Aureobasidium pullulans ZX01 strain and application thereof in prevention and treatment of pear fire blight

Abstract

The invention discloses an aureobasidium pullulans ZX01 strain and application of the aureobasidium pullulans ZX01 strain in prevention and treatment of pear fire blight, and provides the aureobasidium pullulans ZX01 strain which is separated from leaves of siamea siamea, has the preservation number of CCTCC NO: M 20242297, can remarkably inhibit Erwinia amyloliquefaciens, and provides a new candidate strain for biological prevention and treatment of pear fire blight. The aureobasidium sp. Has a relatively strong inhibition effect on pear fire disease pathogenic bacteria, has an excellent biocontrol effect on preventing and treating pear fire disease, is environment-friendly in biological source, small in influence on the ecological environment, simple in culture condition and suitable for industrial fermentation production, and has a very good development and application prospect.

Description

Technical Field

[0001] The present invention belongs to the field of biotechnology, and particularly relates to a Aureobasidium pullulans ZX01 strain and its application in the prevention and control of fire blight of pears. Background Art

[0002] Fire blight of pears is caused by Erwinia amylovora, and is a devastating disease in the production of apples and pears. Since it was discovered in the 1870s, fire blight of pears has continuously caused huge economic losses to the apple and pear industries. There is an urgent need for efficient and safe prevention and control measures for fire blight of pears. The prevention and control of fire blight of pears requires the implementation of preventive protection measures. At the same time, when preventing and controlling diseases, it is necessary to solidly promote technical models such as green prevention and control and reduction of pesticide use and improvement of efficiency, and accelerate the replacement of chemical control with biological control.

[0003] The types of pesticides for the prevention and control of fire blight of pears include antibiotics, organic coppers, inorganic coppers, etc. The prevention and control mainly rely on streptomycin, but the European Commission has clearly prohibited its application in fruit and vegetable diseases. At present, the prevention and control of fire blight of pears in China still rely on antibiotics (such as streptomycin) and chemical agents, but long-term use is likely to cause problems of drug resistance and environmental pollution. The research and practice of biological control of plant diseases have shown that using antagonistic microorganisms to control plant diseases has outstanding advantages such as strong selectivity, not easy to produce drug resistance, safe and efficient, and environmentally friendly, and is an inevitable trend in the green development of modern agriculture and pesticide research and development. There are already products applied to the prevention and control of fire blight of pears internationally, such as Pseudomonas fluorescens A506, Bacillus subtilis QST713, and BD170, etc. However, the domestic related biological control technology is still in a blank stage. Therefore, developing safe, efficient and environmentally friendly biocontrol strains is of great significance for realizing the green prevention and control of fire blight of pears.

[0004] Aureobasidium pullulans has significant advantages in preventing and controlling fire blight pathogens. Blossom Protect developed in Germany TM has a control rate of up to 81% for fire blight of pears in field trials. Aureobasidium pullulans and the pathogen have nutritional and spatial competition, can quickly absorb nutrients, occupy the surface and wound space of plants, and prevent the pathogen from contacting and invading. At the same time, it can secrete antibacterial substances such as 3-methyl-1-butanol, which has an antagonistic effect on the pathogen. It can also induce the gene expression in the systemic acquired resistance pathway of plants, improve the plant's own defense and overall disease resistance. And Aureobasidium pullulans has extremely strong ecological adaptability, has a wide tolerance range for environmental factors such as temperature, humidity, pH, etc., and can synergistically inhibit the pathogen with other beneficial microorganisms. In addition, Aureobasidium pullulans is derived from plants and is one of the agriculturally available fungi, with high safety. Summary of the Invention

[0005] In view of this, one of the objectives of the present invention is to provide a strain of Aureobasidium melanogenum ZX01; the second objective of the present invention is to provide a biological control agent; the third objective of the present invention is to provide a fermentation product; the fourth objective of the present invention is to provide the application of the Aureobasidium melanogenum ZX01 strain or the fermentation product in preventing and treating pear fire blight caused by Erwinia amylovora; the fifth objective of the present invention is to provide a method for preventing and treating pear fire blight caused by Erwinia amylovora.

[0006] To achieve the above objectives, the present invention provides the following technical solutions:

[0007] 1. A strain of Aureobasidium melanogenum ZX01, the taxonomic name of Aureobasidium melanogenum ZX01 is Aureobasidium melanogenum ZX01, and the preservation number of the strain is CCTCC NO: M 20242297.

[0008] 2. A biological control agent, comprising the Aureobasidium melanogenum ZX01 strain.

[0009] 3. A fermentation product, fermented from the Aureobasidium melanogenum ZX01 strain.

[0010] 4. The application of the Aureobasidium melanogenum ZX01 strain or the fermentation product in preventing and treating pear fire blight caused by Erwinia amylovora.

[0011] 5. A method for preventing and treating pear fire blight caused by Erwinia amylovora, spraying a bacterial suspension or fermentation broth containing the Aureobasidium melanogenum ZX01 strain on the surface of pear fruits.

[0012] The beneficial effects of the present invention are as follows:

[0013] 1. The present invention provides a strain of Aureobasidium melanogenum ZX01 isolated from the leaves of Cassia siamea, which can significantly inhibit Erwinia amylovora and provides a new candidate strain for the biological control of pear fire blight.

[0014] 2. The Aureobasidium obtained in the present invention is a plant fungus and can be well colonized in plant tissues.

[0015] 3. The Aureobasidium of the present invention has a strong inhibitory effect on the pathogen of pear fire blight, has an excellent biocontrol effect on preventing and treating pear fire blight, and is environmentally friendly from a biological source and has little impact on the ecological environment.

[0016] 4. The Aureobasidium pullulans obtained by the present invention has simple culture conditions, is suitable for industrial fermentation production, and has good development and application prospects. BRIEF DESCRIPTION OF THE DRAWINGS

[0017] In order to make the objectives, technical solutions, and beneficial effects of the present invention clearer, the following drawings are provided for the description of the present invention:

[0018] Figure 1 It is the colony morphology diagram of Aureobasidium pullulans ZX01 strain on YPD agar medium;

[0019] Figure 2 It is the methylene blue staining morphology diagram of Aureobasidium pullulans ZX01 strain;

[0020] Figure 3 It is the phylogenetic tree based on the ITS sequence of Aureobasidium pullulans ZX01 strain;

[0021] Figure 4 It is the antagonistic screening result diagram of Aureobasidium pullulans against Erwinia amylovora (numbered from left to right as control, BLD.1 - 100);

[0022] Figure 5 It is the antagonistic result diagram of Aureobasidium pullulans ZX01 strain against Erwinia amylovora after cultivation with different glucose concentrations and different initial cell concentrations;

[0023] Figure 6 It is the inhibition zone diagram of Aureobasidium pullulans ZX01 strain against Erwinia amylovora.

[0024] Strain Preservation

[0025] In the present invention, the taxonomic name of Aureobasidium pullulans ZX01 strain is Aureobasidium melanogenum ZX01, which is isolated from the leaves of Cassia siamea, and is deposited in the China Center for Type Culture Collection. The deposit number is CCTCC NO: M20242297, the deposit address is Wuhan University, Wuhan, Hubei Province, China, and the deposit date is October 22, 2024. DETAILED DESCRIPTION OF THE EMBODIMENTS

[0026] The present invention will be further described below in conjunction with the drawings and specific embodiments, so that those skilled in the art can better understand the present invention and implement it, but the embodiments cited do not limit the present invention.

[0027] Example 1

[0028] The Aureobasidium pullulans ZX01 (Aureobasidium melanogenum ZX01) of the present invention, deposit number: CCTCC NO: M 20242297.

[0029] 1) Preparation of culture medium

[0030] Preparation of YPD liquid culture medium: weigh 20 g / L glucose, 10 g / L yeast extract, and 20 g / L peptone, add 1 L of water to fully dissolve, dispense into conical flasks, sterilize at 121°C for 20 min, and set aside after cooling.

[0031] Preparation of PDA agar culture medium: Weigh 12 g / L potato extract powder, 20 g / L glucose, and 20 g / L agar powder, add 1 L of water to fully dissolve, then dispense into conical bottles, sterilize at 121°C for 20 min, then dispense into culture dishes, cool, and store for later use.

[0032] 2) Isolation and purification of Mycoplasma shortbacilli

[0033] The sample for separation is plant leaves. Use scissors disinfected with 75% alcohol and cut the inner or central part of the leaf into pieces of 0.5 cm in a clean bench. 2 For large and small tissue blocks, transfer the cut tissue blocks into a conical flask filled with sterile saline and shake for 20 minutes, then transfer the liquid into a conical flask filled with YPD liquid culture medium, add chloramphenicol after filtration and sterilization to a final concentration of 0.01%, and culture at 220rpm and 25℃ until the liquid becomes turbid. After diluting the turbid liquid in proportion, take 100μL and evenly spread it on the prepared PDA agar culture medium, place it in an oven at 25℃ and culture it upside down for 2-4 days, and observe the growth of the colonies regularly. Pick the grown colonies at any time and purify them by streaking until a single colony is isolated.

[0034] 3) Morphological observation of short-stemmed mold

[0035] The isolated and purified strain was streaked on YPD agar medium and incubated upside down in a 30°C incubator for 7 days. The colony morphology of the strain was observed. The results are shown in the attached figure. Figure 1 As shown, the strain grew well on the YPD agar medium, was light pink, convex upward, moist, spread to the edge, produced hyphae, and was easy to pick; the methylene blue stained cells were spindle-shaped ( Figure 2 ).

[0036] 4) Molecular biological identification of Aureobasidium pullulans ZX01

[0037] The isolated and purified strain was subjected to ITS sequence analysis and identified as Aureobasidium melanogenum, named Aureobasidium pullulans ZX01. The Aureobasidium pullulans ZX01 was isolated from the leaves of Cassia siamea, and its sequence is as follows: It has 99.48% homology with Aureobasidium melanogenum with the accession number of CBS105.22 in GenBank. Based on the ITS sequences of 12 strains with close species levels and 1 outgroup strain, the maximum likelihood method (ML) was selected by MEGA11 software to construct a phylogenetic tree ( Figure 3 ). It was confirmed that its taxonomic name was Aureobasidium melanogenum, named Aureobasidium melanogenum ZX01. The sequence fragment is as follows:

[0038] GAAGTAAAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTAAAGAGTAAGGGTGCTCAGCGCCCGACCTCCAACCCTTTGTTGTTAAAACTACCTTGTTGCTTTGGCGGGACCGCTCGGTCTCGAGCCGCTGGGGATTCGTCCCAGGCGAGCGCCCGCCAGAGTTAAACCAAACTCTTGTTATTTAACCGGTCGTCTGAGTTAAAATTTTGAATAAATCAAAACTTTCAACAACGGATCTCTTGGTTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATTACACCACTCAAGCTATGCTTGGTATTGGGTGCCGTCCTTAGTTGGGCGCGCCTTAAAGACCTCGGCGAGGCCTCACCGGCTTTAGGCGTAGTAGAATTTATTCGAACGTCTGTCAAAGGAGAGGACTTCTGCCGACTGAAACCTTTTATTTTTCTAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGA(SEQ ID NO.1, 605bp).

[0039] 5) Preservation of Aureobasidium pullulans ZX01

[0040] This strain was deposited at the China Center for Type Culture Collection on October 22, 2024, with the deposit number CCTCC NO: M 20242297.

[0041] Example 2

[0042] Screening of highly efficient antagonistic strains against Erwinia amylovora, the pathogen of fire blight of pear

[0043] 1) Preparation of PDA liquid medium

[0044] Weigh 12 g / L of potato leaching powder and 20 g / L of glucose, add 1 L of water, dissolve thoroughly, dispense into conical flasks, sterilize at 121 °C for 20 min, and reserve after cooling.

[0045] 2) Cultivation method of Aureobasidium pullulans

[0046] Inoculate 100 strains of Aureobasidium pullulans isolated and purified from plant samples into PDA liquid medium, and culture at 220 rpm and 28 °C for 5 d. The activated Aureobasidium pullulans is fermented for 5 d, and the fermentation broth is centrifuged at 8000 r / min for 10 min to obtain the supernatant.

[0047] 3) Cultivation method of Erwinia amylovora

[0048] Inoculate Erwinia amylovora into LB liquid medium, culture at 30 °C for 24 h, dilute to 10 2 CFU / mL), take 100 μL of the diluted culture solution of Erwinia amylovora and incubate with 100 μL of the supernatant of Aureobasidium pullulans fermentation at 30 °C for 24 h, using sterile water as the control. The antagonistic activity of Aureobasidium pullulans strains against Erwinia amylovora is quantitatively determined by the microplate method. After incubation, add the culture solution into a 96-well microplate and measure the absorbance at 595 nm.

[0049] Inhibition rate of Erwinia amylovora (%) = [(OD of the sterile water control group 595nm − OD of the co-culture experimental group 595nm ) / OD of the sterile water control group 595 nm × 100%

[0050] The results showed that after co-culturing the supernatant of different Aureobasidium pullulans cultures with Erwinia amylovora, their OD 595nm were all significantly lower than that of the control group. Among them, the inhibition rate of Aureobasidium pullulans ZX01 ( Figure 4 number BLD-54 in it) against Erwinia amylovora reached 81.6%, and the antagonistic effect was the best.

[0051] In summary, through a large number of screening efforts, the inventors of the present application obtained a strain of Aureobasidium pullulans ZX01 that can effectively antagonize Erwinia amylovora, with an inhibition rate as high as 81.6%. Moreover, the strain of the present invention is derived from the plant Cassia siamea, has high safety, and can coexist with plants.

[0052] Example 3

[0053] Inhibitory effect of Aureobasidium pullulans ZX01 on Erwinia amylovora.

[0054] 1) Preparation of PDA liquid medium

[0055] Weigh 12 g / L of potato leaching powder and different contents of glucose (10, 20, 30, 40, 50, 60 g / L), add 1 L of water, fully dissolve, dispense into conical flasks, sterilize at 121 °C for 20 min, and set aside after cooling.

[0056] 2) Cultivation method of Aureobasidium pullulans

[0057] Inoculate Aureobasidium pullulans ZX01 into PDA liquid medium with different glucose contents, control the initial cell concentration to be OD 595nm = 0.5, 0.8, 1.0, 1.5 respectively, culture at 220 rpm and 28 °C until the glucose content is lower than 0.5%, take the fermentation broth, centrifuge at 8000 r / min for 10 min to obtain the supernatant.

[0058] 3) Cultivation method of Erwinia amylovora

[0059] Inoculate Erwinia amylovora into LB liquid medium, culture at 30 °C for 24 h, and dilute to 10 2 CFU / mL.

[0060] 4) Determination of antagonistic activity

[0061] Take 100 μL of the diluted culture solution of Erwinia amylovora and 100 μL of the fermentation supernatant of Aureobasidium pullulans, incubate at 30 °C for 24 h. Use the microplate method to quantitatively determine the antagonistic activity of Aureobasidium pullulans strains against Erwinia amylovora. After incubation, add the culture solution to a 96-well microplate and measure the absorbance at 595 nm.

[0062] Inhibition rate of Erwinia amylovora (%) = [(OD of the sterile water control group 595 nm − OD of the co-culture experimental group 595 nm ) / OD of the sterile water control group 595 nm × 100%

[0063] 5) Determination of the inhibition zone by the agar punching method

[0064] Absorb 100 μL of the diluted culture solution of Erwinia amylovora and spread it on an LB solid plate. Use a sterile borer to punch holes with a diameter of 8 mm on the plate. Use a pipette to vertically add 100 μL of the Aureobasidium pullulans fermentation broth into the holes. Make 3 replicates and a blank control (sterile water). Place it in an incubator at 30 °C for 2 - 3 days, and observe whether an inhibition zone appears and measure the size of the inhibition zone( Figure 6 ).

[0065] The results showed that when the initial glucose content was 20 g / L and the initial OD of Aureobasidium pullulans 595nm was 1.0, the antagonistic activity of its fermentation supernatant against Erwinia amylovora was the strongest, and the inhibition rate could reach over 90%( Figure 5 ).

[0066] In summary, Aureobasidium pullulans ZX01 can effectively inhibit Erwinia amylovora under simple culture conditions, can be prepared into a microbial inoculant, and applied to the green prevention and control of fire blight, reducing the use of chemical pesticides, thereby promoting the sustainable development of agriculture.

[0067] The above-described embodiments are only preferred embodiments given to fully illustrate the present invention, and the protection scope of the present invention is not limited thereto. Equivalent substitutions or transformations made by those skilled in the art on the basis of the present invention are all within the protection scope of the present invention. The protection scope of the present invention is subject to the claims.

Claims

1. A strain of Aureobasidium pullulans ZX01, characterized in that: The taxonomic name of the Aureobasidium melanogenum ZX01 is Aureobasidium melanogenum ZX01, and the preservation number of the strain is CCTCC NO: M 20242297.

2. A biological control agent, characterized in that: It comprises the Aureobasidium pullulans ZX01 strain according to claim 1.

3. A fermentation product, characterized in that It is fermented by the budding Aureobasidium pullulans ZX01 strain described in claim 1.

4. Use of the budding Aureobasidium pullulans ZX01 strain according to claim 1 or the fermentation product according to claim 3 in preventing and treating fire blight caused by Erwinia amylovora.

5. A method for preventing and treating fire blight caused by Erwinia amylovora, characterized in that: Spray the bacterial suspension or fermentation liquid containing the Aureobasidium pullulans ZX01 strain on the surface of the pear fruit.

Images