High specific activity xylanase mutants
By performing directed evolutionary screening of amino acid mutations in xylanase Xyn, its specific activity and heat resistance were improved, solving the problem of limited xylanase resources in industrial production and realizing the preparation and application of efficient xylanase mutants.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- QINGDAO VLAND BIOTECH GRP CO LTD
- Filing Date
- 2023-12-06
- Publication Date
- 2026-05-29
AI Technical Summary
Existing technologies cannot provide xylanases that meet the demanding conditions of industrial production. Resources are limited, and it is difficult to modify natural strains to meet the requirements for high specific activity and heat resistance.
By using directed evolution technology to screen xylanase Xyn, a variety of amino acid mutants were selected to improve its specific activity and thermostability. A recombinant expression vector was constructed and expressed in Trichoderma reesei to obtain xylanase mutants with high specific activity and thermostability.
It significantly improves the specific activity and heat resistance of xylanase, reduces production costs, and makes its application in the feed industry more widespread and economical.
Smart Images

Figure BDA0004589239330000061 
Figure BDA0004589239330000071 
Figure BDA0004589239330000081
Abstract
Description
Technical Field
[0001] This invention relates to the fields of genetic engineering and protein engineering, specifically to a high-specific-activity xylanase mutant and its applications. Background Technology
[0002] Xylan is a major component of hemicellulose and is widely distributed. Its main chain is primarily composed of xylose, while its side chains contain various substituents, resulting in a complex heteropolysaccharide structure. Hydrolytic enzymes that degrade xylan mainly include β-1,4-endoxylanase (EC 3.2.1.8) and β-xylosidase, which act on the main chain, and arabinosidase, glucuronidase, and galactosidase, which hydrolyze side chain groups, thereby improving xylan hydrolysis efficiency. Among these, β-1,4-endoxylanase is the most important glycoside hydrolase. It is an O-glycoside hydrolase that randomly cleaves the β-1,4 glycosidic bonds on the xylan main chain to generate xylooligosaccharides, arabinoxylan, and xylose.
[0003] Based on amino acid similarity and three-dimensional structure analysis of enzymes, xylanases are mainly distributed in the GH10 and GH11 families. Analysis of the amino acid composition and three-dimensional structure of xylanases reveals that glutamic acid, aspartic acid, tyrosine, tryptophan, glycine, and serine are crucial for their catalytic properties, alkali resistance, and heat resistance. Bacterial xylanase protein subunits are relatively simple, with molecular weights ranging from 8 to 145 kDa. Fungal xylanase protein subunits are more complex, with greater molecular weight variation. Regardless of whether it is from fungi or bacteria, the optimal temperature for endo-xylanases is generally between 40℃ and 60℃. Generally, bacterial xylanases have better thermal stability than fungal xylanases. The pH range that xylanases produced by different microorganisms can tolerate is generally 3 to 10, with the optimal pH generally between 4 and 7. The isoelectric point of different xylanases varies between 3 and 10. Xylanases produced by different microorganisms exhibit significant differences in structure and properties. Some xylanases contain only a single region, the catalytic region, while others possess both a catalytic region and multiple non-catalytic regions. Multi-region xylanase molecules contain a catalytic region (CD), a cellulose-binding region (CBD), a xylan-binding region (XBD), a linker sequence, a repeated sequence, a thermostable domain, and other non-catalytic regions with unknown functions. The catalytic region of a xylanase is responsible for its hydrolytic properties and serves as the basis for its classification. The amino acid composition of xylanases varies greatly in number, but their catalytic regions tend to be consistent in size. Glutamic acid and aspartic acid at specific positions within the catalytic region are crucial for catalytic properties. The functional regions in a xylanase molecule are linked by a linker sequence, the length of which varies greatly, generally ranging from 6 to 59 amino acids. This sequence may contain a large number of serine residues or a large number of proline residues. The linker sequences of xylanases from different sources generally show low homology. These linker sequences connect different functional regions, forming flexible, stretchable hinge regions. Many xylan molecules contain repetitive sequences, ranging from 20 to 150 amino acid residues in length. These repetitive sequences are not essential for enzyme activity, and their functions are not fully understood. Furthermore, certain regions in some microorganisms (such as thermophilic glycolytic bacteria and Clostridium thermophilum) can increase the optimal operating temperature of the corresponding enzymes; these are called thermostable regions. These regions perform different physiological functions. The regions contained in different microorganisms vary considerably. Some contain only one or a few of these regions, while others contain all of them.
[0004] Xylanase requires stringent conditions for industrial production, necessitating good thermal stability, a wide pH range adaptability, and high specific activity. However, the resources of xylanase that meet industrial production requirements can be obtained through screening naturally occurring xylanase-producing microorganisms are limited. Therefore, it is necessary to utilize genetic engineering and protein engineering techniques to controllably modify natural strains to achieve the commercial production of xylanase. Summary of the Invention
[0005] To address the problems of existing technologies, this invention provides a xylanase mutant. Based on xylanase Xyn, through extensive mutation screening, a xylanase mutant with significantly improved specific activity was finally obtained, laying the foundation for its widespread use in the feed industry.
[0006] The present invention provides a xylanase mutant comprising an amino acid sequence having at least 90% identity with SEQ ID NO:1, and comprising an amino acid substitution at at least one position selected from the group consisting of: 4, 6, 15, 43, 44, 46, 83, 94, 95, 99, 120, 121, 122, 123, 127, 128, 130, 131, 134, 172, 178, 179.
[0007] In some embodiments of the present invention, the mutant comprises a substitution of at least one amino acid from the following group: P4D / S, T6Q, S15T, N43S, F44V, G46V / C, L83M, T94D, Y95W / F, T99A / D, Q120T / F / V, R121K, V122T / F / H / D / I, N123H / S / E, I127V, I128E / Q / D / M / V, T130D, A131T / K, Y134W / D / H / Q / S / T / M / N / P / A, I172V / M / T, Y178W / F / V, F179G / Q / H / D.
[0008] In some embodiments of the invention, the amino acid sequence of the mutant has at least 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or at least 99% identity with SEQ ID NO:1.
[0009] In some more specific embodiments, the amino acid sequence of the mutant has at least 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, or at least 99.9% identity with SEQ ID NO:1.
[0010] The present invention also relates to DNA molecules encoding the above-mentioned xylanase mutants.
[0011] The present invention also relates to recombinant expression vectors comprising the above-described DNA molecules.
[0012] The present invention also provides a host cell comprising the above-described recombinant expression vector.
[0013] The host cell was *Trichoderma reesei*.
[0014] This invention provides single-point mutants based on wild-type xylanase Xyn, whose specific activities are generally increased by 12.4%-63.4%; among them, the xylanase mutant containing the I128E single-point mutation has the highest specific activity, reaching 1273.9 U / mg. Mutants containing single-point mutations of S15T, N43S, Y95F / W, T99A / D, R121K, V122I, I128V / Q / D, Y134W / D, Y178F / V, and F179G / Q / H / D not only have increased specific activity, but also significantly improved heat resistance. After treatment at 75℃ for 5 min, the enzyme activity retention rate generally increased by 18.0%-63.5%, and after treatment at 80℃ for 5 min, the enzyme activity retention rate generally increased by 11.2%-52.7%. Among them, the xylanase mutant containing the F179Q single-point mutation exhibits the strongest heat resistance, with enzyme activity retention rates as high as 65.2% and 52.7% after treatment at 75℃ and 80℃ for 5 minutes, respectively. The xylanase mutant provided by this invention significantly reduces production costs and has strong heat resistance, which is beneficial for its widespread application in the feed industry. Detailed Implementation
[0015] This invention discloses a xylanase mutant, its preparation method and application, the DNA molecule encoding the xylanase mutant, the vector, and the host cell. Those skilled in the art can refer to the content herein and appropriately modify the process parameters to achieve the desired result. The method and application of this invention have been described through preferred embodiments. Those skilled in the art can obviously modify or appropriately change and combine the methods and applications described herein without departing from the content, spirit, and scope of this invention to realize and apply the technology of this invention.
[0016] This invention utilizes conventional techniques and methods used in the fields of genetic engineering and molecular biology, such as those described in *MOLECMLAR CLONING: A LABORATORY MANUAL, 3rd Ed.* (Sambrook, 2001) and *CURRENT PROTOCOLS IN MOLECMLAR BIOLOGY* (Ausubel, 2003). These general references provide definitions and methods known to those skilled in the art. However, those skilled in the art can utilize other conventional methods, experimental protocols, and reagents based on the technical solutions described in this invention, without being limited to the specific embodiments of this invention.
[0017] Example 1: Screening of xylanase mutants
[0018] To improve the enzyme activity of wild-type xylanase Xyn (amino acid sequence SEQ ID NO:1, encoding nucleotide sequence SEQ ID NO:2) derived from Trichoderma reesei, the applicant screened for a large number of mutations in the amino acids near the enzyme's active site and substrate channel using directed evolution technology.
[0019] Design PCR primers Xyn-F1 and Xyn-R1:
[0020] Xyn-F1: 5'—CGC GAATTC ACTATTCAACCTGGAACTGGATAC—3' (underlined is the ECORI restriction endonuclease recognition site);
[0021] Xyn-R1: 5'—CT CGCGGCCGC TTATGAGACTGTGATAGAGGCAG—3' (The underlined part is the NotI restriction enzyme recognition site).
[0022] Using the Xyn gene (SEQ ID NO: 2) as a template, PCR amplification was performed using the above primers and the GeneMorph II random mutagenesis PCR kit (Bomais). The PCR product was recovered from the gel, digested with EcoRI and NotI, and then ligated into the pET21a vector digested with the same enzymes. The resulting product was transformed into Escherichia coli BL21(DE3), plated on LB+Amp plates, and incubated upside down at 37°C. After the transformants appeared, they were picked one by one into a 96-well plate with a toothpick. 150 μl of LB+Amp medium containing 0.1 mM IPTG was added to each well. The plate was incubated at 37°C and 220 rpm for about 6 h. After centrifugation, the supernatant was discarded, and the cells were resuspended in buffer. The cells were repeatedly frozen and thawed to break up the cell walls and obtain E. coli cell lysate containing xylanase.
[0023] Take 30 μL of lysis buffer and transfer it to two new 96-well plates. Add 30 μL of substrate to one of the 96-well plates and react at 37 °C for 30 min. Then, determine the reducing sugar produced by the DNS method. Add 150 μL of Coomassie Brilliant Blue solution to the other plate and let it stand for 10 min. Then, determine the protein content by the Coomassie Brilliant Blue (Bradford) binding method. Calculate the enzyme activity level and protein content of different mutants. Ultimately, the applicant screened from over 20,000 transformants for mutation sites that significantly improved Xyn specific activity without affecting their original enzymatic properties: P4D, P4S, T6Q, S15T, N43S, F44V, G46V, G46C, L83M, T94D, Y95W, Y95F, T99A, T99D, Q120T, Q120F, Q120V, R121K, V122T, V122F, V122H, V122D, V122I, N123H, N123S , N123E, I127V, I128E, I128Q, I128D, I128M, I128V, T130D, A131T, A131K, Y134W, Y134D, Y134H, Y134Q, Y134S , Y134T, Y134M, Y134N, Y134P, Y134A, I172V, I172M, I172T, Y178W, Y178F, Y178V, F179G, F179Q, F179H, F179D.
[0024] Based on wild-type xylanase Xyn, this invention provides xylanases containing P4D, P4S, T6Q, S15T, N43S, F44V, G46V, G46C, L83M, T94D, Y95W, Y95F, T99A, T99D, Q120T, Q120F, Q120V, R121K, V122T, V122F, V122H, V122D, V122I, N123H, N123S, N123E, I127V, and I128, respectively. Single-point mutants of the mutation sites described in E, I128Q, I128D, I128M, I128V, T130D, A131T, A131K, Y134W, Y134D, Y134H, Y134Q, Y134S, Y134T, Y134M, Y134N, Y134P, Y134A, I172V, I172M, I172T, Y178W, Y178F, Y178V, F179G, F179Q, F179H, and F179D.
[0025] Example 2: Expression of xylanase in Trichoderma reesei
[0026] First, based on the codon preference of Trichoderma, the gene sequences of xylanase Xyn and its mutants were optimized. The optimized gene sequences were synthesized by Shanghai Jierui Biotechnology Co., Ltd., and two restriction enzyme sites, KpnI and MluI, were added to the 5' and 3' ends of the synthesized sequences, respectively.
[0027] 2.1 Construction of expression vector
[0028] The synthesized plasmid was digested with restriction endonucleases KpnI (Fermentas) and MluI (Fermentas); simultaneously, plasmid pTGII was digested with restriction endonucleases KpnI and XbaI. The digestion products were purified using a gel purification kit, and the two digestion products were ligated using T4 DNA ligase (Fermentas). The ligation products were transformed into Trans5α Escherichia coli (Transgen), and selection was performed using ampicillin. To ensure accuracy, several clones were sequenced (Invitrogen). After successful sequencing, the recombinant plasmid containing the xylanase gene was obtained.
[0029] Plasmids were purified from correctly sequenced E. coli clones using a plasmid medium-quantity preparation kit (Axygen).
[0030] 2.2 Protoplast Preparation
[0031] Spore suspensions of *Trichoderma reesei* U4, a host fungus with a xylanase gene deficiency, were inoculated onto PDA plates and cultured at 30°C for 6 days. After abundant sporulation, colonies of approximately 1 cm × 1 cm were excised and placed in liquid medium containing 120 mL of YEG+U (0.5% yeast extract, 1% glucose, and 0.1% uridine) and cultured at 30°C with shaking at 220 rpm for 14–16 h. Mycelia were collected by filtration through sterile gauze and washed once with sterile water. The mycelia were then placed in Erlenmeyer flasks containing 20 mL of 10 mg / mL lyase solution (Sigma L1412) and incubated at 30°C with shaking at 90 rpm for 1–2 h. The progress of protoplast transformation was observed under a microscope.
[0032] Add 20 mL of pre-chilled 1.2 M sorbitol (1.2 M sorbitol, 50 mM Tris-Cl, 50 mM CaCl2) to the Erlenmeyer flask, shake gently, filter through sterile Miracloth filter cloth, collect the filtrate, centrifuge at 3000 rpm, 4 °C for 10 min; discard the supernatant, add 5 mL of pre-chilled 1.2 M sorbitol solution to suspend the bacterial cells, centrifuge at 3000 rpm, 4 °C for 10 min; discard the supernatant, add an appropriate amount of pre-chilled 1.2 M sorbitol to suspend and dispense (200 μL / tube, protoplast concentration of 10⁸ cells / mL).
[0033] 2.3 Expression vector transformation and strain validation
[0034] All the following operations were performed on ice. 10 μg of recombinant plasmid was added to a sterile 7 mL centrifuge tube containing 200 μL of protoplast solution. Then, 50 μL of 25% PEG (25% PEG, 50 mM Tris-Cl, 50 mM CaCl2) was added, the bottom of the tube was gently tapped to mix, and the tube was incubated on ice for 20 min. 2 mL of [unspecified solution] was then added. 25% PEG was mixed and allowed to stand at room temperature for 5 minutes. 4 mL of 1.2 M sorbitol was added, gently mixed, and then poured into the melted upper medium (0.1% MgSO4, 1% KH2PO4, 0.6% (NH4)2SO4, 1% glucose, 18.3% sorbitol, 0.35% agarose) maintained at 55°C. The mixture was gently mixed and then spread onto the prepared lower medium (2% glucose, 0.5% (NH4)2SO4, 1.5% KH2PO4, 0.06% MgSO4, 0.06% CaCl2, 1.5% agar). The mixture was incubated at 30°C for 5–7 days until transformants appeared. Transformants were picked and transferred to the lower medium for re-screening. After incubation at 30°C for 2 days, strains with smoother colony edges were considered positive transformants.
[0035] Take an appropriate amount of mycelium and place it in a 2 mL centrifuge tube. Add 100 mg of sterile quartz sand and 400 μL of extraction buffer (100 mM Tris-HCl, 100 mM EDTA, 250 mM NaCl, 1% SDS). Vigorously shake with a bead mixer for 2 min. After incubating in a 65 °C water bath for 20 min, add 200 μL of 10 M NH4AC and incubate on ice for 10 min. Centrifuge at 13000 rpm for 10 min. Take the supernatant, add 2 volumes of anhydrous ethanol, and place at -20 °C for 30 min. Centrifuge at 13000 rpm for 10 min and discard the supernatant. Wash twice with 70% ethanol. Air dry, dissolve in water, and store at -20 °C.
[0036] Using the extracted genomic DNA from the transformants as a template, the target gene was amplified by PCR using primers MF and MR for verification.
[0037] MF:ATGGTCAGCTTTACCTCCCTCCTC;
[0038] MR:TTATCAGGAGACACAAATTGAAGC.
[0039] PCR amplification conditions were: 94℃ for 4 min; 94℃ for 40 s; 58℃ for 40 s, 72℃ for 1 min, 30 cycles; 72℃ for 7 min, 16℃; PCR amplification products were recovered using a gel extraction kit and sequenced for analysis.
[0040] Following the above method, the applicant constructed recombinant Trichoderma reesei engineered strains expressing xylanase Xyn and its mutants.
[0041] Example 3 Fermentation Verification
[0042] The engineered Trichoderma reesei strains constructed above were inoculated onto PDA solid plates and cultured at 30℃ for 6 days. After spore abundance, two 1 cm diameter mycelial blocks were inoculated into 250 mL Erlenmeyer flasks containing 50 mL of fermentation medium (1.5% glucose, 1.7% lactose, 2.5% corn steep liquor, 0.44% (NH4)2SO4, 0.09% MgSO4, 2% KH2PO4, 0.04% CaCl2, 0.018% Tween-80, 0.018% trace elements). The flasks were cultured at 30℃ for 48 hours, followed by 25℃ for 48 hours. The fermentation broth was centrifuged to obtain fermentation supernatants containing xylanase Xyn and the aforementioned mutant, respectively.
[0043] 3.1 Enzyme activity assay
[0044] (1) Definition of xylanase activity
[0045] Under conditions of 37°C and pH 5.5, the amount of enzyme required to release 1 μmol of reducing sugar per minute from a xylan solution with a concentration of 5 mg / ml is defined as one unit of enzyme activity, U.
[0046] (2) Method for determining xylanase activity
[0047] Take 2 ml of 1% xylan substrate (prepared with pH 5.5 acetate-sodium acetate buffer) and add it to a colorimetric tube. Equilibrate at 37°C for 10 min. Then add 2 ml of acidic xylanase enzyme solution, appropriately diluted with pH 5.5 acetate-sodium acetate buffer and equilibrated at 37°C. Mix well and incubate at 37°C for 30 min. After the reaction is complete, add 5 ml of DNS reagent and mix well to terminate the reaction. Then boil in a boiling water bath for 5 min, cool to room temperature with tap water, and dilute to 25 ml with distilled water. Mix well and use a standard blank sample as a blank control. Measure the absorbance A at 540 nm. E .
[0048] Enzyme activity calculation formula:
[0049]
[0050] In the formula: X D To dilute the xylanase activity in the enzyme solution, U / mL; A E A represents the absorbance of the enzyme reaction solution. Bλ is the absorbance of the enzyme blank solution; K is the slope of the standard curve; C0 is the intercept of the standard curve; M is the molar mass of xylose, 180.2 g / mol; t is the enzymatic reaction time, min; N is the enzyme dilution factor; 1000 is the conversion factor, 1 mmol = 1000 μmol.
[0051] (3) Enzyme activity assay results
[0052] Enzyme activity was detected using the above method, and the results showed that the enzyme activity of the fermentation supernatant of the recombinant Trichoderma recombinant strain expressing xylanase Xyn and its mutant was 530-1039 U / mL.
[0053] 3.2 Protein content determination
[0054] (1) Measurement method:
[0055] The Coomassie Brilliant Blue (Bradford) binding method for protein determination is a combined colorimetric and dye-based method. Coomassie Brilliant Blue G-250 is brownish-red in acidic solution, turning blue upon binding with protein. Within a certain protein concentration range, it obeys Beer's Law and can be measured colorimetrically at 595 nm. It exhibits significant absorption within 3–5 minutes and remains stable for at least 1 hour. In the range of 10–1000 μg / mL, the absorbance is directly proportional to the protein concentration.
[0056] The enzyme solution and Coomassie Brilliant Blue solution were mixed at a volume ratio of 1:5, allowed to stand for 10 minutes, and then the protein content was determined using the Coomassie Brilliant Blue (Bradford) binding method.
[0057] (2) Protein content determination results
[0058] The xylanase protein content in the fermentation supernatant of the above-described wild-type and mutant *Trichoderma reesei* strains was detected using the method described above. The results showed that the protein content in the fermentation supernatant of the recombinant *Trichoderma reesei* strains expressing xylanase Xyn and its mutants ranged from 0.625 to 0.835 mg / mL.
[0059] 3.3 Calculation of specific vitality
[0060] Specific activity refers to the number of enzyme activity units per unit weight of protein, usually expressed as U / mg protein. Generally speaking, the higher the specific activity of an enzyme, the purer the enzyme.
[0061] Specific activity calculation formula: Specific activity (U / mg) = Enzyme activity (U / mL) / Protein content (mg / mL).
[0062] The specific activity of xylanase in the fermentation supernatant of the recombinant Trichoderma reesei engineered strains expressing wild-type xylanase Xyn and its mutant was calculated.
[0063] The specific calculation results are shown in Table 1.
[0064] Table 1 Comparison of specific activities of xylanase Xyn and its single-point mutants
[0065]
[0066]
[0067] As shown in Table 1, compared with wild-type xylanase Xyn, the specific activity of the xylanase single-point mutants provided by this invention is generally increased by 12.4%-63.4%; among them, the xylanase mutant containing the I128E single-point mutation has the highest specific activity, reaching 1273.9 U / mg, achieving unexpected technical results.
[0068] Example 4: Heat resistance analysis of xylanase
[0069] The crude enzyme solution of the mutant obtained from fermentation in Example 3 was diluted to approximately 20 U / ml with an acetate-sodium acetate buffer solution at pH 5.5. After treatment at 75℃ and 80℃ for 5 min respectively, the remaining enzyme activity was measured. The enzyme activity retention rate was calculated as 100% of the enzyme activity of the untreated sample. The specific results are shown in Table 2.
[0070] Table 2 Comparison of heat resistance of xylanase Xyn and its single-point mutants
[0071]
[0072] As shown in Table 2, the mutants containing single-point mutations of S15T, N43S, Y95F / W, T99A / D, R121K, V122I, I128V / Q / D, Y134W / D, Y178F / V, and F179G / Q / H / D screened by this invention not only exhibited increased specific activity but also significantly improved thermostability. After treatment at 75℃ for 5 min, the enzyme activity retention rate generally increased by 18.0%-63.5%, and after treatment at 80℃ for 5 min, the enzyme activity retention rate generally increased by 11.2%-52.7%. Among them, the xylanase mutant containing the F179Q single-point mutation showed the strongest thermostability, with enzyme activity retention rates as high as 65.2% and 52.7% after treatment at 75℃ and 80℃ for 5 min, respectively. Unexpected technical effects were achieved.
[0073] In summary, the xylanase mutant provided by this invention has higher specific activity, stronger heat resistance, and a greater cost advantage than the wild type, making it more suitable for use as a feed additive.
Claims
1. A xylanase mutant, characterized in that, The mutant was obtained by mutating the 179th amino acid from Phe to Gln, based on the xylanase shown in the amino acid sequence SEQ ID NO:
1.
2. A DNA molecule encoding the xylanase mutant of claim 1.
3. A recombinant expression plasmid comprising the DNA molecule of claim 2.
4. A host cell, characterized in that, The host cell comprises the recombinant expression plasmid as described in claim 3; the host cell is *Trichoderma reesei* (…). Trichoderma reesei ).
5. The application of the xylanase mutant of claim 1 in feed production.
Citation Information
Patent Citations
Perhydrolase enzyme
CN103333870A
Animal feed compositions and uses thereof
CN111492053A