between different genotypes and immunoglobulins IgA, IgG, and IgM
[0066]
[0067] Note: Different lowercase letters marked between data in the same row indicate significant differences (P<0.05).
[0068] As shown in Table 2, the content of immunoglobulin M in yak individuals with genotypes AA and GG was significantly higher than that in yak individuals with genotype AG (p<0.05), indicating that the base at the g42437268A>G SNP locus on chromosome 15 of yaks was significantly correlated with yak IgM (p<0.05), and it was a SNP molecular marker related to yak IgM.
[0069] The present invention provides an SNP molecular marker affecting the content of yak immunoglobulin M and its application. The SNP molecular marker for detecting the content of yak immunoglobulin M is located at the 42,437,268th base on chromosome 15 of the yak reference genome LU_Bosgru_v3.0 version, and the mutant base is A or G; when the 42,437,268th base on chromosome 15 is A, the yak genotype is AA or AG; when the 42,437,268th base on chromosome 15 is G, the yak genotype is GG; through the correlation analysis of different genotypes with the contents of IgA, IgG, and IgM, it is found that the content of immunoglobulin M in yak individuals with the genotypes AA and GG is significantly higher than that in yak individuals with the genotype AG (p<0.05). By detecting the base at the 42,437,268th nucleotide site on chromosome 15 of the yak, the IgM content of yak individuals can be judged. The present invention provides a new SNP molecular marker resource for marker-assisted selection of yak immune traits for non-diagnostic purposes and provides a basis for yak assisted breeding.
[0070] The above are only the preferred embodiments of the present invention. It should be noted that for those of ordinary skill in the art, without departing from the principle of the present invention, several improvements and refinements can be made, and these improvements and refinements should also be regarded as the protection scope of the present invention.
Claims
1. A SNP molecular marker for detecting the content of immunoglobulin M in yaks, characterized in that: The SNP molecular marker is located at the 42437268th base on chromosome 15 of the yak reference genome LU_Bosgru_v3.0 version, and the mutant base is A or G.
2. The SNP molecular marker according to claim 1, characterized in that: According to the molecular marker alleles, there are three genotypes of yaks: AA, AG, or GG; The content of immunoglobulin M in yaks with genotypes AA and GG was significantly higher than that in yaks with genotype AG.
3. Use of the SNP molecular marker according to claim 1 or 2 in the preparation of a product for detecting the content of yak immunoglobulin M.
4. Use of the SNP molecular marker according to claim 1 or 2 in the preparation of products for yak assisted breeding.
5. A primer pair for detecting SNP molecular markers of yak immunoglobulin M content, characterized in that: The primer pair is shown in SEQ ID NO.1-2; The SNP molecular marker is located at the 42437268th base on chromosome 15 of the yak reference genome LU_Bosgru_v3.0 version, and the mutant base is A or G.
6. Use of the primer pair according to claim 5 in preparing a product for detecting the content of yak immunoglobulin M.
7. Use of the primer pair according to claim 5 in preparing products for yak assisted breeding.
8. A kit for detecting the content of yak immunoglobulin M, characterized in that: It comprises a reagent for detecting the SNP molecular marker according to claim 1 or 2 or a primer pair according to claim 5.
9. A kit for yak assisted breeding, characterized in that: It comprises a reagent for detecting the SNP molecular marker according to claim 1 or 2 or a primer pair according to claim 5.