Anopheles cracens ir1 gene and uses thereof
By cloning the Ir1 gene of Haemaphysalis longicornis and synthesizing dsRNA to inhibit its chemosensory response, a tick control biological product was developed, solving the problem of lack of control targets in existing technologies and achieving effective repellency against Haemaphysalis longicornis.
Patent Information
- Application Number
- CN202510297658.1
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-03-13
- Publication Date
- 2026-05-19
- Estimated Expiration
- 2045-03-13
AI Technical Summary
The lack of effective targets and repellents for controlling tick-borne diseases in existing technologies makes it imperative to solve the problem of controlling tick-borne diseases.
By cloning the Ir1 gene of Haemaphysalis longicornis, designing and synthesizing its specific dsRNA, and injecting it into the nymphs, the tick control biological products were developed to inhibit their chemosensory response to cinnamaldehyde.
It significantly reduced the repellency response of Haemaphysalis longicornis to cinnamaldehyde, providing a new target for prevention and control, and has broad application prospects.
Smart Images

Figure CN120099016B_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of bioengineering technology, and in particular to an Ir1 gene from Haemaphysalis longicornis and its applications. Background Technology
[0002] Ticks are arthropods that can transmit a variety of pathogens. Their life cycle requires biting a host and feeding on blood to sustain their growth and development. During their bites, they can transmit various pathogens, including viruses, bacteria, protozoa, anaplasma, and spirochetes, directly endangering the health of humans and animals. The longhorn tick (Haemaphysalis longicornis) is characterized by its strong survival and adaptability, and has become a dominant species in many regions. It is also one of the most widely distributed tick species in my country.
[0003] Currently, tick control relies solely on agricultural insect repellents, making the search for new control targets and the development of tick-specific repellents a top priority. Summary of the Invention
[0004] The technical problem to be solved by the present invention is to provide a Haemaphysalis longicornis Ir1 gene (HLIr1), which can be used to develop and manufacture biological products for tick control.
[0005] To solve the above-mentioned technical problems, the present invention is achieved through the following technical solution:
[0006] In one aspect of the present invention, a Haemaphysalis longicornis Ir1 gene is provided, the gene sequence of which comprises: a nucleotide sequence encoding the amino acid sequence shown in SEQ ID NO.1.
[0007] Preferably, the nucleotide sequence of the Haemaphysalis longicornis Ir1 gene is shown in SEQ ID NO.2.
[0008] In another aspect of the invention, a longhorn tick Ir1 protein is provided, having the amino acid sequence shown in SEQ ID NO.1.
[0009] In another aspect of the present invention, a substance for inhibiting the expression of the Ir1 gene in Haemaphysalis longicornis is also provided.
[0010] The substance includes dsRNA that inhibits the expression of the Ir1 gene in Haemaphysalis longicornis.
[0011] Preferably, the dsRNA is a double-stranded RNA composed of the nucleotide sequence shown in SEQ ID NO.17 and its reverse complementary sequence.
[0012] In another aspect of the present invention, the application of the above-mentioned Haemaphysalis longicornis Ir1 gene in the preparation of biological products for the prevention and control of ticks is also provided.
[0013] In another aspect of the present invention, the application of a substance that inhibits the expression of the Ir1 gene of Haemaphysalis longicornis in the preparation of biological products for the prevention and control of ticks is also provided.
[0014] In another aspect of the present invention, a biological product for the prevention and control of ticks is also provided, comprising a substance that inhibits the expression of the Ir1 gene of Haemaphysalis longicornis.
[0015] The Ir1 gene of the present invention, as demonstrated by RNA interference experiments, shows that injecting the dsRNA sequence of the Ir1 gene into the nymphs of parthenogenetic Haemaphysalis longicornis can inhibit their chemosensory response to cinnamaldehyde. This indicates that the Ir1 gene can serve as a control target for Haemaphysalis longicornis, and its dsRNA can be used as related agents and products for tick control, showing broad application prospects. Attached Figure Description
[0016] The present invention will now be described in further detail with reference to the accompanying drawings and specific embodiments.
[0017] Figure 1 This is a diagram showing the PCR amplification results of the Ir1 gene from Haemaphysalis longicornis in Example 1 of this invention;
[0018] Figure 2 This is an electrophoresis result of the synthesized Haematopois longhorn Ir1 gene dsRNA in Example 2 of the present invention;
[0019] Figure 3 This is a schematic diagram of the repulsion measurement in Embodiment 3 of the present invention;
[0020] Figure 4 This is a graph showing the repellency measurement results of Embodiment 3 of the present invention;
[0021] Figure 5 This is a graph showing the RT-qPCR detection results of Ir1 in Example 4 of the present invention. Detailed Implementation
[0022] In order to find new targets for tick control and develop tick-specific repellents, this invention focuses on the ability of cinnamaldehyde to induce a tick repellent response. The glutamate ionotropic receptor Ir1 of Haemaphysalis longicornis was cloned, and the dsRNA sequence of the Ir1 gene was designed and synthesized (SEQ ID NO.17). When injected into the nymphs of Haemaphysalis longicornis, it can inhibit the chemosensory response of Haemaphysalis longicornis to cinnamaldehyde, indicating that the dsRNA of the Ir1 gene of Haemaphysalis longicornis can play a good role in tick control.
[0023] Example 1: Molecular cloning and sequence analysis of the Ir1 gene (HLIr1) from Haemaphysalis longhorn.
[0024] 1. Materials and Methods
[0025] 1.1 Experimental Samples
[0026] The parthenogenetic Haemaphysalis longhorn tick samples and Lusiferase plasmid were provided by the Shanghai Veterinary Research Institute.
[0027] 1.2 Reagents
[0028] TRIzol, chloroform, isopropanol, 75% ethanol, cinnamaldehyde, and 95% ethanol were purchased from Sinopharm Chemical Reagent Co., Ltd.; reverse transcription kit, Escherichia coli strain DH5α, and qPCR detection kit were purchased from Vazyme; DNA amplification high-fidelity enzyme, PCR product recovery kit, plasmid extraction kit, and A-Tailing ligation kit were purchased from Takara; ampicillin and pMD-18T vector were purchased from Takara Bio Engineering (Dalian) Co., Ltd.
[0029] 1.3 Cloning Primer Design
[0030] Design the following cloning primers:
[0031] Ir1-F:5'-ATGAAGGATGTTCTTAATACATCCTTCG-3' (SEQ ID NO.3);
[0032] Ir1-R:5'-TTACCTTGGGTTGAGATCTGAC-3' (SEQ ID NO.4);
[0033] The primers used were synthesized by Saiheng Biotechnology Co., Ltd.
[0034] 1.4 RNA Extraction
[0035] RNA was extracted using the TRIzol method. Several parthenogenetic Haemaphysalis ticks were added to 500 μL of TRIzol and thoroughly ground. Then, 200 μL of chloroform was added, the mixture was vortexed, allowed to stand for 2 min, and centrifuged at 12000 rpm for 10 min at 4°C. The supernatant was collected and added to 500 μL of isopropanol, centrifuged at 12000 rpm for 10 min at 4°C. The supernatant was discarded, and 1 mL of 75% ethanol was added, centrifuged at 12000 rpm for 10 min at 4°C. After drying, the RNA was dissolved in double-distilled water. A reverse transcription kit was used to reverse transcribe the RNA into cDNA.
[0036] Cloning of 1.5Ir1
[0037] Using the cDNA reverse transcribed in section 1.4 as a template, PCR amplification was performed using primers (Ir1-F, Ir1-R) and a high-fidelity DNA amplification enzyme. The amplification conditions were: 98℃ for 1 min; 98℃ for 10 s, 57℃ for 30 s, 72℃ for 30 s, for 30 cycles; 72℃ for 5 min; and storage at 4℃. After 1% agarose gel electrophoresis, the specific fragment was recovered, and A-Tailing was added. After ligation with pMD-18T, the product was transformed into DH5α competent cells. Recombinant plasmids that were positive for bacterial culture PCR were sent to Saiheng Biotechnology Co., Ltd. for sequencing.
[0038] 2. Results
[0039] PCR amplification of Ir1 revealed a full-length sequence of 1344 bp (SEQ ID NO.2), encoding 447 amino acids (SEQ ID NO.1), consistent with expectations. Figure 1 Sequencing and NCBI BLAST analysis revealed that the sequence belongs to a glutamate ionotropic receptor.
[0040] Example 2: RNA interference of Haemaphysalis longicornis Ir1
[0041] 1. Materials and Methods
[0042] 1.1 Experimental Samples
[0043] The parthenogenetic Haemaphysalis longhorn tick samples and Lusiferase plasmid were provided by the Shanghai Veterinary Research Institute.
[0044] 1.2 Reagents
[0045] TRIzol, chloroform, isopropanol, 75% ethanol, cinnamaldehyde, and 95% ethanol were purchased from Sinopharm Chemical Reagent Co., Ltd.; the reverse transcription kit, Escherichia coli strain DH5α, and qPCR detection kit were purchased from Vazyme; the DNA amplification high-fidelity enzyme, PCR product recovery kit, plasmid extraction kit, and A-Tailing ligation kit were purchased from Takara; and the dsRNA synthesis kit was purchased from Promega.
[0046] 1.3dsRNA primer design
[0047] RNAi-Lusiferase-F1:GGATCCTAATACGACTCACTATAGGGCTTCCATCTTCCAGGGATACG (SEQ ID NO.5);
[0048] RNAi-Lusiferase-R1:CGTCCACAAACACAACTCCTCC (SEQ ID NO.6);
[0049] RNAi-Lusiferase-F2:GCTTCCATCTTCCAGGGATACG (SEQ ID NO.7);
[0050] RNAi-Lusiferase-R2:GGATCCTAATACGACTCACTATAGGCGTCCACAAACACAACTCCTCC (SEQ ID NO.8);
[0051] RNAi-Ir1-F1:TAATACGACTCACTATAGGATGTTCTTAATACATCCTTCGCT (SEQ ID NO.9);
[0052] RNAi-Ir1-R1: TTCGAAGTTTTTCGACGTGCT (SEQ ID NO. 10);
[0053] RNAi-Ir1-F2:ATGTTCTTAATACATCCTTCGCT (SEQ ID NO. 11);
[0054] RNAi-Ir1-R2:TAATACGACTCACTATAGGTTCGAAGTTTTCGACGTGCT (SEQ ID NO. 12);
[0055] The primers used were synthesized by Saiheng Biotechnology Co., Ltd.
[0056] 1.4Ir1 RNA interference
[0057] The positive bacterial culture from 1.5 of Example 1 was revived, and the HL-Ir plasmid was extracted using a plasmid extraction kit. Using the extracted plasmid as a template, cDNA was amplified by PCR using primers (RNAi-Ir1-F1, RNAi-Ir1-R1, RNAi-Ir1-F2, RNAi-Ir1-R2) and a high-fidelity DNA amplification enzyme. Separately, the Lusiferase plasmid was used as a template, and PCR amplification was performed using primers (RNAi-Lusiferase-F1, RNAi-Lusiferase-R1, RNAi-Lusiferase-F2, RNAi-Lusiferase-R2) and a high-fidelity DNA amplification enzyme, under the same amplification conditions as in 1.5 of Example 1. After product recovery, the amplified fragments were synthesized using a dsRNA synthesis kit and microinjected using a Nanoject II instrument. Forty parthenogenetic Haemaphysalis longicornis nymphs were injected into each group, and the microinjections were placed in humidified chambers and stored at room temperature. Each group was repeated three times.
[0058] 2. Results
[0059] The synthesized dsRNA lengths were: Lusiferase: approximately 600 bp ( Figure 2 Channel 1 in the sequence), dsIr1 (SEQ ID NO. 17): approximately 464 bp ( Figure 2 (2 channels in the middle).
[0060] Example 3: Repellency assay of Haemaphysalis longicornis Ir1
[0061] 1. Method
[0062] like Figure 3 As shown, a "Y"-shaped tube device was used to conduct behavioral selection tests on parthenogenetic Haemaphysalis longicornis nymphs after RNA interference. Filter paper containing 10 μL of 95% ethanol and 2% cinnamaldehyde (diluted with 95% ethanol) was placed at the upper end of the "Y"-shaped tube, and nymphs injected 24 h prior were placed at the lower end. Ticks were counted at both ends of the "Y"-shaped tube at 15 min, 30 min, and 60 min.
[0063] Repellency rate = (Number of 95% ethanol-terminated ticks - Number of 2% cinnamaldehyde-terminated ticks) / Number of 95% ethanol-terminated ticks
[0064] Analyze the results using Excel and Graphpad.
[0065] 2. Results
[0066] Detection and calculation showed that cinnamaldehyde achieved a 100% repellency rate against microinjected Lusiferase at 15 min, 30 min, and 60 min, while the repellency rate against microinjected dsIr1 decreased to 55%, 60%, and 65%, respectively, indicating a significant decrease in repellency effect (P<0.01). Figure 4 ).
[0067] Example 4: RT-qPCR detection of Ir1 from Haemaphysalis longicornis
[0068] 1. Method
[0069] 1.1 RT-qPCR primer design for Haemaphysalis longicornis Ir1 and internal control molecule ELFIA
[0070] qPCR-Ir1-F:TGAGGACTGACTTCGCCTTG (SEQ ID NO. 13);
[0071] qPCR-Ir1-R: CACAATAGTGGACACGCGGA (SEQ ID NO. 14);
[0072] qPCR-ELFIA-F:CGTCTACAAGATTGGTGGCATT (SEQ ID NO. 15);
[0073] qPCR-ELFIA-R: CTCAGTGGTCAGGTTGGCAG (SEQ ID NO. 16);
[0074] The primers used were synthesized by Saiheng Biotechnology Co., Ltd.
[0075] 1.2 RT-qPCR detection of Ir1
[0076] Parthenogenetic Haematopois longicornis ticks injected with dsRNA and subjected to repellency assays were collected. RNA was extracted and reverse transcribed into cDNA. Using the cDNA as a template, RT-qPCR was performed using primers (qPCR-Ir1-F, qPCR-Ir1-R) and a qPCR detection kit. The RT-qPCR detection conditions were 95℃ for 30 s; 95℃ for 5 s, 60℃ for 30 s, for 40 cycles. Results were analyzed using Excel and Graphpad. -△△Ct The method involves analyzing the data.
[0077] 2. Results
[0078] Following microinjection of Lusiferase and dsIr1, the transcriptional levels of the Ir1 gene in the two groups were measured. The results showed that the transcriptional level of dsIr1 microinjection was significantly lower than that of Lusiferase microinjection (P<0.05). Figure 5 ).
[0079] The embodiments described above are merely illustrative of implementation methods of the present invention, and while the descriptions are specific and detailed, they should not be construed as limiting the scope of the present invention. It should be noted that those skilled in the art can make various modifications and improvements without departing from the concept of the present invention, and these modifications and improvements all fall within the scope of protection of the present invention. Therefore, the scope of protection of this patent should be determined by the appended claims.
Claims
1. A substance that inhibits the expression of the Ir1 gene in Haemaphysalis longicornis, wherein the substance is a dsRNA that inhibits the expression of the Ir1 gene in Haemaphysalis longicornis, and the dsRNA is a double-stranded RNA composed of the nucleotide sequence shown in SEQ ID NO.17 and its reverse complementary sequence.