A genetically engineered bacterium with high yield of δ-tocotrienol and its application
By constructing a genetically engineered strain with high yield of δ-tocotrienol, using Yarrow lipolytica as the host, optimizing the genome and strengthening related pathways, the problems of low yield and amplification difficulties in the existing technology were solved, and efficient production of δ-tocotrienol was achieved to meet the needs of food safety and industrialization.
Patent Information
- Application Number
- CN202510608830.0
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-05-13
- Publication Date
- 2025-07-29
- Estimated Expiration
- 2045-05-13
AI Technical Summary
In the prior art, the production of δ-tocotrienol by microbial fermentation methods such as E. coli, Saccharomyces cerevisiae and Yarrowia lipolytica has problems such as low yield and difficulty in meeting food safety requirements and fermenter amplification needs.
A genetically engineered strain with high yield of δ-tocotrienol was constructed. Yarrow lipolytica was used as the host to knock out the ku70 gene, expressing 4-hydroxyphenylpyruvate dioxygenase, uricone melanoic acid phytotransferase and tocopherol cyclase genes, strengthening the shikilic acid and mevalonate pathways, introducing the isopentenol pathway, and fusion of HPD and HPT proteins and truncating tocopherol cyclase signal peptides to optimize the genome of the genetically engineered strains.
High yield of δ-tocotrienol was achieved, with the output in the shake flask being 50.94mg/L and the output in the 2L fermenter reaching 616.45mg/L, which has the prospect of industrial application and meets food safety requirements.
Smart Images

Figure SMS_1
Abstract
Description
Technical Field
[0001] The present invention relates to the field of genetic recombination technology, and more specifically, to a genetically engineered bacterium with high yield of δ-tocotrienol and its application. Background Art
[0002] Tocotrienols belong to the vitamin E family, and vitamin E exists naturally in eight different forms: four tocopherols and four tocotrienols. Tocotrienols contain four conformations, namely α-tocotrienol (α-tocotrienol), molecular formula C 29 H 44 O2, molecular weight 424.659; β-tocotrienol (β-tocotrienol), molecular formula C 28 H 42 O2, molecular weight 410.63; γ-tocotrienol (γ-tocotrienol), molecular formula C 28 H 42 O2, molecular weight 410.63; δ-tocotrienol (δ-tocotrienol), C 27 H 40 O2, molecular weight 396.61. The structure of tocotrienols can be divided into two parts, one part comes from homogentisic acid (HGA) synthesized by the shikimate pathway, and the other part comes from geranylgeranyl pyrophosphate (GGPP) synthesized by the mevalonate pathway (MVA). Under the action of homogentisate phytyltransferase (HPT), 2-methyl-6-geranylgeranylbenzoquinone (MGGBQ) is generated, and then under the catalysis of tocopherol cyclase (TC), δ-tocotrienol is generated. Tocotrienols have stronger antioxidant effects than tocopherols. They protect the stability of cell membranes by interrupting the chain reaction of free radicals, prevent the formation of lipofuscin on the membrane and delay the aging of the body; they can achieve anti-tumor effects by maintaining the stability of genetic materials and preventing chromosomal structure variation, avoid coronary artery sclerosis by preventing the oxidation of LDL cholesterol, and have the effects of preventing cataracts, delaying Alzheimer's disease, maintaining normal reproductive functions and neuroprotection.
[0003] Approximately 80% of the vitamin E sold on the market currently comes from chemical synthesis, and 20% comes from extraction from plants or seeds. However, the chemical synthesis process of vitamin E is affected by the use of toxic catalysts, making the process environmentally unfriendly and unsustainable. In addition, currently only α-tocopherol can be synthesized by chemical synthesis methods, and tocotrienols can be synthesized by a combination of biosynthesis and chemical synthesis methods. Most of the commercially available tocotrienols come from plant extraction. Therefore, there is an urgent need for a more environmentally friendly and economical production strategy. The method of producing tocotrienols by microbial fermentation is currently the most promising method. With the continuous development of synthetic biology technology and metabolic engineering technology, the advantages of using microbial fermentation are becoming more and more obvious.
[0004] Currently, the strains used to produce tocotrienols by microbial fermentation are Escherichia coli and Saccharomyces cerevisiae. In 2008, Christoph Albermann et al. first synthesized δ-tocotrienol in engineered Escherichia coli with a yield of 15 μg / g DCW. However, Escherichia coli produces endotoxins during fermentation, and the tocotrienols produced do not meet the food-grade requirements. In recent years, there has also been some progress in producing tocotrienols in Saccharomyces cerevisiae. In 2020, it was reported that δ-tocotrienol was first synthesized in Saccharomyces cerevisiae with a yield of 4.1 mg / L. In the same year, the research group of Teacher Hongwei Yu from Zhejiang University reported the synthesis of four conformational tocotrienols in Saccharomyces cerevisiae with a yield of 320 mg / L. Xue Jiao et al. achieved flux balance of three modules of tocotrienols in Saccharomyces cerevisiae, used β-cyclodextrin for biphasic extraction, and finally achieved a δ-tocotrienol yield of 247.1 mg / L, and 85.6% of the tocotrienols were extracted extracellularly. In 2025, Jinbo Xiang et al. used Yarrowia lipolytica as the chassis and obtained 466.8 mg / L of δ-tocotrienol in a 5 L fermenter. However, compared with shake flasks, only a two-fold magnification can be achieved in a 5 L fermenter, which cannot meet the requirements of subsequent scale-up.
[0005] Problems existing in the prior art: The yield of tocotrienols produced by Escherichia coli is low and does not meet food safety requirements. Saccharomyces cerevisiae contains four conformational tocotrienols, and it is difficult to isolate a single conformational tocotrienol; in addition, although using Saccharomyces cerevisiae as the chassis strain, the yield in shake flasks is 247.1 mg / L, but there is a problem of difficulty in scaling up in fermenters. The currently reported yield of Yarrowia lipolytica in a fermenter is 466.8 mg / L, but there is the same problem, and only a two-fold magnification can be achieved at the fermenter level. Based on this, the current problem is that a genetically engineered bacterium that meets food safety production of δ-tocotrienol needs to be constructed, which can produce δ-tocotrienols by microbial fermentation and can be significantly scaled up at the fermenter level.
[0006] Therefore, it is an urgent problem for those skilled in the art to provide a genetically engineered bacterium with high yield of δ-tocotrienol and its application. Summary of the Invention
[0007] In view of this, the present invention provides a genetically engineered bacterium with high yield of δ-tocotrienol and its application.
[0008] Yarrowia lipolytica is an unconventional oil-producing yeast with very strong stress resistance. It can not only use glucose as a carbon source, but also utilize various substrates such as waste oil, crude glycerol, and organic acids. Some Yarrowia lipolytica strains have been approved by the US Food and Drug Administration (FDA) and have obtained the Generally Recognized as Safe (GRAS) status, which makes it a suitable host for the production of food additives, drugs, and cosmetics. Since Yarrowia lipolytica has a high acetyl-CoA flux and shikimic acid flux and can synthesize a large amount of tocotrienol precursors GGPP and HGA, and the unique lipophilic environment in the cells of Yarrowia lipolytica is very suitable for the production and storage of tocotrienol, Yarrowia lipolytica is a host with great potential for the production of tocotrienol.
[0009] To achieve the above object, the present invention adopts the following technical solutions:
[0010] A genetically engineered bacterium with high yield of δ-tocotrienol,
[0011] using Yarrowia lipolytica ATCC MYA-2613 as the starting strain, knocking out the ku70 gene;
[0012] expressing the gene encoding 4-hydroxyphenylpyruvate dioxygenase, the gene encoding homogentisate phytyltransferase, and the gene encoding tocopherol cyclase;
[0013] Strengthening the shikimic acid pathway: expressing the gene encoding 3-deoxy-D-arabino-heptulosonate-7-phosphate synthase and the gene encoding shikimate mutase;
[0014] Strengthening the mevalonate pathway: expressing the gene encoding hydroxymethylglutaryl-CoA reductase and the gene encoding geranylgeranyl pyrophosphate synthase; and integrating the gene encoding hydroxymethylglutaryl-CoA reductase and the gene encoding geranylgeranyl pyrophosphate synthase into the F30 locus;
[0015] Introducing the isopentenol pathway: expressing the gene encoding choline kinase and the gene encoding isopentenyl phosphate kinase; and integrating the gene encoding choline kinase and the gene encoding isopentenyl phosphate kinase into the YLT1 locus;
[0016] Protein fusion of HPD and HPT: Integrate the HPD-HPT fusion gene into the YLT2 locus;
[0017] Truncate the signal peptide of the gene encoding tocopherol cyclase and complement leucine deficiency: Integrate the gene encoding tocopherol cyclase with 46 amino acids truncated after the N-terminal start codon ATG and the gene encoding leucine synthesis into the 26s locus.
[0018] Furthermore, the gene sequence of HPD encoding 4-hydroxyphenylpyruvate dioxygenase is shown in SEQ ID NO.17;
[0019] The gene sequence of HPT encoding homogentisate phytyltransferase is shown in SEQ ID NO.18;
[0020] The gene sequence of TC encoding tocopherol cyclase is shown in SEQ ID NO.19;
[0021] The gene scARO4 encoding 3-deoxy-D-arabino-heptulosonate-7-phosphate synthase K229L The sequence is shown in SEQ IDNO.50;
[0022] The gene ylARO7 encoding shikimate mutase G139S The sequence is shown in SEQ ID NO.51;
[0023] The gene sequence of tHMGR encoding hydroxymethylglutaryl-CoA reductase is shown in SEQ ID NO.68;
[0024] The gene sequence of GGPPsa encoding geranylgeranyl pyrophosphate synthase is shown in SEQ ID NO.69;
[0025] The gene sequence of CK encoding choline kinase is shown in SEQ ID NO.102;
[0026] The gene sequence of IPK encoding isopentenyl phosphate kinase is shown in SEQ ID NO.103;
[0027] The HPD-HPT fusion gene sequence is shown in SEQ ID NO.139;
[0028] The sequence of 46AATC, the gene encoding tocopherol cyclase with 46 amino acids truncated after the N-terminal start codon ATG, is shown in SEQ ID NO.156;
[0029] The gene sequence of LEU2 encoding leucine synthesis is shown in SEQ ID NO.157.
[0030] Furthermore, the method for constructing a genetically engineered bacterium with high yield of δ-tocotrienol includes the following steps:
[0031] Using Yarrowia lipolytica ATCC MYA-2613 as the starting strain, knockout the ku70 gene;
[0032] Express the gene encoding 4-hydroxyphenylpyruvate dioxygenase, the gene encoding homogentisate phytyltransferase, and the gene encoding tocopherol cyclase;
[0033] Strengthen the shikimate pathway; strengthen the mevalonate pathway; introduce the isopentenol pathway; perform protein fusion of HPD and HPT; truncate the signal peptide of the gene encoding tocopherol cyclase and complement the leucine deficiency.
[0034] Furthermore, the application of the genetically engineered bacterium with high yield of δ-tocotrienol in the production of δ-tocotrienol.
[0035] Furthermore, the application of the genetically engineered bacterium with high yield of δ-tocotrienol in improving the yield of δ-tocotrienol.
[0036] Furthermore, a method for producing δ-tocotrienol, which uses the genetically engineered bacterium for fermentation.
[0037] As can be seen from the above technical solutions, compared with the prior art, the present invention discloses a genetically engineered bacterium with high yield of δ-tocotrienol and its application. The selected Yarrowia lipolytica is a food-grade microorganism, which is non-pathogenic to humans and animals, and has better growth advantages under the same culture conditions. The Yarrowia lipolytica genetically engineered bacterium constructed in the present invention has industrial stability. The yield of δ-tocotrienol in the shake flask is 50.94 mg / L, and it can be amplified by more than 10 times compared with the shake flask level at the 2 L fermenter level. 616.45 mg / L of δ-tocotrienol can be produced after culturing for 240 h, showing prospects for industrial application. Specific Embodiments
[0038] The technical solutions in the embodiments of the present invention will be clearly and completely described below. Obviously, the described embodiments are only a part of the embodiments of the present invention, rather than all the embodiments. All other embodiments obtained by those of ordinary skill in the art based on the embodiments of the present invention without creative efforts shall fall within the protection scope of the present invention.
[0039] LB medium: 5 g / L of yeast extract, 10 g / L of tryptone, 5 g / L of NaCl.
[0040] YPD medium: 10 g / L of yeast extract, 20 g / L of peptone, 20 g / L of glucose.
[0041] SC medium: Yeast Nitrogen base (YNB) 1.7 g / L, ammonium sulfate (NH4)2SO4 5 g / L, amino acid mixture 1.8 g / L, glucose 20 g / L.
[0042] Composition of the amino acid mixture: Adenine 0.5 g, Alanine 2.0 g, Argnine 2.0 g, Asparagine 2.0 g, Aspartic acid 2.0 g, Cysteine 2.0 g, Glutamine 2.0 g, Glutamic acid 2.0 g, Glycine 2.0 g, Histidine 2.0 g, Inositol 2.0 g, Isoleucine 2.0 g, Leucine 4.0 g, Lysine 2.0 g, Methionine 2.0 g, para-Aminobenzoic acid 0.2 g, Phenylalanine 2.0 g, Proline 2.0 g, Serine 2.0 g, Threonine 2.0 g, Tryptophan 2.0 g, Tyrosine 2.0 g, Uracil 2.0 g, Valine 2.0 g.
[0043] SC-URA - Medium: Based on SC medium, without adding uracil.
[0044] SC-URA - -LEU - Medium: Based on SC medium, without adding uracil and leucine.
[0045] The above media can be made into corresponding solid media by adding 18 g / L of agarose.
[0046] The shake flask fermentation medium is SC medium, and the concentration of glucose is adjusted to 40 g / L.
[0047] YPD-5FOA solid medium: Add 0.5 g / L of 5-FOA (5-fluoroorotic acid) to YPD solid medium.
[0048] Method for shake flask fermentation culture:
[0049] 1) Streak on the SC solid medium plate and incubate at 30 °C for 36 h.
[0050] 2) Culture of the seed solution: Add 5 ml of SC liquid medium to a 50 ml sterile test tube. Use a 200 μl yellow pipette tip to scrape the bacterial lawn from the plate and pipette it into the liquid medium to mix evenly. Incubate at 30 °C for 12 h.
[0051] 3) Add 30 ml of SC liquid medium to a 100 ml baffled shake flask. Measure the OD600 of the seed solution and calculate the inoculation volume in the shake flask. The initial OD600 in the shake flask is 0.1.
[0052] 4) After culturing for 48 h, add 10% (i.e., 3 ml) of the organic phase dodecane.
[0053] 5) Culture for 144 h.
[0054] Testing method:
[0055] 1) Detection of OD600: Dilute the fermentation broth with deionized water and measure the absorbance value (600 nm) using a UV-visible spectrophotometer. Ensure that the diluted OD600 is in the range of 0.2 - 0.8. The measured value multiplied by the dilution factor is the OD600.
[0056] 2) Detection of homogentisic acid (HGA): To determine the HGA concentration, yeast strains were cultured in SC medium and samples were taken from the supernatant of the fermentation broth. After centrifuging the fermentation broth, 1 mL of the supernatant was collected, mixed with 40 μL of glacial acetic acid, and filtered through a syringe with a membrane (aqueous membrane with a pore size of 0.22 μm) to remove impurities for HPLC analysis. HGA was detected by HPLC (Thermo Fisher, USA) equipped with a C18-H column (4.6 × 250 mm, 5 µm, Kromasil 100-5-C18(W), Sweden) using a UV / VIS detector at 290 nm. The samples were eluted with a 0.01 M KH2PO4 solution (A) and methanol (B) at a ratio of 90% / 10% at a flow rate of 0.8 mL / min at 40 °C.
[0057] 3) Detection of δ-tocotrienol: To determine δ-tocotrienol, take the organic phase from the fermentation broth. After centrifuging, 1 ml of the organic phase was collected and filtered through a syringe with a membrane (organic membrane with a pore size of 0.22 μm) to remove impurities.
[0058] Detection was carried out using GC-MS, and the equipment was GCMS-QP2010SE (Shimadzu, Japan). The chromatographic column was (5% phenyl-95% polydimethylsiloxane; 30m×0.25mm, 0.25μm film thickness). High-purity helium gas (99.999%) was used as the carrier gas, and the constant flow rate was 1.0 mL / min. The initial temperature of the gas chromatography furnace was set at 60°C, and then it was programmed to rise to 300°C at a rate of 40°C / min and held for 11 minutes. The total running time was 17 minutes (including a 6-minute solvent delay time). 1 μL of the sample solution was injected in the splitless injection mode, and the inlet temperature was constantly maintained at 300°C.
[0059] Yarrowia lipolytica Po1f was purchased from the American Type Culture Collection, with the accession number ATCC MYA-2613.
[0060] Example 1
[0061] 1) Using Yarrowia lipolytica ATCC MYA-2613 as the starting strain, in order to improve the homologous recombination efficiency of Yarrowia lipolytica, the endogenous ku70 gene was knocked out to obtain the strain ATCC MYA-2613ΔKu70-URA, named YL01.
[0062] The Ku70 gene was knocked out by the method of homologous recombination. The specific method is as follows:
[0063] (1) Using the genomic DNA of Yarrowia lipolytica ATCC MYA-2613 as a template, the primer pair Ku70-up-F / Ku70-up-R was used to amplify Ku70-up (shown in SEQ ID NO.1) to obtain the Ku70-up fragment; the primer pair Ku70-down-F / Ku70-down-R was used to amplify Ku70-down (shown in SEQ ID NO.2) to obtain the Ku70-down fragment, that is, the upstream and downstream homologous arms for knocking out Ku70 were obtained.
[0064] The specific primer sequences are as follows:
[0065] Ku70-up-F: CGTTGCGC TTGGGCTTGGGGCACTTCTGC ; SEQ ID NO.3.
[0066] Ku70-up-R: cgttttacaac GTTCGTGGTTCGTGTTTCGTGTTCGT ; SEQ ID NO.4.
[0067] Ku70-down-F: CTACGGCTAC CTGCTGCTTCCAAACGATATGAGGATGAGT ; SEQ ID NO.5.
[0068] Ku70-down-R: CAAATGCCTG ATGGTGTGCCAGGAGGTGGAC ; SEQ ID NO.6.
[0069] Gene amplification system: 25 μL of PrimestarMax (Takara), 2 μL each of forward and reverse primers, 1 μL of template, 20 μL of ddH2O.
[0070] Gene amplification program: Pre-denaturation at 98 °C for 3 minutes; denaturation at 98 °C for 10 seconds, annealing at 57 °C for 30 seconds, extension at 72 °C at 10 s / kb for 35 cycles; extension at 72 °C for 10 minutes.
[0071] After agarose gel electrophoresis and product recovery of the PCR products, gene fragments Ku70-up and Ku70-down were obtained.
[0072] (2) The screening marker used for homologous recombination is 3HA-URA-3HA: Using the 3HA-URA-3HA gene sequence synthesized by BGI (as shown in SEQ ID NO.7) as a template, 3HA-URA-3HA was amplified using primers Ku70-URA-F / Ku70-URA-R to obtain the screening marker 3HA-URA-3HA fragment 1 of the knockout / integration plasmid.
[0073] The primer sequences are as follows:
[0074] Ku70-URA-F: CGAACCACGAAC gttgtaaaacgacggccagtcgaacc ; SEQ ID NO.8.
[0075] Ku70-URA-R: GAAGCAGCAG GTAGCCGTAGGTCTCGTACTGCTTGAC ; SEQ ID NO.9.
[0076] (3) The plasmid vector p-kana (as shown in SEQ ID NO.10) was amplified using Ku70-VEC-F / Ku70-VEC-R to obtain the p-kana vector fragment.
[0077] The primer sequences are as follows:
[0078] Ku70-VEC-F: TGGCACACCAT CAGGCATTTGAGAAGCACACGGTCAC ; SEQ ID NO.11.
[0079] Ku70-VEC-R: CAAGCCCAA GCGCAACGCAATTAATGTAAGTTAGCTCACTC ; SEQ ID NO.12.
[0080] (4) Add the amplified products into a PCR tube: 2 μL of Ku70-up fragment, 2 μL of Ku70-down fragment, 3 μL of 3HA-URA-3HA fragment 1, 3 μL of p-kana vector fragment, and 10 μl of Gibson ligase. The ligation temperature is 50 °C and the ligation time is 15 min. The total system is 20 μL.
[0081] All 20 μl of the total ligation system for Gibson ligation were transformed into E.coli Trans10 commercial competent cells (TransGen Biotech Co., Ltd., Beijing) for culture. The transformation process was strictly carried out according to the instructions: After culturing at 37 °C for 1 h, plate onto LB plates (containing 50 μg / mL kanamycin), and then culture at 37 °C for 12 h. Select 10 - 20 single colonies for colony PCR amplification and DNA sequencing verification. The primers for colony PCR amplification and DNA sequencing are Ku70-up-F / Ku70-down-R.
[0082] Select a correct single colony, name it Escherichia coli EC001, name the plasmid pkana-Ku70. After expansion, extract the plasmid to obtain the pkana-Ku70 plasmid. Using the pkana-Ku70 plasmid as a template and ku70 linearization-F / R as primers, amplify the linearized integration fragment Ku70up-3HA-URA-3HA-Ku70down.
[0083] The primer sequences are as follows:
[0084] ku70 linearization-F: TTGGGCTTGGGGCACTTCTGC; SEQ ID NO.13.
[0085] ku70 linearization-R: ATGGTGTGCCAGGAGGTGGAC; SEQ ID NO.14.
[0086] Transform the linearized integration fragment Ku70up-3HA-URA-3HA-Ku70down into the strain Yarrowia lipolytica ATCC MYA-2613 by chemical transformation method.
[0087] The transformation method of Yarrowia lipolytica ATCC MYA-2613 is as follows:
[0088] Transformation using the Yarrowia lipolytica kit: Use Frozen-EZ Yeast Transformation II Kit.
[0089] Pick colonies from the plate into 10 mL of YPD medium and grow overnight until OD 600= 0.5 - 0.7 (should not be too high). 500 µL of bacterial solution is required for each competent cell. Taking 1 mL as an example, two competent cells are prepared as follows:
[0090] ① Take 1 mL of bacterial solution and centrifuge at 5000 rpm for 3 min. Discard the supernatant (try to suck it out as clean as possible).
[0091] ② Add an equal volume (1 mL) of Buffer S1 and mix well. Centrifuge at 5000 rpm for 3 min. Discard the supernatant.
[0092] ③ Add 100 µL of Buffer S2 to every 1 mL of bacterial solution, mix gently and aliquot into two clean centrifuge tubes (50 µL each). It can be used immediately or frozen at -80 °C for later use.
[0093] ④ Add plasmid or linearized DNA fragment to the competent cells (the added volume should be less than 5 µL, and the DNA addition amount is about 1 µg).
[0094] ⑤ Add 500 µL of Buffer S3 to each competent cell and recover at 30 °C for 1 h. When plating, each competent cell is plated on two plates, and 250 µL is directly plated on each plate. The plated plates are SC-URA - 。
[0095] Verify after culturing at 30 °C for 36 h.
[0096] For gene knockout strains, several single colonies grown on the above plates need to be picked and verified for the KU70 gene using the verification primers Ku70-F / R. If the corresponding band can be amplified, it proves that the knockout is not successful. If the corresponding band cannot be amplified, it proves that the knockout is successful. The verification primers are as follows:
[0097] Ku70-F: TGCTGGAAATCGAGGACTACAAGG; SEQ ID NO.15.
[0098] Ku70-R: CAACCCAGTCCTTCTTCAACTTGCTA; SEQ ID NO.16.
[0099] Inoculate the verified strain into YPD medium, culture for 12 h, preserve the glycerol tube, and obtain the strain ATCC MYA-2613ΔKu70-URA, named YL01.
[0100] (5)Recover the selection marker to obtain the strain ATCC MYA-2613ΔKu70-URA - :
[0101] The strain YL01 was inoculated into YPD medium and cultured for 12 h. After the bacterial liquid became turbid, it was spread on YPD-5FOA solid medium. Since the strains containing uracil could not survive on YPD-5FOA solid medium, the colonies growing on YPD-5FOA solid medium were the strains ATCC MYA-2613ΔKu70-URA that had lost URA. - It was named YL02.
[0102] 2) Starting from the strain ATCC MYA-2613ΔKu70-URA - (YL02), three exogenous genes are required for the synthesis of δ-tocotrienol, namely the gene encoding 4-hydroxyphenylpyruvate dioxygenase, the gene encoding homogentisate phytyltransferase, and the gene encoding tocopherol cyclase.
[0103] (1) The gene encoding 4-hydroxyphenylpyruvate dioxygenase selected was the codon-optimized gene HPD encoding 4-hydroxyphenylpyruvate dioxygenase derived from Pseudomonas putida KT2440 (as shown in SEQ ID NO.17).
[0104] (2) The gene encoding homogentisate phytyltransferase was selected from the codon-optimized gene HPT encoding homogentisate phytyltransferase derived from Synechocystis sp. PCC 6803 (as shown in SEQ ID NO.18).
[0105] (3) The gene encoding tocopherol cyclase was selected from the codon-optimized gene TC encoding tocopherol cyclase derived from Arabidopsis thaliana (as shown in SEQ ID NO.19).
[0106] In order to integrate the above three exogenous genes into the strain YL02, the following plasmids need to be constructed:
[0107] First is the construction of plasmid pintE1-HPD-HPT. The vector backbone is pintE1-TEFin-HPT-xpr2-EXP-HPD-lip2-3HA-URA-3HA.
[0108] The construction method is as follows:
[0109] Using plasmid pCfB4778 as the amplification template, pCfB4778 was purchased from EasyClone YALI Collection (Kit #1000000140, 1000000141), and the plasmid backbone p-intE1vec was amplified with the amplification primers intE1vec-F / R. The primer sequences are as follows:
[0110] intE1vec-F: CTACGGCTACccgagcgtcgacaagcatacagc; SEQ ID NO.20.
[0111] intE1vec-R: GTGAGTGAATTGagcactatcctctgctgcgtc; SEQ ID NO.21.
[0112] Using the TEFin promoter synthesized by BGI (as shown in SEQ ID NO.22) as the template, the TEFin promoter was amplified with the primers TEFin-F1 / TEFin-R1 to obtain the TEFin promoter fragment 1.
[0113] The primer sequences are as follows:
[0114] TEFin-F1: gatagtgct CAATTCACTCACTCTCCCGACTATCC ; SEQ ID NO.23.
[0115] TEFin-R1: gatggtggc ctgcggttagtactgcaaaaagtgc ; SEQ ID NO.24.
[0116] Using the genomic DNA of Yarrowia lipolytica ATCC MYA-2613 as the template, the xpr2 terminator (as shown in SEQ ID NO.25) was amplified with the primers xpr2-F1 / xpr2-R1 to obtain the xpr2 terminator fragment 1.
[0117] The primer sequences are as follows:
[0118] xpr2-F1: ccatcttctaa GATCCAACTACGGAACTTGTGTTGATGTCTTTG ; SEQ ID NO.26.
[0119] xpr2-R1: CCAAACTC GACACGGGCATCTCACTTGCATATG ; SEQ ID NO.27.
[0120] Using the genomic DNA of Yarrowia lipolytica ATCC MYA-2613 as the template, the EXP promoter (as shown in SEQ ID NO.28) was amplified with the primers EXP-F1 / EXP-R1 to obtain the EXP promoter fragment 1.
[0121] The primer sequences are as follows:
[0122] EXP-F1: GATGCCCGTGTC GAGTTTGGCGCCCGTTTTTTCG ; SEQ ID NO.29
[0123] EXP-R1: gatgtcggccat TGCTGTAGATATGTCTTGTGTGTAAGGGGG ; SEQ ID NO.30
[0124] Using the genomic DNA of Yarrowia lipolytica ATCC MYA-2613 as a template, the lip2 terminator (shown as SEQ ID NO.31) was amplified using the primers lip2-F1 / lip2-R1 to obtain the lip2 terminator fragment 1
[0125] The primer sequences are as follows:
[0126] lip2-F1: cgtgctgtctactgattaa gctatttatcactctttacaacttctacctcaactatc ; SEQID NO.32
[0127] lip2-R1: tcgttttacaac catttgccattcgtaacgctggtag ; SEQ ID NO.33
[0128] Using the HPT gene synthesized by BGI (shown as SEQ ID NO.18) as a template, the HPT gene was amplified using the primers HPT-F / HPT-R to obtain the HPT gene fragment
[0129] The primer sequences are as follows:
[0130] HPT-F: tactaaccgcaggccaccatccaggccttctg; SEQ ID NO.34
[0131] HPT-R: CCGTAGTTGGATCttagaagatggtgttagaaaaattaggcagccac; SEQ ID NO.35
[0132] Using the HPD gene synthesized by BGI (shown as SEQ ID NO.17) as a template, the HPD gene was amplified using the primers HPD-F / HPD-R to obtain the HPD gene fragment
[0133] The primer sequences are as follows:
[0134] HPD-F: TCTACAGCA atggccgacatcttcgagaaccccat ; SEQ ID NO.36
[0135] HPD-R: tagcttaatcagtagacagcacgcctcgtc ; SEQ ID NO.37.
[0136] Using the plasmid pkana-Ku70 constructed above as a template, the 3HA-URA-3HA was amplified with primers URA-F2 / URA-R2 to obtain the 3HA-URA-3HA fragment 2.
[0137] The primer sequences are as follows:
[0138] URA-F2: ggcaaatg gttgtaaaacgacggccagtcgaacc ; SEQ ID NO.38.
[0139] URA-R2: gacgctcgg GTAGCCGTAGGTCTCGTACTGCTTGAC ; SEQ ID NO.39.
[0140] The gene amplification system and gene amplification program are the same as above.
[0141] Add the amplified products into a PCR tube: 2 μL of p-intE1vec, 1 μL of TEFin promoter fragment 1, 1 μL of EXP promoter fragment 1, 1 μL of xpr2 terminator fragment 1, 1 μL of lip2 terminator fragment 1, 2 μL of 3HA-URA-3HA fragment 2, 1 μL of HPT gene fragment, 1 μL of HPD gene fragment, and 10 μL of Gibson ligase. The ligation temperature is 50 °C and the ligation time is 15 min. The total system is 20 μL. The transformation method is the same as above. After culturing at 37 °C for 1 h, plate it onto an LB plate (containing 100 μg / mL ampicillin).
[0142] The colony PCR amplification and DNA sequencing primers are HPT-F / HPD-R. If a band with a size of 3519 bp can be PCR amplified, it is correct.
[0143] Select a correct single colony, name it Escherichia coli EC002, name the plasmid pintE1-HPD-HPT. After expansion, perform plasmid extraction to obtain the pintE1-HPD-HPT plasmid.
[0144] Secondly, construct the pintE1-HPD-HPT-TC plasmid, and the vector backbone is pintE1-TEFin-HPT-xpr2-lip2-TC-TEFin-EXP-HPD-lip2-3HA-URA-3HA.
[0145] The construction method is as follows:
[0146] Using the pintE1-HPD-HPT plasmid as the amplification template, the pintE1-HPD-HPTvec fragment was amplified using the primers intE1-HPD-HPT-F / intE1-HPD-HPT-R.
[0147] The primer sequences are as follows:
[0148] intE1-HPD-HPT-F: GAGTGAGTGAATTGGAGTTTGGCGCCCGTTTTTTCG; SEQ ID NO.40.
[0149] intE1-HPD-HPT-R: cgaatggcaaatgGACACGGGCATCTCACTTGCATATG; SEQ ID NO.41.
[0150] Using the pintE1-HPD-HPT plasmid as the amplification template, the TEFin promoter (shown in SEQ ID NO.22) was amplified using the primers TEFin-F2 / TEFin-R2 to obtain the TEFin promoter fragment 2.
[0151] TEFin-F2: atcggatctc ctgcggttagtactgcaaaaagtgc ; SEQ ID NO.42.
[0152] TEFin-R2: GCCAAACTC CAATTCACTCACTCTCCCGACTATCC ; SEQ ID NO.43.
[0153] Using the pintE1-HPD-HPT plasmid as the amplification template, the lip2 terminator (shown in SEQ ID NO.31) was amplified using the primers lip2-F2 / lip2-R2 to obtain the lip2 terminator fragment 2.
[0154] lip2-F2: CCGTGTC catttgccattcgtaacgctggtag ; SEQ ID NO.44.
[0155] lip2-R2: cccggcctgtaa gctatttatcactctttacaacttctacctcaactatc ; SEQ IDNO.45.
[0156] Using the TC gene (shown in SEQ ID NO.19) synthesized by BGI as the template, the TC gene was amplified using the primers TC-F / TC-R to obtain the TC gene fragment.
[0157] The primer sequences are as follows:
[0158] TC-F: gataaatagc ttacaggccgggaggtttgaagaaagg ; SEQ ID NO.46.
[0159] TC-R: gtactaaccgcag gagatccgatctctgatcgtgtctatga ; SEQ ID NO.47.
[0160] Add 3 μL of pintE1-HPD-HPTvec, 2 μL of TEFin promoter fragment 2, 2 μL of lip2 terminator fragment 2, 3 μL of TC gene and 10 μL of Gibson ligase into a PCR tube. The ligation temperature is 50 °C and the ligation time is 15 min. The total volume of the system is 20 μL. The transformation method is the same as above. After culturing at 37 °C for 1 h, spread the culture on an LB plate (containing 100 μg / mL ampicillin).
[0161] The primers for colony PCR amplification and DNA sequencing are HPT-F / HPD-R. If a band with a size of 5808 bp can be amplified by PCR, it is correct.
[0162] Select a correct single colony, name it Escherichia coli EC003, name the plasmid pintE1-HPD-HPT-TC. After amplification, extract the plasmid to obtain the pintE1-HPD-HPT-TC plasmid.
[0163] Using the pintE1-HPD-HPT-TC plasmid as a template and intE1 linearization-F / R as primers, amplify the linearized integration fragment: intE1up-TEFin-HPT-xpr2-lip2-TC-TEFin-EXP-HPD-lip2-3HA-URA-3HA-intE1down.
[0164] The primer sequences are as follows:
[0165] intE1 linearization-F: TTGGGCTTGGGGCACTTCTGC; SEQ ID NO.48.
[0166] intE1 linearization-R: ATGGTGTGCCAGGAGGTGGAC; SEQ ID NO.49.
[0167] Using strain YL02 as the starting strain, transform the linearized integration fragment into YL02 to obtain strain ATCC MYA-2613ΔKu70-intE1:(HPD-HPT-TC)-URA, named YL03.
[0168] The transformation method is the same as above.
[0169] Recover the selection marker to obtain strain ATCC MYA-2613ΔKu70-intE1:(HPD-HPT-TC)-URA -, named YL04.
[0170] The method for recycling and screening markers is the same as above.
[0171] The strain YL03 was fermented in SC medium for 144 h, and the HGA and δ-tocotrienol were measured. The results are as follows: OD600 was 20.62, the yield of HGA was 2.52 mg / L, and the yield of δ-tocotrienol was 0.119 mg / L.
[0172] 3) Strengthen the shikimate pathway
[0173] Based on the strain YL04, the precursor homogentisic acid (HGA) was strengthened. The related genes for the strengthening of the precursor homogentisic acid (HGA) include the gene ARO4 encoding 3-deoxy-D-arabino-heptulosonate-7-phosphate synthase and the gene ARO7 encoding chorismate mutase.
[0174] The gene encoding 3-deoxy-D-arabino-heptulosonate-7-phosphate synthase is selected from the gene scARO4 encoding 3-deoxy-D-arabino-heptulosonate-7-phosphate synthase from Saccharomyces cerevisiae BY4741 and with the amino acid at position 229 mutated from lysine to leucine K229L (as shown in SEQ ID NO.50).
[0175] The gene ARO7 encoding chorismate mutase is selected from the gene ylARO7 encoding chorismate mutase from Yarrowia lipolytica ATCC MYA-2613 and with the amino acid at position 139 mutated from glycine to threonine G139S (as shown in SEQ ID NO.51).
[0176] In order to integrate the above two foreign genes into the strain YL04, it is necessary to construct the plasmid pintB1-scARO4 K229L -ylARO7 G139S , and the vector backbone is pintB1-TEFin-scARO4 K229L -xpr2-EXP-ylARO7 G139S -lip2-3HA-URA-3HA.
[0177] The construction method is as follows:
[0178] Using the plasmid backbone p-intB1vec synthesized by BGI (shown in SEQ ID NO.52) as a template, primers intB1vec-F / R were used for amplification to obtain the plasmid backbone p-intB1vec fragment.
[0179] The primer sequences are as follows:
[0180] intB1vec-F: GAGACCTACGGCTAC gtgaacttcttatgggaagtcaagttgagattgtg ; SEQ ID NO.53.
[0181] intB1vec-R: GAGTGAGTGAATTG acctgctcctgcacctaagttcgt ; SEQ ID NO.54.
[0182] Using the pintE1-HPD-HPT plasmid as an amplification template, primers TEFin-F3 / TEFin-R3 were used to amplify the TEFin promoter (shown in SEQ ID NO.22) to obtain the TEFin promoter fragment 3.
[0183] The primer sequences are as follows:
[0184] TEFin-F3: aggagcaggt CAATTCACTCACTCTCCCGACTATCCAACAACG ; SEQ ID NO.55.
[0185] TEFin-R3: ggagattcact ctgcggttagtactgcaaaaagtgctgg ; SEQ ID NO.56.
[0186] Using the pintE1-HPD-HPT plasmid as an amplification template, primers xprEXP-F1 / xprEXP-R1 were used to amplify xpr2-EXP to obtain the xpr2-EXP fragment 1.
[0187] xprEXP-F1: caagaaatag GATCCAACTACGGAACTTGTGTTGATGTCTTTG ; SEQ ID NO.57.
[0188] xprEXP-R1: ctttagtgaagtccat TGCTGTAGATATGTCTTGTGTGTAAGGGGG ; SEQ ID NO.58.
[0189] Using the pintE1-HPD-HPT plasmid as an amplification template, primers lip2-F3 / lip2-R3 were used to amplify the lip2 terminator (shown in SEQ ID NO.31) to obtain the lip2 terminator fragment 3.
[0190] lip2-F3: gcggttggagtag gctatttatcactctttacaacttctacctcaactatc ; SEQ ID NO.59.
[0191] lip2 - R3: ccgtcgttttacaac catttgccattcgtaacgctggtagacagg ; SEQ ID NO.60.
[0192] Using the ylARO7 gene synthesized by BGI (as shown in SEQ ID NO.51) as a template, primers ylARO7 - F / ylARO7 - R were used to amplify the ylARO7 gene to obtain the ylARO7 gene fragment. G139S gene (as shown in SEQ ID NO.51) as a template, using primers ylARO7 G139S -F / ylARO7 G139S -R to amplify the ylARO7 G139S gene, obtaining the ylARO7 G139S gene fragment.
[0193] The primer sequences are as follows:
[0194] ylARO7 G139S -F: CTACAGCA atggacttcactaaagccgacaccgttctg ; SEQ ID NO.61.
[0195] ylARO7 G139S -R: tgataaatagc ctactccaaccgccggagcag ; SEQ ID NO.62.
[0196] Using the scARO4 gene synthesized by BGI (as shown in SEQ ID NO.50) as a template, primers scARO4 - F / scARO4 - R were used to amplify the scARO4 gene to obtain the scARO4 gene fragment. K229L gene (as shown in SEQ ID NO.50) as a template, using primers scARO4 K229L -F / scARO4 K229L -R to amplify the scARO4 K229L gene, obtaining the scARO4 K229L gene fragment.
[0197] scARO4 K229L -F: ctaaccgcag agtgaatctccaatgttcgctgccaac ; SEQ ID NO.63.
[0198] scARO4 K229L -R: CCGTAGTTGGATC ctatttcttgttaacttctcttctttgtctgacagc ; SEQ IDNO.64.
[0199] Using the plasmid pkana - Ku70 constructed above as a template, primers URA - F3 / URA - R3 were used to amplify 3HA - URA - 3HA to obtain the 3HA - URA - 3HA fragment 3.
[0200] URA - F3: same as SEQ ID NO.38.
[0201] URA - R3: gaagttcac GTAGCCGTAGGTCTCGTACTGCTTGAC; SEQ ID NO. 65.
[0202] The gene amplification system and gene amplification procedure are the same as above.
[0203] Add 1 μL of p-intB1vec fragment, 1 μL of TEFin promoter fragment 3, 1 μL of xpr2-EXP fragment 1, 1 μL of lip2 terminator fragment 3, 2 μL of 3HA-URA-3HA fragment 3, and 2 μL of scARO4 K229L gene fragment, 2 μL of ylARO7 G139S gene fragment and 10 μl of Gibson ligase. The ligation temperature is 50 °C and the ligation time is 15 min. The total system is 20 μL. The transformation method is the same as above. After culturing at 37 °C for 1 h, plate it onto an LB plate (containing 50 μg / mL kanamycin).
[0204] The primers for colony PCR amplification and DNA sequencing are scARO4 K229L -F / ylARO7 G139S -R. If a band with a size of 3399 bp can be amplified by PCR, it is correct.
[0205] Select a correct single colony, name it Escherichia coli EC004, and name the plasmid pintB1-scARO4 K229L -ylARO7 G139S . After amplification, extract the plasmid to obtain pintB1-scARO4 K229L -ylARO7 G139S plasmid.
[0206] Use intB1 linearization-F / R as primers to amplify the linearized integration fragment IntB1up-TEFin-scARO4 K229L -xpr2-EXP-ylARO7 G139S -lip2-3HA-URA-3HA-IntB1down.
[0207] The primer sequences are as follows:
[0208] intB1 linearization-F: cataagacgcctcgttgctcggg; SEQ ID NO. 66.
[0209] intB1 linearization-R: gaatgcgtgcgatcccacagttctca; SEQ ID NO. 67.
[0210] Using strain YL04 as the starting strain, the fragment was transformed into YL04 to obtain strain ATCC MYA-2613ΔKu70-intE1:(HPD-HPT-TC)-intB1:(scARO4 K229L -ylARO7 G139S )-URA, named YL05.
[0211] The transformation method was the same as above.
[0212] The selection marker was recovered to obtain strain ATCC MYA-2613ΔKu70-intE1:(HPD-HPT-TC)-intB1:(scARO4 K229L -ylARO7 G139S )URA - , named YL06.
[0213] The method for recovering the selection marker was the same as above.
[0214] Strain YL05 was fermented in SC medium for 144 h, and the contents of HGA and δ-tocotrienol were measured. The results were as follows: OD600 was 19.26, the yield of HGA was 116 mg / L, and the yield of δ-tocotrienol was 0.802 mg / L.
[0215] 4) Strengthening the mevalonate pathway
[0216] (1) Based on strain YL06, the precursor geranylgeranyl pyrophosphate (GGPP) was strengthened. The genes related to the strengthening of the precursor geranylgeranyl pyrophosphate (GGPP) include the gene encoding 3-hydroxy-3-methylglutaryl coenzyme A (HMG-CoA) reductase and the gene encoding geranylgeranyl pyrophosphate (GGPP) synthase.
[0217] The gene encoding 3-hydroxy-3-methylglutaryl coenzyme A (HMG-CoA) reductase is the gene tHMGR (as shown in SEQ ID NO.68) encoding 3-hydroxy-3-methylglutaryl coenzyme A reductase from Yarrowia lipolytica ATCC MYA-2613 with the first 500 amino acids deleted from the N-terminus.
[0218] The gene encoding geranylgeranyl pyrophosphate (GGPP) synthase is the gene GGPPsa (as shown in SEQ ID NO.69) encoding geranylgeranyl pyrophosphate (GGPP) synthase from Sulfolobus acidocaldarius ATCC 33909 and codon-optimized.
[0219] To integrate the above two genes into strain YL06, it is necessary to construct plasmid pintD1-tHMGR-GGPPsa, and the vector backbone is pintD1-TEFin-tHMGR-xpr2-EXP-GGPPsa-lip2-3HA-URA-3HA.
[0220] The construction method is as follows:
[0221] Using plasmid pkana-Ku70 as the amplification template, amplify the plasmid backbone p-intD1vec, and the amplification primers are intD1vec-F / R.
[0222] The primer sequences are as follows:
[0223] intD1vec-F: TGTTGTTGCCTCTCACAGGCATTTGAGAAGCACACGGTCAC; SEQ ID NO.70.
[0224] intD1vec-R: GATGCGACAGAGGCGCAACGCAATTAATGTAAGTTAGCTCACTC; SEQ ID NO.71.
[0225] Using plasmid pintE1-HPD-HPT as the amplification template, amplify the TEFin promoter (shown in SEQ ID NO.22) with primers TEFin-F4 / TEFin-R4 to obtain the TEFin promoter fragment 4.
[0226] TEFin-F4: CTCGACAAGG CAATTCACTCACTCTCCCGACTATCCAACAAC ; SEQ ID NO.72.
[0227] TEFin-R4: cagactgggt ctgcggttagtactgcaaaaagtgctgg ; SEQ ID NO.73.
[0228] Using plasmid pintE1-HPD-HPT as the amplification template, amplify xpr2-EXP with primers xprEXP-F2 / xprEXP-R2 to obtain the xpr2-EXP fragment 2.
[0229] xprEXP-F2: acggtcaTAAGATCCAACTACGGAACTTGTGTTGATGTCTTTGC; SEQ ID NO.74.
[0230] xprEXP-R2: GTCGAAGTAAGACATTGCTGTAGATATGTCTTGTGTGTAAGGGGGT; SEQ IDNO.75.
[0231] Using the pintE1-HPD-HPT plasmid as the amplification template, primers lip2URA-F1 / lip2URA-R1 were used to amplify lip2-terminator and 3HA-URA-3HA, and the lip2-3HA-URA-3HA fragment 1 was obtained.
[0232] lip2URA-F1: CCGACGACGAAAGTAA gctatttatcactctttacaacttctacctcaactatc ; SEQ ID NO.76.
[0233] lip2URA-R1: TAGAATGAACCG GTAGCCGTAGGTCTCGTACTGCTTGAC ; SEQ ID NO.77.
[0234] Using the genome of Yarrowia lipolytica ATCC MYA-2613 as the template, primers tHMGR-F / tHMGR-R were used to amplify the tHMGR gene (as shown in SEQ ID NO.68), and the tHMGR gene fragment was obtained.
[0235] tHMGR-F: ctaaccgcagacccagtctgtgaaggtggttgagaag; SEQ ID NO.78.
[0236] tHMGR-R: CCGTAGTTGGATCttatgaccgtatgcaaatattcgaaccgttttgtagacg; SEQ ID NO.79.
[0237] Using the genome of Yarrowia lipolytica ATCC MYA-2613 as the template, primers intD1up-F / intD1up-R were used to amplify the upstream homologous arm intD1up (as shown in SEQ ID NO.80), and the intD1up fragment was obtained.
[0238] The primer sequences are as follows:
[0239] intD1up-F: CGTTGCGC CTCTGTCGCATCTCTAGTAGAGGTGGTGAC ; SEQ ID NO.81.
[0240] intD1up-R: GTGAGTGAATTG CCTTGTCGAGACGCTAACAGACACATGC ; SEQ ID NO.82.
[0241] Using the genome of Yarrowia lipolytica ATCC MYA-2613 as the template, primers intD1down-F / intD1down-R were used to amplify the downstream homologous arm intD1down (as shown in SEQ ID NO.83), and the intD1down fragment was obtained.
[0242] The primer sequences are as follows:
[0243] intD1down-F: ACCTACGGCTAC CGGTTCATTCTAGCACATGTGCCATGT ; SEQ ID NO.84.
[0244] intD1down-R: TCAAATGCCTG TGAGAGGCAACAACACCCTCGTATCTCAAC ; SEQ ID NO.85.
[0245] Using the GGPPsa gene synthesized by BGI (shown as SEQ ID NO.69) as a template, the GGPPsa gene was amplified using the primers GGPPsa-F / GGPPsa-R to obtain the GGPPsa gene fragment.
[0246] The primer sequences are as follows:
[0247] GGPPsa-F: TCTACAGCAATGTCTTACTTCGACAACTACTTCAACGAGATCG; SEQ ID NO.86.
[0248] GGPPsa-R: aatagcTTACTTTCGTCGTCGGATGGTGAACTCG; SEQ ID NO.87.
[0249] The gene amplification system and gene amplification program are the same as above.
[0250] Add 2 μL of p-intD1vec, 1 μL of intD1up fragment, 1 μL of intD1up fragment, 1 μL of TEFin promoter fragment 4, 1 μL of xpr2-EXP fragment 2, 2 μL of lip2-3HA-URA-3HA fragment 1, 1 μL of tHMGR gene fragment, 1 μL of GGPPsa gene fragment and 10 μl of Gibson ligase into a PCR tube. The ligation temperature is 50 °C and the ligation time is 15 min. The total system is 20 μL. The transformation method is the same as above. After culturing at 37 °C for 1 h, plate it onto an LB plate (containing 50 μg / mL kanamycin).
[0251] The colony PCR amplification and DNA sequencing primers are tHMGR-F / GGPPsa-R. If a band with a size of 4011 bp can be PCR amplified, it is correct.
[0252] Select a correct single colony, name it Escherichia coli EC005, name the plasmid pintD1-tHMGR-GGPPsa. After expansion, plasmid extraction was carried out to obtain the pintD1-tHMGR-GGPPsa plasmid.
[0253] Use intD1 linearization - F / R as primers to amplify the linearized integration fragment IntD1up - TEFin - tHMGR - xpr2 - EXP - GGPPsa - lip2 - 3HA - URA - 3HA - IntD1down.
[0254] The primer sequences are as follows:
[0255] intD1 linearization - F: CTCTTTCGTAGATGGTTTCCGTAAGACGTTTGAG; SEQ ID NO.88.
[0256] intD1 linearization - R: GCTCCTGCAACTCCTGTCTATGGTCTGTAAC; SEQ ID NO.89.
[0257] Using strain YL06 as the starting strain, transform the linearized integration fragment into YL06 to obtain strain ATCC MYA - 2613ΔKu70 - intE1:(HPD - HPT - TC) - intB1:(scARO4 K229L - ylARO7 G139S ) - intD1:(tHMGR - GGPPsa) - URA, named YL07.
[0258] The transformation method is the same as above.
[0259] Recover the selection marker to obtain strain ATCC ATCCMYA - 2613ΔKu70 - intE1:(HPD - HPT - TC) - intB1:(scARO4 K229L - ylARO7 G139S ) - intD1:(tHMGR - GGPPsa) - URA - , named YL08.
[0260] The method for recovering the selection marker is the same as above.
[0261] (2) To perform a second integration of these two genes, using strain YL08 as the starting strain, continue to integrate tHMGR and GGPPsa into the F30 locus.
[0262] To integrate the above two genes into strain YL08, it is necessary to construct plasmid PintF30 - tHMGR - GGPPsa, with the vector backbone of pintF30 - TEFin - tHMGR - xpr2 - EXP - GGPPsa - lip2 - 3HA - URA - 3HA.
[0263] The construction method is as follows:
[0264] Using plasmid pkana-Ku70 as the amplification template, amplify plasmid backbone p-intF30vec, and the amplification primers are intF30vec-F / R.
[0265] The primer sequences are as follows:
[0266] intF30vec-F: CACTCTCCTGTCAGGCATTTGAGAAGCACACGGTCAC; SEQ ID NO.90.
[0267] intF30vec-R: AGACAATGTGCGCAACGCAATTAATGTAAGTTAGCTCACTC; SEQ ID NO.91.
[0268] Using plasmid pintD1-tHMGR-GGPPsa as the amplification template, use primers TEFin-F5 / lip2URA-R5 to amplify the TEFin-tHMGR-xpr2-EXP-GGPPsa-lip2-3HA-URA-3HA fragment.
[0269] The primer sequences are as follows:
[0270] TEFin-F5: ACTAAGGCCagagaccgggttggcggc; SEQ ID NO.92.
[0271] lip2URA-R5: CTTCAACCGTGTAGCCGTAGGTCTCGTACTGC; SEQ ID NO.93.
[0272] Using the genome of Yarrowia lipolytica ATCC MYA-2613 as the template, use primers intF30up-F / intF30up-R to amplify the homologous arm intF30up (as shown in SEQ ID NO.94) to obtain the intF30up fragment.
[0273] The primer sequences are as follows:
[0274] intF30up-F: GCGTTGCGC ACATTGTCTTCACCTGTTCGGCTCATGAG ; SEQ ID NO.95.
[0275] intF30up-R: cccggtctct GGCCTTAGTTTCGTCTTGACTCGGC ; SEQ ID NO.96.
[0276] Using the genome of Yarrowia lipolytica ATCC MYA-2613 as a template, the homologous arm intF30down (shown in SEQ ID NO.97) was amplified using the primers intF30down-F / intF30down-R to obtain the intF30down fragment.
[0277] The primer sequences are as follows:
[0278] intF30down-F: CCTACGGCTAC ACGGTTGAAGCAAAGCTTTAGTGTGTTAGC ; SEQ ID NO.98.
[0279] intF30down-R: CTCAAATGCCTG ACAGGAGAGTGACAAGCCAACTGTGG ; SEQ ID NO.99.
[0280] The gene amplification system and gene amplification program are the same as above.
[0281] Add 3 μL of p-intF30vec, 3 μL of TEFin-tHMGR-xpr2-EXP-GGPPsa-lip2-3HA-URA-3HA fragment, 2 μL of intF30up fragment, 2 μL of intF30down fragment, and 10 μl of Gibson ligase into a PCR tube. The ligation temperature is 50 °C and the ligation time is 15 min. The total system is 20 μL. The transformation method is the same as above. After culturing at 37 °C for 1 h, plate it onto an LB plate (containing 50 μg / mL kanamycin).
[0282] The primers for colony PCR amplification and DNA sequencing are tHMGR-F / GGPPsa-R. If a band with a size of 4011 bp can be PCR amplified, it is correct.
[0283] Select a correct single colony, name it Escherichia coli EC006, name the plasmid PintF30-tHMGR-GGPPsa, after amplification, perform plasmid extraction to obtain the PintF30-tHMGR-GGPPsa plasmid.
[0284] Using the PintF30-tHMGR-GGPPsa plasmid as a template and intF30 linearization-F / R as primers, amplify the linearized integration fragment intF30up-TEFin-tHMGR-xpr2-EXP-GGPPsa-lip2-3HA-URA-3HA-intF30down.
[0285] The primer sequences are as follows:
[0286] intF30 Linearization - F: GCCAAGTCTAGACCAACGGTCCATGAC; SEQ ID NO.100.
[0287] intF30 Linearization - R: CGTCCTTGAAGTCGACGTACACATCCTG; SEQ ID NO.101.
[0288] Using strain YL08 as the starting strain, the linearized integration fragment was transformed into YL08 to obtain strain ATCC MYA - 2613ΔKu70 - intE1:(HPD - HPT - TC)-intB1:(scARO4 K229L -ylARO7 G139S )-intD1:(tHMGR - GGPPsa)-intF30:(tHMGR - GGPPsa)-URA, named YL09.
[0289] The transformation method was the same as above.
[0290] The selection marker was recovered to obtain strain ATCC ATCCMYA - 2613ΔKu70 - intE1:(HPD - HPT - TC)-intB1:(scARO4 K229L -ylARO7 G139S )-intD1:(tHMGR - GGPPsa)-intF30:(tHMGR - GGPPsa)-URA - , named YL10.
[0291] The method for recovering the selection marker was the same as above.
[0292] Strains YL07 and YL09 were fermented in SC medium for 144 h respectively, and δ - tocotrienol was measured. The results showed that for strain YL07 fermented for 144 h, OD600 was 19.26 and δ - tocotrienol was 1.445 mg / L; for strain YL09 fermented for 144 h, OD600 was 18.32 and the yield of δ - tocotrienol was 1.840 mg / L.
[0293] 5) Introduction of the isopentenol pathway
[0294] Based on strain YL10, the gene encoding choline kinase and the gene encoding isopentenyl phosphate kinase were introduced.
[0295] The gene encoding choline kinase is the codon-optimized gene CK encoding choline kinase from Saccharomyces cerevisiae BY4741 (as shown in SEQ ID NO.102).
[0296] The gene encoding isopentenyl pyrophosphate kinase is the codon-optimized gene IPK encoding isopentenyl pyrophosphate kinase from Arabidopsis thaliana (as shown in SEQ ID NO.103).
[0297] To integrate the above two genes into strain YL10, plasmid pintF2-CK-IPK needs to be constructed, and the vector backbone is pintF2-TEFin-CK-xpr2-EXP-IPK-lip2-3HA-URA-3HA.
[0298] The construction method is as follows:
[0299] Using plasmid PintF30-tHMGR-GGPPsa as the amplification template, amplify the plasmid backbone p-intF2vec, and the amplification primers are intF2vec-F / R.
[0300] The primer sequences are as follows:
[0301] intF2vec-F: CCAAACCAAACCCAGGCATTTGAGAAGCACACGGTCAC; SEQ ID NO.104.
[0302] intF2vec-R: GAGGAGAAGTGGCGCAACGCAATTAATGTAAGTTAGCTCACTCA; SEQ ID NO.105.
[0303] Using the pintE1-HPD-HPT plasmid as the amplification template, amplify the TEFin promoter (as shown in SEQ ID NO.22) using primers TEFin-F5 / TEFin-R5 to obtain the TEFin promoter fragment 5.
[0304] The primer sequences are as follows:
[0305] TEFin-F5: GATCTGGGGTT CAATTCACTCACTCTCCCGACTATCC ; SEQ ID NO.106.
[0306] TEFin-R5: GACTCTTGCAC ctgcggttagtactgcaaaaagtgctgg ; SEQ ID NO.107.
[0307] Using the pintE1-HPD-HPT plasmid as the amplification template, the xpr2-EXP was amplified with the primers xprEXP-F3 / xprEXP-R3 to obtain the xpr2-EXP fragment 3.
[0308] The primer sequences are as follows:
[0309] xprEXP-F3: CCTGTAAGATCCAACTACGGAACTTGTGTTGATGTCTTTGC; SEQ ID NO.108.
[0310] xprEXP-R3: GATGTTCAGTTCCATTGCTGTAGATATGTCTTGTGTGTAAGGGGGT; SEQ ID NO.109.
[0311] Using the primers lip2URA-F2 / lip2URA-R2 to amplify the lip2 terminator and 3HA-URA-3HA, the lip2-3HA-URA-3HA fragment 2 was obtained.
[0312] The primer sequences are as follows:
[0313] lip2URA-F2: CATCCGATTCTCCAAGTAA gctatttatcactctttacaacttctacctcaactatc ; SEQ ID NO.110.
[0314] lip2URA-R2: CTATGGGATG GTAGCCGTAGGTCTCGTACTGCTTGAC ; SEQ ID NO.111.
[0315] Using the Yarrowia lipolytica ATCC MYA-2613 genome as the template, the homologous arm intF2up (shown in SEQ ID NO.112) was amplified with the primers intF2up-F / intF2up-R to obtain the intF2up fragment.
[0316] The primer sequences are as follows:
[0317] intF2up-F: CGTTGCGC CACTTCTCCTCAGCTCACGTGAATCACAC ; SEQ ID NO.113.
[0318] intF2up-R: GTGAGTGAATTG AACCCCAGATCCAAGTCCACACC ; SEQ ID NO.114.
[0319] Using the genome of Yarrowia lipolytica ATCC MYA-2613 as a template, the homologous arm intF2down (shown in SEQ ID NO.115) was amplified using the primers intF2down-F / intF2down-R to obtain the intF2down fragment.
[0320] The primer sequences are as follows:
[0321] intF2down-F: CCTACGGCTAC CATCCCATAGTGTTGAAGGTAATACCCGGTAG ; SEQ ID NO.116.
[0322] intF2down-R: TCAAATGCCTG GGTTTGGTTTGGTTTGATTTGGTGTGCCA ; SEQ ID NO.117.
[0323] Using the CK gene (shown in SEQ ID NO.102) synthesized by BGI as a template, the CK gene was amplified using the primers CK-F / CK-R to obtain the CK gene fragment.
[0324] The primer sequences are as follows:
[0325] CK-F: ctaaccgcagGTGCAAGAGTCTCGACCCGGCT; SEQ ID NO.118.
[0326] CK-R: GTTCCGTAGTTGGATC TTACAGGTAAGAGGTGTCCAGGAACTTG ; SEQ ID NO.119.
[0327] Using the IPK gene (shown in SEQ ID NO.103) synthesized by BGI as a template, the IPK gene was amplified using the primers IPK-F / IPK-R to obtain the IPK gene fragment.
[0328] The primer sequences are as follows:
[0329] IPK-F: TCTACAGCA ATGGAACTGAACATCTCTGAGTCTCG ; SEQ ID NO.120.
[0330] IPK-R: tagc TTACTTGGAGAATCGGATGATGGTGCC ; SEQ ID NO.121.
[0331] The gene amplification system and gene amplification program are the same as above.
[0332] Add 2 μL of p-intF2vec, 1 μL of intF2up fragment, 1 μL of intF2down fragment, 1 μL of TEFin promoter fragment 5, 1 μL of xpr2-EXP fragment 3, 2 μL of lip2-3HA-URA-3HA fragment 2, 1 μL of CK gene fragment, 1 μL of IPK gene fragment and 10 μl of Gibson ligase into a PCR tube. The ligation temperature is 50 °C and the ligation time is 15 min. The total system is 20 μL. The transformation method is the same as above. After culturing at 37 °C for 1 h, plate it onto an LB plate (containing 50 μg / mL kanamycin).
[0333] The primers for colony PCR amplification and DNA sequencing are CK-F / IPK-R. If a band with a size of 4263 bp can be amplified by PCR, it is correct.
[0334] Select a correct single colony, name it Escherichia coli EC007, name the plasmid pintF2-CK-IPK. After amplification, extract the plasmid to obtain the pintF2-CK-IPK plasmid.
[0335] Using the pintF2-CK-IPK plasmid as a template and intF2 linearization-F / R as primers, amplify the linearized integration fragment intF2up-TEFin-CK-xpr2-EXP-IPK-lip2-3HA-URA-3HA-intF2down.
[0336] The primer sequences are as follows:
[0337] intF2 linearization-F: CACTTCTCCTCAGCTCACGTGAATCACAC; SEQ ID NO.122.
[0338] intF2 linearization-R: GGTTTGGTTTGGTTTGATTTGGTGTGCCA; SEQ ID NO.123.
[0339] Using strain YL10 as the starting strain, transform the linearized integration fragment into YL10 to obtain strain ATCC MYA-2613ΔKu70-intE1:(HPD-HPT-TC)-intB1:(scARO4 K229L -ylARO7 G139S )-intD1:(tHMGR-GGPPsa)-intF30:(tHMGR-GGPPsa)-intF2:(CK-IPK)-URA, named YL11.
[0340] The transformation method is the same as above.
[0341] The strain ATCC MYA - 2613ΔKu70 - intE1:(HPD - HPT - TC)-intB1:(scARO4 K229L -ylARO7 G139S )-intD1:(tHMGR - GGPPsa)-intF30:(tHMGR - GGPPsa)-intF2:(CK - IPK)-URA - was recovered and screened for the marker, named YL12.
[0342] The method for recovering and screening the marker was the same as above.
[0343] Strains YL09 and YL11 were fermented in SC medium for 144 h respectively, and δ - tocotrienol was determined. The results showed that: for strain YL09 fermented for 144 h, OD600 was 18.92 and δ - tocotrienol was 1.869 mg / L; for strain YL11 fermented for 144 h, OD600 was 17.26 and the yield of δ - tocotrienol was 2.707 mg / L.
[0344] The above results indicated that by expressing the two genes CK and IPK, the yield of δ - tocotrienol could be significantly increased.
[0345] Using strain YL12 as the starting strain, in order to further increase the yield of tocotrienol, the two genes CK and IPK were integrated at the multi - copy site YLT1.
[0346] To integrate CK and IPK at the YLT1 site, plasmid PYLT1 - CK - IPK needed to be constructed, and the vector backbone was PYLT1 - TEFin - CK - xpr2 - EXP - IPK - lip2 - 3HA - 11bpURA - 3HA. Compared with 3HA - URA - 3HA, the original promoter of the URA expression cassette in 3HA - 11bpURA - 3HA was truncated to a 11 - bp promoter, and 3HA - 11bpURA - 3HA (shown in SEQ ID NO.124) was synthesized by BGI.
[0347] The construction method was as follows:
[0348] Using plasmid pintF2 - CK - IPK as the amplification template, the plasmid backbone p - YLT1vec was amplified, and the amplification primers were YLT1vec - F / R.
[0349] The primer sequences were as follows:
[0350] YLT1vec - F: agagtcgacaaaggccctccaattgcttctaacatcgcgtg; SEQ ID NO.125.
[0351] YLT1vec-R: GAGTGAGTGAATTGCACTGAGGGCTTTGTGAGGAGGTAACG; SEQ ID NO.126.
[0352] Using plasmid pintF2-CK-IPK as the amplification template, the amplified fragment TEFin-CK-xpr2-EXP-IPK-lip2 was amplified with the amplification primers TEFin-FA / lip2-RA.
[0353] The primer sequences are as follows:
[0354] TEFin-FA: CCCTCAGTG CAATTCACTCACTCTCCCGACTATCCAACAAC ; SEQ ID NO.127.
[0355] lip2-RA: cgtcgttttacaaccatttgccattcgtaacgctggtag; SEQ ID NO.128.
[0356] Using 3HA-11bpURA-3HA synthesized by BGI (as shown in SEQ ID NO.124) as the template, 3HA-11bpURA-3HA was amplified with primers 11bpURA-F / 11bpURA-R to obtain the 3HA-11bpURA-3HA fragment.
[0357] The primer sequences are as follows:
[0358] 11bpURA-F: ggcaaatg gttgtaaaacgacggccagtcg ; SEQ ID NO.129.
[0359] 11bpURA-R: c GTAGCCGTAGGTCTCGTACTGCTTGAC ; SEQ ID NO.130.
[0360] Using the genome of Yarrowia lipolytica ATCC MYA-2613 as the template, the homologous arm YLT1up (as shown in SEQ ID NO.131) was amplified with primers YLT1up-F / YLT1up-R to obtain the YLT1up fragment.
[0361] The primer sequences are as follows:
[0362] YLT1up-F: gtgtaacaatg CCTAGGCATGTGTAACACTCGCTCTGG ; SEQ ID NO.132.
[0363] YLT1up-R: GAGTGAGTGAATTG CACTGAGGGCTTTGTGAGGAGGTAACG ; SEQ ID NO.133.
[0364] Using the genome of Yarrowia lipolytica ATCC MYA-2613 as a template, the homologous arm YLT1down (shown in SEQ ID NO.134) was amplified using primers YLT1down-F / YLT1down-R to obtain the YLT1down fragment.
[0365] The primer sequences are as follows:
[0366] YLT1down-F: CAGTACGAGACCTACGGCTAC gcggccgctgtcgggaa ; SEQ ID NO.135.
[0367] YLT1down-R: ggag ggcctttgtcgactctatctagcaaag ; SEQ ID NO.136.
[0368] The gene amplification system and gene amplification program are the same as above.
[0369] Add 2 μL of p-YLT1vec, 2 μL of YLT1up fragment, 2 μL of YLT1down fragment, 2 μL of TEFin-CK-xpr2-EXP-IPK-lip2 fragment, 2 μL of 3HA-11bpURA-3HA fragment and 10 μl of Gibson ligase into a PCR tube. The ligation temperature is 50 °C and the ligation time is 15 min. The total system is 20 μL. The transformation method is the same as above. After culturing at 37 °C for 1 h, plate it onto an LB plate (containing 50 μg / mL kanamycin).
[0370] The primers for colony PCR amplification and DNA sequencing are CK-F / IPK-R. If a band of 4263 bp can be PCR amplified, it is correct.
[0371] Select a correct single colony, name it Escherichia coli EC008, name the plasmid pYLT1-CK-IPK. After expansion, plasmid extraction was carried out to obtain the pYLT1-CK-IPK plasmid.
[0372] Using the pYLT1-CK-IPK plasmid as a template, and using YLT1 linearization-F / R as primers, the linearized integration fragment YLT1up-TEFin-CK-xpr2-EXP-IPK-lip2-3HA-11bpURA-3HA-YLT1down was amplified.
[0373] The primer sequences are as follows:
[0374] YLT1 linearization-F: CCTAGGCATGTGTAACACTCGCTCTGG; SEQ ID NO.137.
[0375] YLT1 linearization - R: ggcctttgtcgactctatctagcaaag; SEQ ID NO.138.
[0376] Using strain YL12 as the starting strain, the linearized integration fragment was transformed into YL12 to obtain strain ATCC MYA - 2613ΔKu70 - intE1:(HPD - HPT - TC)-intB1:(scARO4 K229L -ylARO7 G139S )-intD1:(tHMGR - GGPPsa)-intF30:(tHMGR - GGPPsa)-intF2:(CK - IPK)-YLT1:(CK - IPK)-URA, named YL13.
[0377] The transformation method was the same as above.
[0378] The selection marker was recovered to obtain strain ATCC MYA - 2613ΔKu70 - intE1:(HPD - HPT - TC)-intB1:(scARO4 K229L -ylARO7 G139S )-intD1:(tHMGR - GGPPsa)-intF30:(tHMGR - GGPPsa)-intF2:(CK - IPK)- YLT1:(CK - IPK)-URA - , named YL14.
[0379] Strain YL13 was fermented in SC medium for 144 h, and δ - tocotrienol was measured. The results showed that after 144 h of fermentation of strain YL13, the OD600 was 16.73 and the yield of δ - tocotrienol was 16.29 mg / L.
[0380] 6) Protein fusion of HPD and HPT
[0381] Using strain YL14 as the starting strain, in order to further increase the production of δ-tocotrienol, the integration of the HPD-HPT (RH) fusion protein was carried out at the YLT2 locus. The HPD-HPT (RH) fusion protein is a fusion of the gene HPD encoding 4-hydroxyphenylpyruvate dioxygenase (the gene encoding 4-hydroxyphenylpyruvate dioxygenase is the codon-optimized HPD gene encoding 4-hydroxyphenylpyruvate dioxygenase derived from Pseudomonas putida KT2440) and the gene HPT encoding homogentisate phytyltransferase (the gene encoding homogentisate phytyltransferase is the codon-optimized HPT gene encoding homogentisate phytyltransferase derived from Synechocystis sp. PCC 6803) using a linker. The HPD-HPT (RH) gene sequence is shown in SEQ ID NO.139.
[0382] In SEQ ID NO.139, 1-1074bp is the HPD gene sequence, 1075-1104bp is the linker sequence, and 1105-2031bp is the HPT gene sequence.
[0383] Using plasmid pYLT1-CK-IPK as the amplification template, the plasmid backbone p-YLT2vec was amplified, and the amplification primers were YLT2vec-F / R.
[0384] The primer sequences are as follows:
[0385] YLT2vec-F: cttcaatactccaattgcttctaacatcgcgtg; SEQ ID NO.140.
[0386] YLT2vec-R: CCGGGTATTACCTTCAACAcattgttacaccatatcaaatcgcacgc; SEQ IDNO.141.
[0387] Using plasmid pYLT1-CK-IPK as the amplification template, the TEFin promoter (shown in SEQ ID NO.22) was amplified using the primers TEFin-F6 / TEFin-R6 to obtain the TEFin promoter fragment 6.
[0388] The primer sequences are as follows:
[0389] TEFin-F6: CTCTTTTCTGGCAATTCACTCACTCTCCCGACTATCC; SEQ ID NO.142.
[0390] TEFin-R6: tgtcggc ctgcggttaGTACTGCAAAAAGTGCTG; SEQ ID NO.143.
[0391] Using plasmid pYLT1-CK-IPK as the amplification template, amplify lip2-3HA-11bpURA-3HA with primers 11bpURA-F1 / 11bpURA-R1 to obtain lip2-3HA-11bpURA-3HA fragment 1.
[0392] The primer sequences are as follows:
[0393] 11bpURA-F1: ccatcttctaa gctatttatcactctttacaacttctacctcaactatc ; SEQ IDNO.144.
[0394] 11bpURA-R1: gctcattca GTAGCCGTAGGTCTCGTACTGCTTGAC ; SEQ ID NO.145.
[0395] Using the genome of Yarrowia lipolytica ATCC MYA-2613 as the template, amplify the homologous arm YLT2up (shown in SEQ ID NO.146) with primers YLT2up-F / YLT2up-R to obtain the YLT2up fragment.
[0396] The primer sequences are as follows:
[0397] YLT2up-F: caatg TGTTGAAGGTAATACCCGGTGGGGTA ; SEQ ID NO.147.
[0398] YLT2up-R: GAGTGAATTG CCAGAAAAGAGATTCTAGATCAGTGGATAAAACTATCTACAGG ; SEQ IDNO.148.
[0399] Using the genome of Yarrowia lipolytica ATCC MYA-2613 as the template, amplify the homologous arm YLT2down (shown in SEQ ID NO.149) with primers YLT2down-F / YLT2down-R to obtain the YLT2down fragment.
[0400] The primer sequences are as follows:
[0401] YLT2down-F: CCTACGGCTACtgaatgagcaagcacacaccaggg; SEQ ID NO.150.
[0402] YLT2down-R: gaagcaattggag tattgaagatcataagtattattgatgtgatatag ; SEQ IDNO.151.
[0403] Using the HPD-HPT (RH) gene sequence synthesized by BGI (shown in SEQ ID NO.139) as a template, HPD-HPT(RH) was amplified using primers HPD-HPT(RH)-F / HPD-HPT(RH)-R to obtain the HPD-HPT(RH) fragment.
[0404] The primer sequences are as follows:
[0405] HPD-HPT(RH)-F: gtactaaccgcaggccgacatcttcgagaaccccat; SEQ ID NO.152.
[0406] HPD-HPT(RH): agtgataaatagc ttagaagatggtgttagaaaaattaggcagccac ; SEQ IDNO.153.
[0407] The gene amplification system and gene amplification program are the same as above.
[0408] Add 2 μL of p-YLT2vec, 1 μL of YLT1up fragment, 1 μL of YLT1down fragment, 2 μL of TEFin promoter fragment 6, 2 μL of HPD-HPT(RH) fragment, 2 μL of lip2-3HA-11bpURA-3HA fragment 1 and 10 μl of Gibson ligase into a PCR tube. The ligation temperature is 50 °C and the ligation time is 15 min. The total system is 20 μL. The transformation method is the same as above. After culturing at 37 °C for 1 h, plate it onto an LB plate (containing 50 μg / mL kanamycin).
[0409] The primers for colony PCR amplification and DNA sequencing are TEFin-F6 / 11bpURA-R2. If a band of 5068 bp can be amplified by PCR, it is correct.
[0410] Select a correct single colony, name it Escherichia coli EC009, name the plasmid pYLT2-HPD-HPT(RH), after amplification, perform plasmid extraction to obtain the pYLT2-HPD-HPT(RH) plasmid.
[0411] Using the pYLT2-HPD-HPT(RH) plasmid as a template and using YLT2 linearization-F / R as primers, amplify the linearized integration fragment YLT2up-TEFin-HPD-HPT(RH)-lip2-3HA-11bpURA-3HA-YLT2down.
[0412] The primer sequences are as follows:
[0413] YLT2 linearization - F: caatgTGTTGAAGGTAATACCCGGTGGGGTA; SEQ ID NO.154.
[0414] YLT2 linearization - R: tattgaagatcataagtattattgatgtgatatag; SEQ ID NO.155.
[0415] Using strain YL14 as the starting strain, the linearized integration fragment was transformed into YL14 to obtain strain ATCC MYA - 2613ΔKu70 - intE1:(HPD - HPT - TC)-intB1:(scARO4 K229L -ylARO7 G139S )-intD1:(tHMGR - GGPPsa)-intF30:(tHMGR - GGPPsa)-intF2:(CK - IPK)-YLT1:(CK - IPK)- YLT2:(HPD - HPT(RH))-URA, named YL15.
[0416] The transformation method was the same as above.
[0417] The selection marker was recovered to obtain strain ATCC ATCCMYA - 2613ΔKu70 - intE1:(HPD - HPT - TC)-intB1:( scARO4 K229L -ylARO7 G139S )-intD1:(tHMGR - GGPPsa)-intF30:(tHMGR - GGPPsa)-intF2:(CK - IPK)-YLT1:(CK - IPK)- YLT2:(HPD - HPT(RH))-URA - , named YL16.
[0418] The method for recovering the selection marker was the same as above.
[0419] Strain YL15 was fermented in SC medium for 144 h, and δ - tocotrienol was measured. The results showed that when strain YL15 was fermented for 144 h, the OD600 was 17.32, and the yield of δ - tocotrienol was 32.58 mg / L.
[0420] 7) Truncating the plant - derived signal peptide of TC and complementing the leucine deficiency
[0421] Using strain YL16 as the starting strain, in order to further increase the production of δ-tocotrienol, 46AATC and LEU2 were integrated at the multi-copy site 26s. For the gene encoding tocopherol cyclase, the gene TC encoding tocopherol cyclase derived from Arabidopsis thaliana and codon-optimized was selected, and the signal peptide was truncated by removing 46 amino acids after the N-terminal start codon ATG to obtain 46AATC (as shown in SEQ ID NO.156). LEU2 is the gene encoding leucine synthesis (as shown in SEQ ID NO.157), derived from Yarrowia lipolytica CLIB 122 / E 150.
[0422] Using plasmid pYLT1-CK-IPK as the amplification template, the plasmid backbone p-26svec was amplified, and the amplification primers were 26svec-F / R.
[0423] The primer sequences are as follows:
[0424] 26svec-F: cataccgaagCAGGCATTTGAGAAGCACACGGTCAC; SEQ ID NO.158.
[0425] 26svec-R: -cttaggatcgaGCGCAACGCAATTAATGTAAGTTAGCTCACTC; SEQ ID NO.159.
[0426] Using plasmid pYLT1-CK-IPK as the amplification template, the TEFin promoter (as shown in SEQ ID NO.22) was amplified using primers TEFin-F7 / TEFin-R7 to obtain the TEFin promoter fragment 7.
[0427] The primer sequences are:
[0428] TEFin-F7: ta CAATTCACTCACTCTCCCGACTATCCAACAAC ; SEQ ID NO.160.
[0429] TEFin-R7: gatagaggc ctgcggttagtactgcaaaaagtgc ; SEQ ID NO.161.
[0430] Using plasmid pYLT1-CK-IPK as the amplification template, xpr2-EXP was amplified using primers xpr2-EXP-F4 / xpr2-EXP-R4 to obtain the xpr2-EXP fragment 4.
[0431] The primer sequences are:
[0432] xpr2-EXP-F4: ccggcctgtaaGATCCAACTACGGAACTTGTGTTGATGTCTTTG; SEQ ID NO.162.
[0433] xpr2-EXP-R4: gtttcgggttccatTGCTGTAGATATGTCTTGTGTGTAAGGGGG; SEQ ID NO.163.
[0434] Using plasmid pYLT1-CK-IPK as the amplification template, lip2-3HA-11bpURA-3HA was amplified with primers 11bpURA-F2 / 11bpURA-R2 to obtain the lip2-3HA-11bpURA-3HA fragment 2.
[0435] The primer sequences are as follows:
[0436] 11bpURA-F2: gctgctcaagaaggagtaa gctatttatcactctttacaacttctacctcaactatc ; SEQ ID NO.164.
[0437] 11bpURA-R2: gatgacgaggc GTAGCCGTAGGTCTCGTACTGCTTGAC ; SEQ ID NO.165.
[0438] Using the genome of Yarrowia lipolytica ATCC MYA-2613 as the template, the homologous arm 26sup (shown as SEQ ID NO.166) was amplified with primers 26sup-F / 26sup-R to obtain the 26sup fragment.
[0439] The primer sequences are as follows:
[0440] 26sup-F: GCGTTGCGC tcgatcctaaggggtggcataactgtc ; SEQ ID NO.167.
[0441] 26sup-R: GTCGGGAGAGTGAGTGAATTG tatatgatatggtgtcgactggctaccttaagagagtc ; SEQ ID NO.168.
[0442] Using the genome of Yarrowia lipolytica ATCC MYA-2613 as the template, the homologous arm 26sdown (shown as SEQ ID NO.169) was amplified with primers 26sdown-F / 26sdown-R to obtain the 26sdown fragment.
[0443] The primer sequences are as follows:
[0444] 26sdown-F: CTACGGCTAC gcctcgtcatctaattagtgacgcg; SEQ ID NO.170.
[0445] 26sdown-R: CTCAAATGCCTG cttcggtatgataggaagagccgaca ; SEQ ID NO.171.
[0446] Using the 46AATC synthesized by BGI (shown as SEQ ID NO.156) as a template, the 46AATC was amplified using primers 46AATC-F / 46AATC-R to obtain the 46AATC fragment.
[0447] The primer sequences are as follows:
[0448] 46AATC-F: tactaaccgcag gcctctatctctacccccaactctgaaac ; SEQ ID NO.172.
[0449] 46AATC-R: GTAGTTGGATC ttacaggccgggaggtttgaagaaagg ; SEQ ID NO.173.
[0450] Using the LEU2 gene synthesized by BGI (shown as SEQ ID NO.157) as a template, the LEU2 gene was amplified using primers LEU2-F / LEU2-R to obtain the LEU2 gene fragment.
[0451] The primer sequences are as follows:
[0452] LEU2-F: TCTACAGCAatggaacccgaaactaagaagaccaag; SEQ ID NO.174.
[0453] LEU2-R: tagc ttactccttcttgagcagctccttgacc ; SEQ ID NO.175.
[0454] The gene amplification system and gene amplification program are the same as above.
[0455] Add 1 μL of p-26svec, 1 μL of 26sup fragment, 1 μL of 26sdown fragment, 1 μL of TEFin promoter fragment 7, 2 μL of 46AATC fragment, 1 μL of xpr2-EXP fragment 4, 1 μL of LEU2 gene fragment, 2 μL of lip2-3HA-11bpURA-3HA fragment 2 and 10 μl of Gibson ligase into the PCR tube. The ligation temperature is 50 °C and the ligation time is 15 min. The total system is 20 μL. The transformation method is the same as above. After culturing at 37 °C for 1 h, plate it onto the LB plate (containing 50 μg / mL kanamycin).
[0456] The primers for colony PCR amplification and DNA sequencing are 46AATC-F / LEU2-R. If a band of 3981bp can be amplified by PCR, it is correct.
[0457] Select a correct single colony, name it Escherichia coli EC010, name the plasmid p26s-46AATC-LEU2. After amplification, plasmid extraction was performed to obtain the p26s-46AATC-LEU2 plasmid.
[0458] Using the p26s-46AATC-LEU2 plasmid as a template and 26s linearization-F / R as primers, the linearized integration fragment 26sup-TEFin-46AATC-xpr2-EXP-LEU2-lip2-3HA-11bpURA-3HA-26sdown was amplified.
[0459] The primer sequences are as follows:
[0460] 26s linearization-F: tcgatcctaaggggtggcataactgtc; SEQ ID NO.176.
[0461] 26s linearization-R: cttcggtatgataggaagagccgaca; SEQ ID NO.177.
[0462] Using strain YL16 as the starting strain, the linearized integration fragment was transformed into YL16 to obtain strain ATCC MYA-2613ΔKu70-intE1:(HPD-HPT-TC)-intB1:(scARO4 K229L -ylARO7 G139S )-intD1:(tHMGR-GGPPsa)-intF30:(tHMGR-GGPPsa)-intF2:(CK-IPK)-YLT1:(CK-IPK)-YLT2:(HPD-HPT(RH))-26s:(46AATC-LEU2)-URA, named YL17.
[0463] The transformation method is the same as above.
[0464] Strain YL17 was fermented in SC medium for 144h, and δ-tocotrienol was measured. The results showed that after 144h of fermentation of strain YL17, the OD600 was 15.49 and the δ-tocotrienol yield was 50.94mg / L.
[0465] Example 2 Scale-up optimization in a 2L fermenter
[0466] The gene integration strain YL17 was cultured in a 2L fermenter for scale-up, and the fermentation method is as follows:
[0467] 1) Cultivation of the seed culture:
[0468] (1) Streak on the SC solid medium plate and incubate at 30 °C for 36 h.
[0469] (2) Add 5 ml of SC liquid medium into a 50 ml sterile test tube. Use a 200 μl yellow pipette tip to scrape the bacterial lawn from the plate and pipette it into the liquid medium to mix well. Incubate at 30 °C for 12 h.
[0470] (3) Add 50 ml of SC liquid medium into a 250 ml baffled shake flask, add 1 ml of the seed culture from the test tube, and incubate for 24 h.
[0471] 2) Scale-up culture in a 2 L fermenter:
[0472] The initial fermentation volume is 1 L, which contains 3.5 g / L Yeast Nitrogen base (YNB), 1.5 g / L yeast extract, 13 g / L ammonium sulfate, 80 g / L glucose. The OD600 in the fermenter after inoculating the seed culture is 0.8.
[0473] During the fermentation process, the rotation speed is 600 rpm, the aeration rate is 1.5 vvm, and the pH is set to 5.00 (connect a 5 mol / L potassium hydroxide alkali feed bottle to the alkali addition pump).
[0474] Starting from 0 h, sample every 12 h to measure the glucose concentration. When the glucose concentration in the initial fermentation medium is consumed to 15 g / L, sugar feeding starts, and the glucose during feeding is controlled at 5 - 15 g / L. Take 10 ml of the fermentation broth and put it into a 15 ml centrifuge tube, centrifuge at 12000 rpm for 10 min, and take the upper aqueous phase and dilute it 10 times for glucose detection. The glucose detection method is as follows: the eluent is 5 mM dilute sulfuric acid, the detection equipment is a Thermo Fisher liquid phase, the column is an organic acid column from BIO-RAD, the elution rate is 0.6 mL / min, and the column temperature is 60 °C.
[0475] After 48 h of fermentation, add 100 ml of dodecane containing 0.5 g of the antioxidant butylated hydroxytoluene (BHT). Starting from 96 h, sample every 12 h for the detection of δ-tocotrienol. Take 10 ml of the fermentation broth and put it into a 15 ml centrifuge tube, centrifuge at 12000 rpm for 10 min, and take the upper organic phase and dilute it 100 times for the detection of δ-tocotrienol.
[0476] The formula of the sugar feeding medium is: 3.5 g / L Yeast Nitrogen base (YNB), 1.5 g / L yeast extract, 80 g / L ammonium sulfate, 600 g / L glucose.
[0477] Taking the preparation of 1 L of sugar-fed medium as an example, weigh 3.5 g of Yeast Nitrogen base (YNB) and 1.5 g of yeast powder, add deionized water, and make up the volume to 200 ml for separate sterilization; weigh 80 g of ammonium sulfate, add deionized water, and make up the volume to 200 ml for separate sterilization; weigh 600 g of glucose, add deionized water, and make up the volume to 600 ml for separate sterilization. After sterilization, mix the above three separately sterilized liquids together to obtain 1 L of sugar-fed medium.
[0478] The δ-tocotrienol production is shown in Table 1.
[0479] Table 1
[0480]
[0481] The results in Table 1 show that after 240 h of fermentation by strain YL17, the δ-tocotrienol production is 616.45 mg / L.
[0482] The above description of the disclosed embodiments enables those skilled in the art to implement or use the present invention. Various modifications to these embodiments will be obvious to those skilled in the art, and the general principles defined herein can be implemented in other embodiments without departing from the spirit or scope of the present invention. Therefore, the present invention will not be limited to the embodiments shown herein, but rather to the widest scope consistent with the principles and novel features disclosed herein.
Claims
1. A genetically engineered bacterium with high yield of δ-tocotrienol, characterized in that: Using Yarrowia lipolytica ATCC MYA-2613 as the starting strain, the ku70 gene is knocked out; Expressing the gene encoding 4-hydroxyphenylpyruvate dioxygenase, the gene encoding homogentisate phytyltransferase, and the gene encoding tocopherol cyclase; Strengthening the shikimic acid pathway: expressing the gene encoding 3-deoxy-D-arabinoheptulosonate-7-phosphate synthase and the gene encoding shikimate mutase; Strengthening the mevalonate pathway: first expressing the gene encoding hydroxymethylglutaryl-CoA reductase and the gene encoding geranylgeranyl pyrophosphate synthase; on this basis, integrating the gene encoding hydroxymethylglutaryl-CoA reductase and the gene encoding geranylgeranyl pyrophosphate synthase into the F30 locus; Introducing the isopentenol pathway: first expressing the gene encoding choline kinase and the gene encoding isopentenyl phosphate kinase; on this basis, integrating the gene encoding choline kinase and the gene encoding isopentenyl phosphate kinase into the YLT1 locus; Performing protein fusion of HPD and HPT: integrating the HPD-HPT fusion gene into the YLT2 locus; Truncating the signal peptide of the gene encoding tocopherol cyclase and complementing the leucine deficiency: integrating the gene encoding tocopherol cyclase with 46 amino acids truncated after the N-terminal start codon ATG and the gene encoding leucine synthesis into the 26s locus; The gene sequence of the gene encoding 4-hydroxyphenylpyruvate dioxygenase is as shown in SEQ ID NO.17; The gene sequence of the gene encoding homogentisate phytyltransferase is as shown in SEQ ID NO.18; The gene sequence of the gene encoding tocopherol cyclase is as shown in SEQ ID NO.19; The gene sequence of the gene encoding 3-deoxy-D-arabinoheptulosonate-7-phosphate synthase is as shown in SEQ ID NO.50; The gene sequence of the gene encoding shikimate mutase is as shown in SEQ ID NO.51; The gene sequence of the gene encoding hydroxymethylglutaryl-CoA reductase is as shown in SEQ ID NO.68; The gene sequence of the gene encoding geranylgeranyl pyrophosphate synthase is as shown in SEQ ID NO.69; The gene sequence of the gene encoding choline kinase is as shown in SEQ ID NO.102; The gene sequence of the gene encoding isopentenyl phosphate kinase is as shown in SEQ ID NO.103; The HPD-HPT fusion gene sequence is as shown in SEQ ID NO.139; The sequence of the gene encoding tocopherol cyclase with 46 amino acids truncated after the N-terminal start codon ATG is as shown in SEQ ID NO.156; The sequence of the gene encoding leucine synthesis is as shown in SEQ ID NO.
157.
2. The construction method of a genetically engineered bacterium with high yield of δ-tocotrienol according to claim 1, characterized in that, Including the following steps: Using Yarrowia lipolytica ATCC MYA-2613 as the starting strain, the ku70 gene is knocked out; Expressing the gene encoding 4-hydroxyphenylpyruvate dioxygenase, the gene encoding homogentisate phytyltransferase, and the gene encoding tocopherol cyclase; Enhance the shikimic acid pathway; enhance the mevalonic acid pathway; introduce the isopentenol pathway; perform protein fusion of HPD and HPT; truncate the signal peptide of the gene encoding tocopherol cyclase and complement the leucine deficiency.
3. Use of the genetically engineered bacterium for high-yield production of δ-tocotrienol as claimed in claim 1 in the production of δ-tocotrienol.
4. Use of the genetically engineered bacterium for high-yield production of δ-tocotrienol as claimed in claim 1 in increasing the yield of δ-tocotrienol.
5. A method for producing δ-tocotrienol, characterized in that, Fermentation is carried out using the genetically engineered bacterium as claimed in claim 1.
Citation Information
Patent Citations
Recombinant yarrowia lipolytica for producing beta-carotene as well as construction method and application thereof
CN115029257A
Yarrowia lipolytica engineering bacterium and application thereof
CN116426398A