Mutant of alanine dehydrogenase and application of mutant in production

By constructing mutants of Bacillus lysine alanine dehydrogenase and designing recombinant strains of E. coli, the problems of high cost, poor product quality and environmental pollution in the existing L-alanine production methods are solved, and efficient, low-cost and environmentally friendly L-alanine production is achieved.

CN120118871AActive Publication Date: 2025-06-10JIANGNAN UNIV
View PDF 5 Cites 0 Cited by

Patent Information

Application Number
CN202510277849.1
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-03-10
Publication Date
2025-06-10
Estimated Expiration
2045-03-10

AI Technical Summary

Technical Problem

The existing L-alanine production methods have problems of high costs, poor product quality and environmental pollution, and traditional methods rely on expensive raw materials and non-renewable resources.

Method used

By constructing mutants of Bacillus lysine alanine dehydrogenase, specifically E76R, E76R/D270E and E76R/D270E/A300K, combined with the design of the recombinant strain of E. coli, the catalytic efficiency of alanine dehydrogenase is optimized and L-alanine is produced by fermentation.

Benefits of technology

It realizes efficient production of L-alanine, reduces production costs, improves product purity and safety of fermentation process, and reduces dependence on non-renewable resources.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120118871A_ABST
    Figure CN120118871A_ABST
Patent Text Reader

Abstract

The invention discloses a mutant of alanine dehydrogenase and application of the mutant in production, and belongs to the technical field of bioengineering. Lactic dehydrogenase, formate dehydrogenase and alanine racemase are knocked out from escherichia coli, generation of most of by-products is blocked, alanine dehydrogenase from a lysinibacillus source and alanine efflux protein from escherichia coli are integrated at the genome level, and the escherichia coli is obtained. An alanine dehydrogenase mutant aldE76R / D270E / A300K is constructed by connecting a coding gene of glucose-6-phosphate dehydrogenase, phosphogluconate dehydratase and a KDPG aldolase gene in an overexpression ED pathway in series through a promoter, conversion of carbon flow to L-alanine is greatly enhanced, an efficient L-alanine production strain is constructed, and the strain is free of plasmids, free of resistance genes and free of induction. The accumulation amount of the L-alanine after the recombinant strain constructed by the invention is fermented in a 5L fermentation tank for 48 hours reaches 150.2 g / L.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to a mutant of alanine dehydrogenase and its application in production, belonging to the technical field of bioengineering. Background Art

[0002] L-alanine, a non-essential amino acid and one of the smallest chiral molecules, also known as L-α-aminopropionic acid, has the molecular formula CH 3 CH 2 (NH 2 )COOH, with a molecular weight of 89.09, a density of 1.432 g / cm 3 , a melting point of 297 °C, appearing as a colorless to white crystalline powder, soluble in water, slightly soluble in ethanol, insoluble in ether and acetone, odorless and non-toxic, having umami and sweetness, where the sweetness is 1.2 times that of sucrose.

[0003] L-alanine is widely used in the fields of daily chemicals, food, and medicine. In the field of daily chemicals, amino acid surfactants have the advantages of high biocompatibility, excellent compatibility, and no irritation to the skin, and are popular among many consumers in the market. L-alanine can be used as a raw material for synthesizing amino acid surfactants. In the food field, L-alanine is a flavor enhancer approved for use in China. Compared with other flavor enhancers, L-alanine does not contain sodium ions, is safer to consume, and has a significant flavor-enhancing effect on food, with obvious advantages; L-alanine also has umami, and adding it to fish sauce can play a role in increasing sweetness, enhancing freshness, and reducing fishy smell; in addition to umami, L-alanine also has sweetness. L-alanine can replace L-phenylalanine and aspartic acid to synthesize a new dipeptide sweetener, alitame, which is about 10 times sweeter than aspartame, and its sweet taste characteristics are similar to sucrose, without the aftertaste of bitterness or metal aftertaste commonly found in other high-potency sweeteners. In the medical field, L-alanine is the main raw material for synthesizing vitamin B 6 and aminopropanol.

[0004] The production methods of L-alanine mainly include chemical synthesis method, extraction method, enzyme conversion method and fermentation method. The propionic acid chlorination method is a common method for chemically synthesizing L-alanine. However, the production of L-alanine by the propionic acid chlorination method has high costs, poor quality of the synthesized product, and environmental pollution, and it has basically been phased out at present; the extraction method is to acid-hydrolyze or enzymatically hydrolyze substances with high L-alanine content such as corn protein, silk or gelatin, and then obtain L-alanine after separation and chiral resolution. This method has relatively high costs and is not suitable for large-scale and industrial production; the enzyme conversion method is divided into free whole cell method and immobilized cell method. The raw material of the enzyme conversion method is L-aspartic acid, and L-alanine is obtained after being catalyzed by microbial cells rich in L-aspartic acid-β-decarboxylase activity. L-aspartic acid can be efficiently prepared by immobilized Escherichia coli catalyzing fumaric acid. The enzyme conversion method is a commonly used production method in industry at present, but the raw material aspartic acid used is expensive, the production cost is relatively high, and aspartic acid is usually produced from fumarate by enzymatic catalysis using aspartate ammonia-lyase, and fumarate is mainly obtained from petroleum. Petroleum-based products have characteristics such as non-renewability, environmental unfriendliness, and price dependence; the raw material glucose used in the fermentation method is cheap, the production cost is low, the enantiomeric purity of the produced amino acid is relatively high, subsequent purification steps are reduced, and the fermentation process conditions are mild, which can prevent further degradation of the product, and has broad research prospects. Summary of the Invention

[0005] The present invention provides a mutant of alanine dehydrogenase. The alanine dehydrogenase is derived from Lysinibacillus sphaericus, the Genbank accession number of the wild-type enzyme is 48275818, it contains 372 amino acids, the amino acid sequence of the wild-type alanine dehydrogenase is shown in SEQ ID NO.1, and the nucleotide sequence is shown in SEQ ID NO.10.

[0006] SEQ ID NO.1:

[0007] MKIGIPKEIKNNENRVAMTPAGVVSLTHAGHERLAIETGGGIGSSFTDAEYVAAGAAYRCIGKEAWAQEMILKVKEPVASEYDYFYEGQILFTYLHLAPRAELTQALIDKKVVGIAYETVQLANGSLPLLTPMSEVAGKMATQIGAQYLEKNHGGKGILLGGVSGVHARKVTVIGGGIAGTNAAKIAVGMGADVTVIDLSPERLRQLEDMFGRDVQTLMSNPYNIAESVKHSDLVVGAVLIPGAKAPKLVSEEMIQSMQPGSVVVDIAIDQGGIFATSDRVTTHDDPTYVKHGVVHYAVANMPGAVPRTSTIALTNNTIPYALQIANKGYKQACIDNPALKKGVNALEGHITYKAVAEAQGLPYVNVDELIQ

[0008] SEQ ID NO.10

[0009] atgaaaattggcattccgaaagaaatcaaaaacaacgaaaaccgcgtggctatgacgccggctggtgttgttagcctgacccacgctggtcatg

[0010] aacgcctggctattgaaaccggtggcggcattggttcctcctttaccgacgccgaatatgtggcagcgggcgcagcttaccgttgtatcggtaag

[0011] gaagcatgggcgcaggagatgatcctgaaagttaaagaaccggttgcaagcgaatacgattacttctacgagggccagatcctgttcacctatct

[0012] gcacctggcaccgcgtgctgaactgacccaagcactgatcgataaaaaagtcgttggtattgcttacgaaaccgtgcagctggcaaacggttct

[0013] ctgccgctgctgactccaatgtctgaagtggcgggcaaaatggctacccagatcggtgcccagtacctggagaaaaaccacggcggcaaagg

[0014] cattctgctgggtggtgtatctggtgtgcacgctcgcaaagttacggtgatcggtggcggtattgcaggcaccaacgctgcaaaaattgccgtag

[0015] gtatgggtgcagacgtaaccgtgattgacctgtccccggaacgtctgcgtcaactggaagatatgttcggtcgtgacgtgcagaccctgatgag

[0016] caacccgtataacatcgcggaaagcgttaaacactccgatctggttgttggcgcagtactgatcccgggcgctaaggcacctaaactggtgtcc

[0017] gaagaaatgatccaaagcatgcagccgggttctgtggttgtggacatcgcgattgatcaaggcggcatcttcgcaactagcgaccgtgtcacta

[0018] cccacgacgaccctacctatgttaaacacggtgtagtacactacgctgtagcgaacatgcctggtgcagtgccacgtacgagcaccattgctctg

[0019] accaacaacaccattccgtatgctctgcagatcgcgaataaaggctataagcaggcgtgtatcgacaatccggcactgaaaaaaggcgtgaatg

[0020] cgctggaaggccacatcacttacaaagcggttgcggaagcccaaggcctgccgtacgttaacgttgatgaactgattcag

[0021] The mutant is obtained by mutating the glutamate at position 76 of alanine dehydrogenase with the amino acid sequence shown in SEQ ID NO.1 into arginine, and is named E76R;

[0022] or by mutating the glutamate at position 76 of alanine dehydrogenase with the amino acid sequence shown in SEQ ID NO.1 into arginine, and simultaneously mutating the aspartic acid at position 270 into glutamate, and is named E76R / D270E;

[0023] or by mutating the glutamate at position 76 of alanine dehydrogenase with the amino acid sequence shown in SEQ ID NO.1 into arginine, mutating the aspartic acid at position 270 into glutamate, and simultaneously mutating the alanine at position 300 into lysine, and is named E76R / D270E / A300K.

[0024] In one embodiment of the present invention, the three mutants of alanine dehydrogenase contain the nucleotide sequences shown in SEQ ID NO.7, SEQ ID NO.8 and SEQ ID NO.9.

[0025] The present invention also provides a gene encoding the above mutant or a recombinant vector carrying the gene.

[0026] The present invention also provides a recombinant cell expressing the above mutant or carrying the above gene or the recombinant vector.

[0027] In one embodiment of the present invention, the recombinant cell uses bacteria or fungi as an expression host.

[0028] The present invention also provides a recombinant enzyme catalyst containing the above alanine dehydrogenase mutant sequence, and the recombinant enzyme catalyst is any one of the following forms:

[0029] (1) Culturing a recombinant expression transformant and separating the transformed cells containing the recombinant enzyme;

[0030] (2) Culturing a recombinant expression transformant, separating the transformed cells containing the recombinant enzyme, disrupting the transformed cells containing the recombinant enzyme, and obtaining a cell lysate;

[0031] (3) Culturing a recombinant expression transformant, separating the transformed cells containing the recombinant enzyme, disrupting the transformed cells containing the recombinant enzyme, obtaining a cell lysate, and freeze-drying the cell lysate of the recombinant enzyme to obtain a lyophilized enzyme powder.

[0032] The present invention also provides a method for improving the catalytic efficiency of alanine dehydrogenase on pyruvate, and the method is to mutate the glutamate at position 76 of alanine dehydrogenase with the amino acid sequence shown in SEQ ID NO.1 into arginine;

[0033] Or mutate the glutamic acid at position 76 of alanine dehydrogenase with the amino acid sequence shown in SEQ ID NO.1 to arginine, and simultaneously mutate the aspartic acid at position 270 to glutamic acid;

[0034] Or mutate the glutamic acid at position 76 of alanine dehydrogenase with the amino acid sequence shown in SEQ ID NO.1 to arginine, mutate the aspartic acid at position 270 to glutamic acid, and simultaneously mutate the alanine at position 300 to lysine.

[0035] The present invention provides a recombinant Escherichia coli strain with improved L-alanine production efficiency. Using Escherichia coli W3110 as the starting strain, it has the following improvements:

[0036] Overexpressed the above-mentioned alanine dehydrogenase mutant, as well as alanine transporter, glucose-6-phosphate dehydrogenase, 6-phosphogluconate dehydratase, and KDPG aldolase derived from Escherichia coli, and simultaneously knocked out lactate dehydrogenase, alanine racemase, and pyruvate formate-lyase in the Escherichia coli genome.

[0037] In one embodiment of the present invention, the recombinant strain is a heterologous introduction of the alanine dehydrogenase ald mutant of Lysinibacillus, knockout of lactate dehydrogenase ldhA, knockout of alanine racemase dadX, knockout of pyruvate formate-lyase pflB, overexpression of alanine transporter alaE, and use of promoter P tac Tandem overexpression of the coding genes zwf of glucose-6-phosphate dehydrogenase, edd of 6-phosphogluconate dehydratase, and eda gene of KDPG aldolase in the ED pathway.

[0038] In one embodiment of the present invention, the coding gene ald (Gene ID: 48275818) of alanine dehydrogenase is integrated at the ldhA locus (Gene ID: 946315).

[0039] In one embodiment of the present invention, the coding gene alaE (Gene ID: 947147) of the alanine efflux protein is integrated at the dadX locus (Gene ID: 945754).

[0040] In one embodiment of the present invention, the P tac Promoter sequence, the coding gene zwf of glucose-6-phosphate dehydrogenase, edd of 6-phosphogluconate dehydratase, and eda gene of KDPG aldolase are integrated at the pflB locus (Gene ID: 945514).

[0041] In one embodiment of the present invention, the nucleotide sequence of the encoding gene ald of alanine dehydrogenase is as shown in SEQ ID NO.10; the nucleotide sequence of the encoding gene alaE of alanine exporter is as shown in SEQ ID NO.2; the nucleotide sequence of the tac promoter is as shown in SEQ ID NO.3; the nucleotide sequence of the encoding gene zwf of glucose-6-phosphate dehydrogenase is as shown in SEQ ID NO.4; the nucleotide sequence of the encoding gene edd of phosphogluconate dehydratase is as shown in SEQ ID NO.5; the nucleotide sequence of the encoding gene eda of KDPG aldolase is as shown in SEQ ID NO.6.

[0042] In one embodiment of the present invention, the recombinant Escherichia coli uses Escherichia coli as the expression host.

[0043] The present invention also provides a method for fermentatively producing L-alanine, which is to use the above recombinant Escherichia coli strain for fermentation to obtain L-alanine;

[0044] In one embodiment of the present invention, the method is to inoculate the recombinant Escherichia coli strain into the fermentation medium at an inoculum size of 10% by volume, perform aerobic fermentation in the early stage at a temperature of 33-37 °C and stir at 300-400 rpm for 6-8 h; perform anaerobic fermentation in the later stage at a temperature of 33-37 °C and continue to stir at 100-200 rpm for 40-48 h.

[0045] In one embodiment of the present invention, the above recombinant Escherichia coli strain is inoculated into the seed medium and cultured with shaking at 37 °C for 8 h, then inoculated into the fermentation medium at an inoculum size of 10-15%, perform aerobic fermentation in the early stage at a temperature of 37 °C, with a ventilation ratio of 1:1 and stir at 300-400 rpm for 8 h, perform anaerobic fermentation in the later stage at a temperature of 37 °C, continue to stir at 100-200 rpm, and end the fermentation when the glucose consumption rate slows down.

[0046] In one embodiment of the present invention, the fermentation medium used: initial glucose 10-20 g / L, MgSO 4 ·7H 2 O 1-2 g / L, yeast powder 4-6 g / L, (NH 4 ) 2 SO 4 1-3 g / L, K 2 HPO 4 3-5 g / L, betaine 0.5-1 g / L, corn steep liquor 10-20 g / L, trace elements 1-2 mL / L.

[0047] In one embodiment of the present invention, the trace element components are: FeSO 4 .7H 2 O, 3 - 5 g / L, CaCl 2 0.5 - 1.0 g / L, ZnSO 4 .7H 2 O 1 - 1.5 g / L, CuSO 4 .5H 2 O 0.5 - 1.0 g / L, (NH 4 )6Mo 7 O 24 .4H 2 O 0.5 - 1.0 g / L, Na 2 B 4 O 7 .10H 2 O 0.5 - 1.0 g / L; CoCl 2 .6H 2 O 0.5 - 1.0 g / L, made up to 1 L with distilled water, and filtered and sterilized.

[0048] The present invention also provides a method for producing L - alanine using the recombinant Escherichia coli described above.

[0049] In one embodiment, the inoculation is carried out at an inoculation amount of 10% into a fermenter at a temperature of 37°C.

[0050] In one embodiment, during the fermentation process, the residual sugar is controlled at 2 - 3 g / L, aerated in the early stage and anaerobic in the later stage, and concentrated ammonia water is used to maintain the pH at 6.8 - 6.9, and the fermentation lasts for 48 h.

[0051] The present invention also provides a method for improving the production intensity of L - alanine by Escherichia coli, which is to improve Escherichia coli as follows: using the promoter P tac to over - express in tandem the coding genes zwf, edd, and eda of glucose - 6 - phosphate dehydrogenase, phosphogluconate dehydratase, and KDPG aldolase in the ED pathway.

[0052] The present invention also provides a method for improving the production intensity of Escherichia coli for L - alanine, which is to over - express the above - mentioned alanine dehydrogenase mutant, as well as alanine transporters, glucose - 6 - phosphate dehydrogenase, phosphogluconate dehydratase, and KDPG aldolase derived from Escherichia coli, and at the same time knock out lactate dehydrogenase, alanine racemase, and pyruvate formate - lyase on the Escherichia coli genome.

[0053] In one embodiment of the present invention, the P tacThe promoter sequence, the coding gene zwf of glucose-6-phosphate dehydrogenase, the phosphogluconate dehydratase edd, and the KDPG aldolase eda gene are integrated at the pflB locus.

[0054] In one embodiment of the present invention, the nucleotide sequence of the coding gene ald of alanine dehydrogenase is as shown in SEQ ID NO.10; the nucleotide sequence of the coding gene alaE of alanine exporter is as shown in SEQ ID NO.2; the nucleotide sequence of the P tac promoter is as shown in SEQ ID NO.3; the nucleotide sequence of the coding gene zwf of glucose-6-phosphate dehydrogenase is as shown in SEQ ID NO.4; the nucleotide sequence of the coding gene edd of phosphogluconate dehydratase is as shown in SEQ ID NO.5; the nucleotide sequence of the coding gene eda of KDPG aldolase is as shown in SEQ ID NO.6.

[0055] The present invention provides a method for constructing the mutant. Based on the homology modeling of alanine dehydrogenase from Lysinibacillus, the mutation sites are determined by structural analysis; the mutant primers for site-directed mutagenesis are designed, and the site-directed mutagenesis is carried out using the pET28a vector carrying the alanine dehydrogenase gene as a template to construct mutant plasmids E76R-pET28a, E76R / D270E-pET28a, and E76R / D270E / A300K-pET28a respectively. The mutated plasmids are transformed into Escherichia coli BL21(DE3) cells, and positive monoclonal mutants are obtained after screening and verification.

[0056] In one embodiment of the present invention, the method for constructing the mutant is based on the homology modeling of alanine dehydrogenase from Lysinibacillus sphaericus, the mutation sites are determined by structural analysis; the mutant primers for site-directed mutagenesis are designed, and the site-directed mutagenesis is carried out using the pET28a vector carrying the alanine dehydrogenase gene as a template to construct mutant plasmids E76R-pET28a, E76R / D270E-pET28a, and E76R / D270E / A300K-pET28a. The mutated plasmids are transformed into Escherichia coli BL21(DE3) cells, and positive monoclonals E76R, E76R / D270E, and E76R / D270E / A300K are obtained after screening and verification.

[0057] The present invention also provides the use of the above-mentioned alanine dehydrogenase mutant, or the above-mentioned gene, or recombinant vector, or recombinant cell, or recombinant enzyme catalyst, or recombinant Escherichia coli strain, or the above-mentioned method in the preparation of L-alanine or products containing L-alanine.

[0058] Beneficial effects

[0059] The Escherichia coli constructed in the present invention can use glucose as a substrate to obtain a high yield of L-alanine in a short time. The operation of the strain during fermentation is convenient. In a 5L fermenter, the yield after 48h of fermentation can reach 150.2g / L, and the production intensity is 3.12g / L / h. Description of the Drawings

[0060] Figure 1 It is a diagram of the Ala-1.6 modification strategy;

[0061] Figure 2 It is the fed-batch fermentation results of the engineered strains Ala-1.1, Ala-1.2, Ala-1.3, Ala-1.4, Ala-1.5, and Ala-1.6 in a 5L fermenter.

[0062] Figure 3 It is a diagram showing an example of the structure of an alanine dehydrogenase mutant; where A is a diagram of the binding conformation of wild-type alanine dehydrogenase residues to the substrate pyruvate; B is a diagram of the binding conformation of the mutant to the substrate pyruvate. Detailed Embodiments

[0063] The plasmids, strains, and primers involved in the following examples are shown in Tables 1 to 3 respectively:

[0064] Table 1: Plasmids used in this application

[0065]

[0066]

[0067] Table 2: Strains involved in this application

[0068]

[0069] Table 3: Primer sequences

[0070]

[0071]

[0072] The media involved in the following examples are as follows:

[0073] Primary seed medium: 10g / L NaCl, 5g / L yeast extract, 10g / L peptone.

[0074] Secondary seed tank medium: initial glucose 10 - 20g / L, MgSO 4 ·7H 2 O 1 - 2g / L, yeast extract 4 - 6g / L, (NH 4 ) 2 SO4 1 - 3 g / L, K 2 HPO 4 3 - 5 g / L, betaine 0.5 - 1 g / L, corn steep liquor 10 - 20 g / L, trace elements 1 - 2 mL / L.

[0075] Fermentation medium: initial glucose 10 - 20 g / L, MgSO 4 ·7H 2 O 1 - 2 g / L, yeast extract 4 - 6 g / L, (NH 4 )2SO 4 1 - 3 g / L, K 2 HPO 4 3 - 5 g / L, betaine 0.5 - 1 g / L, corn steep liquor 10 - 20 g / L, trace elements 1 - 2 mL / L.

[0076] The detection methods involved in the following examples are as follows:

[0077] Cell concentration determination:

[0078] Take an appropriate amount of the fermentation broth and dilute it, and measure the OD measured by an ultraviolet spectrophotometer at a wavelength of 600 nm 600 represented.

[0079] L - alanine liquid phase detection method:

[0080] Take 12000 r / min of the fermentation broth and centrifuge for 10 min, take the supernatant and dilute it by a certain multiple, and measure the content of L - alanine by high - performance liquid chromatography (HPLC). The HPLC detection conditions are as follows: the chromatographic column is a Thermo C18 column, 5 μm, 4.6×250 mm chromatographic column, the mobile phase is mobile phase A (sodium acetate - triethylamine): mobile phase B (methanol - acetonitrile), the flow rate is 0.8 mL / min, the column temperature is 40 °C, the detector is an ultraviolet detector, and the wavelength is 338 nm.

[0081] Conversion rate = (output × fermentation broth volume) / total sugar consumption in fermentation %.

[0082] Production intensity: the output of L - alanine per unit time, production intensity = output (g / L) / fermentation time (h).

[0083] Example 1: Construct an engineered strain Ala - 1.1 with the ldhA gene knocked out on the genome and the ald gene from Lysinibacillus integrated

[0084] Using Escherichia coli W3110 as the starting strain (abbreviated as strain Ala-1.0 in the following examples), the lactate dehydrogenase ldhA gene (Gene ID: 946315) was knocked out, and the alanine dehydrogenase ald gene (GeneID: 48275818) derived from lysine was integrated to construct engineering strain Ala-1.1. All gene editing operations were completed using the Cas9 gene editing technology.

[0085] The specific method is as follows:

[0086] (1) Using the genome of strain Ala-1.0 (W3110) as a template, the upstream and downstream homologous arms of the ldhA gene were amplified using primers P1 and P2, and P3 and P4. Then, using the ald-pET28a plasmid as a template, the ald gene (SEQ ID NO.1) was amplified using primers P5 and P6. Subsequently, the upstream and downstream arms and the ald gene were fused into a linearized fragment for knocking out ldhA and integrating ald using primers P1 and P4. The linear fragment for knocking out ldhA and integrating ald could be obtained through electrophoresis separation and gel recovery of the PCR product.

[0087] (2) The sequence of the gene ldhA to be knocked out was uploaded to the CRISPR / Cas9 gene editing website for analysis to obtain the N20 sequence of the gene to be knocked out. An N20 sequence with high score and no self-ligation, which was close to the downstream homologous arm, was selected and used to replace the 20bp plasmid gene sequence of the sgRNA in the pTargetF plasmid to obtain the constructed pTargetF-ldhA plasmid. The pTargetF-ldhA plasmid was amplified using primers P7 and P8 respectively. After purification, the template plasmid was removed using DpnⅠ digestion enzyme from TaKaRa Company, and then it was transformed into Escherichia coli Top10 competent cells, and the obtained pTargetF-ldhA plasmid was extracted.

[0088] (3) The verified pTargetF-ldhA plasmid and the linearized fragment for knocking out ldhA and integrating ald were co-electroporated into strain Ala-1.0. After electroporation, it was spread on an LB + Kan (concentration: 50mg / mL) + Spe (concentration: 50mg / mL) plate and cultured under the culture condition of 30℃.

[0089] (4) Colony PCR was performed using the verification primers P1 and P4, and positive clones were screened by sequencing.

[0090] (5) The positive strain was inoculated into LB + Kan liquid medium containing 100 mg / mL IPTG and cultured at 30 °C with 200 r / min for about 12 h. After induced culture, the bacterial liquid was serially diluted and spread on LB + Kan plates, and cultured at 30 °C for about 12 h. Take one LB + Kan plate and one LB + Kan + Spe plate, draw small squares at the bottom of the plates with a marker pen, and number the small squares. Number the single colonies on the plates, and use sterilized toothpicks or pipette tips to inoculate the single colonies on the plates onto the LB + Kan plate and the LB + Kan + Spe plate in sequence according to the numbers, and culture at 30 °C for about 12 h. Observe the growth of colonies on the two plates. The strain that grows on the LB + Kan plate but does not grow on the LB + Kan + Spe plate is the strain with the pTargetF plasmid eliminated;

[0091] (6) The strain with the pTargetF plasmid eliminated was inoculated into LB liquid medium and cultured at 42 °C with 200 r / min for about 12 h. Then, an appropriate amount of the bacterial liquid was taken and diluted and spread on LB plates, and cultured at 37 °C for 12 h. Take one LB plate and one LB + Kan plate, draw small squares at the bottom of the plates with a marker pen, and number the small squares. Use sterilized toothpicks to inoculate the single colonies on the plates onto the LB plate and the LB + Kan plate in sequence according to the numbers, and culture at 37 °C for 12 h. Observe the growth of colonies on the two plates. The strain that grows on the LB plate but does not grow on the LB + Kan plate is the strain with the pCas plasmid eliminated;

[0092] (7) Finally, the strain with the plasmid completely eliminated was inoculated into LB liquid medium and cultured at 37 °C. Take 800 μL of the bacterial liquid into a preservation tube, add 800 μL of 30% (v / v) glycerol, and preserve at -80 °C to construct the strain Ala-1.1.

[0093] Example 2: Construction of the engineered strain Ala-1.2 with the dadX gene knocked out on the genome and the gene from Escherichia coli-derived alaE integrated

[0094] Using the Ala-1.1 constructed in Example 1 as the starting strain, the alanine racemase dadX gene (Gene ID: 945754) was knocked out, and the alanine exporter alaE (Gene ID: 947147) was integrated to construct the engineered strain Ala-1.2. All gene editing operations were completed using the Cas9 gene editing technology. The specific method is as follows:

[0095] (1) Using the genome of strain Ala-1.1 as a template, the upstream and downstream homologous arms of the dadX gene were amplified using primers P9 and P10, and P11 and P12. Then, using the genome of Escherichia coli W3110 as a template, the alaE gene (SEQ ID NO.2) was amplified using primers P13 and P14. Subsequently, the upstream and downstream arms and the alaE gene were fused into a linearized fragment for knocking out dadX and integrating alaE using primers P9 and P12. The linearized fragment for knocking out dadX and integrating alaE could be obtained through electrophoresis separation and gel recovery of the PCR product.

[0096] (2) The sequence of the gene dadX to be knocked out was uploaded to the CRISPR / Cas9 gene editing website for analysis to obtain the N20 sequence of the gene to be knocked out. An N20 sequence with high score and no self-ligation was selected near the downstream homologous arm and used to replace the 20bp plasmid gene sequence of the sgRNA in the pTargetF plasmid, resulting in the constructed pTargetF-dadX plasmid. Primers P15 and P16 were used to amplify the pTargetF-dadX plasmid respectively. After purification, the template plasmid was removed using DpnⅠ digestion enzyme from TaKaRa Company, and then it was transformed into Escherichia coli Top10 competent cells. The obtained pTargetF-dadX plasmid was extracted.

[0097] (3) The verified pTargetF-dadX plasmid and the linearized fragment for knocking out dadX and integrating alaE were co-electroporated into strain Ala-1.1. After electroporation, it was spread on an LB+Kan (concentration: 50mg / mL)+Spe (concentration: 50mg / mL) plate and cultured under the condition of 30℃.

[0098] (4) Colony PCR was performed using verification primers P9 and P12, and positive clones were screened by sequencing.

[0099] (5) The positive strain was inoculated into an LB+Kan liquid medium containing 100mg / mL IPTG and cultured at 30℃ and 200r / min for about 12h. After induced culture, the bacterial solution was serially diluted and spread on an LB+Kan plate and cultured at 30℃ for about 12h. Take one LB+Kan plate and one LB+Kan+Spe plate, draw small squares at the bottom of the plate with a marker pen and number the small squares. Number the single colonies on the plate, and use a sterilized toothpick or pipette tip to inoculate the single colonies on the plate onto the LB+Kan plate and the LB+Kan+Spe plate in sequence according to the numbers, and culture at 30℃ for about 12h. Observe the growth of colonies on the two plates. The strain that grows on the LB+Kan plate but does not grow on the LB+Kan+Spe plate is the strain that has eliminated the pTargetF plasmid.

[0100] (6) Inoculate the strain with the eliminated pTargetF plasmid into LB liquid medium, culture at 42 °C and 200 r / min for about 12 h. Then take an appropriate amount of the bacterial solution, dilute and spread it on an LB plate, culture at 37 °C for 12 h. Take one LB plate and one LB+Kan plate, draw small squares on the bottom of the plates with a marker pen, and number the small squares. Use a sterilized toothpick to inoculate the single colonies on the plates onto the LB plate and the LB+Kan plate in sequence according to the numbers, culture at 37 °C for 12 h, observe the growth of colonies on the two plates. The strain that grows on the LB plate but does not grow on the LB+Kan plate is the strain with the eliminated pCas plasmid;

[0101] (7) Finally, inoculate the strain with the completely eliminated plasmid into LB liquid medium and culture at 37 °C. Take 800 μL of the bacterial solution into a preservation tube, add 800 μL of 30% (v / v) glycerol, and preserve at -80 °C to construct strain Ala-1.2.

[0102] Example 3: Construct a strain with the pflB gene knocked out on the genome and integrate the promoter P tac Tandemly overexpress the coding genes zwf, edd, and eda of glucose-6-phosphate dehydrogenase, phosphogluconate dehydratase, and KDPG aldolase in the ED pathway to construct genomic strain Ala-1.3

[0103] Using Ala-1.2 constructed in Example 2 as the starting strain, knock out the gene (Gene ID: 945514) encoding pyruvate formate-lyase pflB on the genome and integrate the promoter P tac Tandemly overexpress the coding gene zwf (Gene ID: 946370), the coding gene edd (Gene ID: 946362) of phosphogluconate dehydratase, and the coding gene eda (Gene ID: 946367) of KDPG aldolase in the ED pathway to construct engineering strain Ala-1.3. All gene editing operations are completed using the Cas9 gene editing technology.

[0104] The specific method is as follows:

[0105] (1) Using the genome of strain Ala-1.2 as a template, amplify the upstream and downstream homologous arms of the pflB gene including the promoter P using primers P17 and P18, P19 and P20 tac(SEQ ID NO.3), amplify the coding gene zwf gene (SEQ ID NO.4) encoding glucose-6-phosphate dehydrogenase using primers P21 and P22, amplify the phosphogluconate dehydratase edd gene (SEQ ID NO.5) using primers P23 and P24, amplify the KDPG aldolase eda gene (SEQ ID NO.6) using primers P25 and P26, and then use primers P17 and P20 to fuse the upper and lower arms, P tac The promoter, the zwf encoding glucose-6-phosphate dehydrogenase, the edd phosphogluconate dehydratase, and the eda gene encoding KDPG aldolase were fused into a linearized fragment, and the sequence linear fragment could be obtained by separating the PCR product by electrophoresis and recovering it from the gel;

[0106] (2) Upload the sequence of the gene pflB to be knocked out to the CRISPR / Cas9 gene editing website for analysis to obtain the sequence of the gene N20 to be knocked out. Select a high-scoring N20 sequence that is close to the downstream homologous arm and has no self-ligation, and replace the 20bp plasmid gene sequence of the sgRNA in the pTargetF plasmid to obtain the constructed pTargetF-pflB plasmid. Use primers P27 and P28 to amplify the pTargetF-pflB plasmid respectively. After purification, use the DpnⅠ digestion enzyme of TaKaRa to remove the template plasmid, and then transform it into the competent Escherichia coli Top10 to extract the obtained pTargetF-pflB plasmid;

[0107] (3) Co-electroporate the verified pTargetF-pflB plasmid and the linearized fragment into the Ala-1.2 strain. After electroporation, spread it on an LB+Kan (concentration: 50mg / mL)+Spe (concentration: 50mg / mL) plate and culture it under the culture condition of 30°C;

[0108] (4) Perform colony PCR using the verification primers P17 and P20 and sequence to screen for positive clones;

[0109] (5) Inoculate the positive strain into LB + Kan liquid medium containing 100 mg / mL IPTG, culture at 30 °C and 200 r / min for about 12 h. After induction culture, serially dilute the bacterial liquid and spread it on the LB + Kan plate. Perform three-zone streaking and culture at 30 °C for about 12 h. Take one LB + Kan plate and one LB + Kan + Spe plate, draw small squares on the bottom of the plate with a marker pen, and number the small squares. Number the single colonies on the plate, and use a sterilized toothpick or pipette tip to inoculate the single colonies on the plate onto the LB + Kan plate and the LB + Kan + Spe plate in sequence according to the numbers. Culture at 30 °C for about 12 h, observe the growth of colonies on the two plates. The strain that grows on the LB + Kan plate but does not grow on the LB + Kan + Spe plate is the strain that has eliminated the pTargetF plasmid;

[0110] (6) Inoculate the strain that has eliminated the pTargetF plasmid into LB liquid medium, culture at 42 °C and 200 r / min for about 12 h. Then take an appropriate amount of the bacterial liquid, dilute it and spread it on the LB plate. Culture at 37 °C for 12 h. Take one LB plate and one LB + Kan plate, draw small squares on the bottom of the plate with a marker pen, and number the small squares. Use a sterilized toothpick to inoculate the single colonies on the plate onto the LB plate and the LB + Kan plate in sequence according to the numbers. Culture at 37 °C for 12 h, observe the growth of colonies on the two plates. The strain that grows on the LB plate but does not grow on the LB + Kan plate is the strain that has eliminated the pCas plasmid;

[0111] (7) Finally, inoculate the strain that has completely eliminated the plasmid into LB liquid medium and culture at 37 °C. Take 800 μL of the bacterial liquid into a preservation tube, add 800 μL of 30% (v / v) glycerol, and preserve it at -80 °C to construct the strain Ala-1.3.

[0112] Example 4: Construction and application of Escherichia coli alanine dehydrogenase mutant E76R

[0113] Using the Ala-1.3 constructed in Example 3 as the starting strain, mutate the 76th amino acid of alanine dehydrogenase (ald) on the genome from E to R. The ald E76R nucleotide sequence is shown in SEQ ID NO.7, and construct the L-alanine high-yield strain Ala-1.4 (ald E76R ). The gene integration of Escherichia coli is completed by the Cas9 gene editing technology. The structural schematic diagram of the alanine dehydrogenase mutant is as shown in Figure 3 .

[0114] The specific method is as follows:

[0115] 1. Construction and expression of the mutant

[0116] (1) Using the pET28a plasmid (abbreviated as ald-pET28a) linked with the lysine bacillus alanine dehydrogenase encoding ald gene (SEQ ID NO.10) as a template, PCR products were obtained by PCR using the mutant primer of E76R. After treating the PCR products with DpnⅠ, they were transformed into Escherichia coli Top10 competent cells, and the transformants were selected for sequencing verification.

[0117] The mutant primers are shown as follows (the italicized and bold parts are the mutation sites), E76R mutant primer pair:

[0118] E76R upstream: 5’-GTTAAACGCCCGGTTGCAAGC-3’

[0119] E76R downstream: 5’-AACCGGGCGTTTAACTTTCAG-3’

[0120] The sequencing results showed that no random mutations occurred except for the required mutation sites. Therefore, the mutant plasmid E76R-pET28a was successfully constructed.

[0121] (2) Purification and enzyme activity of the mutant

[0122] Transform the mutant E76R-pET28a or ald-pET28a into Escherichia coli BL21(DE3) cells, and select the transformants for sequencing verification. The verified positive transformants were cultured overnight at 37℃ in LB medium, and then transferred to TB medium at an inoculation amount of 2% (v / v). When the OD600 reached about 0.6 - 0.8, IPTG with a final concentration of 0.04 mM / L was added, and induction was carried out at 25℃ for 12 h.

[0123] Collect the fermentation broth, and centrifuge at 8000 rpm for 10 min at 4℃ to collect the cells. Ultrasonic the collected cells in the washing solution. The components of the washing solution are: 400 mM NaCl, 25 mM Tris pH 8.0, 0.05% w / v Triton X-100, 20 mM imidazole. Centrifuge the cell lysate at 12000 rpm for 20 min, and pass the supernatant through a 0.45μm membrane and then onto a nickel chelating column (the nickel column was pre-equilibrated with the washing solution for 20 min). Then wash the column with 20 column volumes of the washing solution to remove impurities, and then elute the target protein with 20 mL of the elution solution. The components of the elution solution are: 400 mM NaCl, 25 mM Tris pH8.0, 500 mM imidazole. Then further purify the eluted protein with a desalting column, and concentrate it by centrifugation with a 30KDa ultrafiltration tube to obtain the purified alanine dehydrogenase mutant and wild-type alanine dehydrogenase.

[0124] The obtained 1 mM alanine dehydrogenase mutant and wild-type enzyme were added to the reaction system, which contained a reaction mixture (100 mM pyruvate, 10 mM NADH, and 2 M NH 4 Cl), and incubated at 37 °C and pH 7.0 for 10 minutes. Subsequently, the enzyme activity was determined by measuring the absorbance at 340 nm using a spectrophotometer.

[0125] The results showed that the enzyme activity of the wild type was 94.18 U / mg, and that of E76R was 102.20 U / mg.

[0126] 2. Construction of genetically engineered bacterium Ala-1.4 (ald E76R )

[0127] Using Ala-1.3 constructed in Example 3 as the starting strain, the 76th amino acid of alanine dehydrogenase (ald) on the genome was mutated from E to R. The nucleotide sequence of ald E76R is shown in SEQ ID NO.7, and the specific steps are as follows:

[0128] (1) The E76R-pET28a plasmid was prepared according to the method in step 1;

[0129] (2) Using the E76R-pET28a plasmid as a template, the E76R alanine dehydrogenase mutant gene (ald E76R ) was amplified using primers P5 and P6; then, using the genome of the Ala-1.3 strain as a template, the upstream and downstream homologous arms were amplified using primers P1 and P4, and fused with the ald E76R gene into a linearized fragment (hereinafter abbreviated as ald E76R fragment). This linear fragment could be obtained by separating the PCR product by electrophoresis and recovering it from the gel;

[0130] (3) The sequence of the gene ald to be knocked out was uploaded to the CRISPR / Cas9 gene editing website for analysis to obtain the N20 sequence of the gene to be knocked out. A high-scoring N20 sequence without self-ligation and close to the downstream homologous arm was selected and replaced the 20 bp plasmid gene sequence of the sgRNA in the pTargetF plasmid to obtain the constructed pTargetF-ald plasmid. The pTargetF-ald plasmid was amplified using primers P29 and P30 respectively. After purification, the template plasmid was removed using the DpnⅠ digestion enzyme from TaKaRa Company, and then transformed into Escherichia coli Top10 competent cells, and the obtained pTargetF-ald plasmid was extracted;

[0131] (3) The verified pTargetF-ald plasmid and ald E76RThe fragments were co-electroporated into the Ala-1.3 strain. After electroporation, they were spread on an LB + Kan (concentration: 50 mg / mL) + Spe (concentration: 50 mg / mL) plate and cultured under the condition of 30 °C;

[0132] (4) Colony PCR was performed using the verification primers P1 and P4, and positive clones were screened by sequencing;

[0133] (5) The positive strain was inoculated into an LB + Kan liquid medium containing 100 mg / mL IPTG and cultured at 30 °C and 200 r / min for about 12 h. After induction culture, the bacterial liquid was serially diluted and spread on an LB + Kan plate and cultured at 30 °C for about 12 h. Take one LB + Kan plate and one LB + Kan + Spe plate, draw small squares at the bottom of the plate with a marker pen, and number the small squares. Number the single colonies on the plate, and use a sterilized toothpick or pipette tip to inoculate the single colonies on the plate onto the LB + Kan plate and the LB + Kan + Spe plate in sequence according to the numbers, and culture at 30 °C for about 12 h. Observe the growth of colonies on the two plates. The strain that grows on the LB + Kan plate and does not grow on the LB + Kan + Spe plate is the strain that has eliminated the pTargetF plasmid;

[0134] (6) The strain that has eliminated the pTargetF plasmid was inoculated into an LB liquid medium and cultured at 42 °C and 200 r / min for about 12 h. Then, an appropriate amount of the bacterial liquid was diluted and spread on an LB plate and cultured at 37 °C for 12 h. Take one LB plate and one LB + Kan plate, draw small squares at the bottom of the plate with a marker pen, and number the small squares. Use a sterilized toothpick to inoculate the single colonies on the plate onto the LB plate and the LB + Kan plate in sequence according to the numbers, and culture at 37 °C for 12 h. Observe the growth of colonies on the two plates. The strain that grows on the LB plate and does not grow on the LB + Kan plate is the strain that has eliminated the pCas plasmid;

[0135] (7) Finally, the strain that has completely eliminated the plasmid was inoculated into an LB liquid medium and cultured at 37 °C. Take 800 μL of the bacterial liquid into a preservation tube, add 800 μL of 30% (v / v) glycerol, and preserve it at -80 °C to construct the strain Ala-1.4.

[0136] Example 5: Construction and application of Escherichia coli alanine dehydrogenase mutant E76R / D270E

[0137] Using the Ala-1.4 constructed in Example 4 as the starting strain, the 270th amino acid of alanine dehydrogenase (ald) on the genome was mutated from D to E to construct a high L-alanine-producing strain Ala-1.5 (ald E76R / D270E ), and the gene integration of Escherichia coli was completed by the Cas9 gene editing technology.

[0138] The specific method is as follows:

[0139] 1. Construction and expression of mutants

[0140] (1) Using the E76R-pET28a plasmid constructed in Example 4 as a template, PCR products were obtained by PCR using mutant primers for D270E or V239L. After treating the PCR products with DpnⅠ, they were transformed into Escherichia coli Top10 competent cells, and the transformants were selected for sequencing verification.

[0141] The mutant primers are as follows (the italicized and bolded parts are the mutation sites): D270E mutant primer pair:

[0142] D270E upstream: 5’-GCGATTGAACAAGGCGGCATC-3’

[0143] D270E downstream: 5’-GCCTTGTTCAATCGCGATGTC-3’

[0144] V239L mutant primer pair:

[0145] V239L upstream: 5’-GGCGCACTGCTGATCCCGGGC-3’

[0146] V239L downstream: 5’-GATCAGCAGTGCGCCAACAAC-3’

[0147] The sequencing results showed that no random mutations occurred except for the required mutation sites. Therefore, the mutant plasmids E76R / D270E-pET28a and E76R / V239L-pET28a were successfully constructed.

[0148] (2) According to steps (2) and (3) of step 1 in Example 4, the enzyme activity was detected. The results showed that the enzyme activity of E76R / D270E was 118.50 U / mg; the enzyme activity of E76R / V239L was 78.40 U / mg. It can be seen that the mutant E76R / D270E had the best effect, and subsequent strain construction was carried out with this mutant.

[0149] 2. Construction of genetically engineered bacterium Ala-1.5(ald E76R / D270E )

[0150] Using Ala-1.4 constructed in Example 4 as the starting strain, or mutating the 270th amino acid of alanine dehydrogenase (ald) on the genome from D to E (ald E76R / D270E The nucleotide sequence is shown in SEQ ID NO.8), and the specific steps are as follows:

[0151] (1) The E76R / D270E-pET28a plasmid was prepared according to the method in step 1;

[0152] (2) Using the homologous arms obtained in Example 4 and the E76R / D270E-pET28a plasmid as a template, the E76R and D270E alanine dehydrogenase mutant genes (ald E76R / D270E ) were amplified using primers P5 and P6. Then, using primers P1 and P4, the upstream and downstream homologous arms and the ald E76R / D270E gene were fused into a linearized fragment (hereinafter abbreviated as ald E76R / D270E linear fragment). This linear fragment could be obtained by separating the PCR product through electrophoresis and recovering it from the gel;

[0153] (3) The pTarget-ald plasmid obtained in Example 4 and the ald E76R / D270E linear fragment were co-electroporated into the Ala-1.4 strain. After electroporation, the cells were spread on an LB+Kan (concentration: 50 mg / mL)+Spe (concentration: 50 mg / mL) plate and cultured under the condition of 30 °C;

[0154] (4) Colony PCR was performed using the verification primers P1 and P4, and positive clones were screened by sequencing;

[0155] (5) The positive strain was inoculated into an LB+Kan liquid medium containing 100 mg / mL IPTG and cultured at 30 °C and 200 r / min for about 12 h. After induction culture, the bacterial solution was serially diluted and spread on an LB+Kan plate and cultured at 30 °C for about 12 h. Take one LB+Kan plate and one LB+Kan+Spe plate, draw small squares at the bottom of the plate with a marker pen, and number the small squares. Number the single colonies on the plate, and use a sterilized toothpick or pipette tip to inoculate the single colonies on the plate onto the LB+Kan plate and the LB+Kan+Spe plate in sequence according to the numbers. Culture at 30 °C for about 12 h, and observe the growth of colonies on the two plates. The strain that grows on the LB+Kan plate but does not grow on the LB+Kan+Spe plate is the strain that has eliminated the pTargetF plasmid;

[0156] (6) The strain that has eliminated the pTargetF plasmid was inoculated into an LB liquid medium and cultured at 42 °C and 200 r / min for about 12 h. Then, an appropriate amount of the bacterial solution was diluted and spread on an LB plate and cultured at 37 °C for 12 h. Take one LB plate and one LB+Kan plate, draw small squares at the bottom of the plate with a marker pen, and number the small squares. Use a sterilized toothpick to inoculate the single colonies on the plate onto the LB plate and the LB+Kan plate in sequence according to the numbers. Culture at 37 °C for 12 h, and observe the growth of colonies on the two plates. The strain that grows on the LB plate but does not grow on the LB+Kan plate is the strain that has eliminated the pCas plasmid;

[0157] (7) Finally, inoculate the plasmid-free strain completely into LB liquid medium and culture at 37 °C. Take 800 μL of the bacterial solution into a preservation tube, add 800 μL of 30% (v / v) glycerol, and preserve at -80 °C to construct strain Ala-1.5.

[0158] Example 6: Construction and application of Escherichia coli alanine dehydrogenase mutant E76R / D270E / A300K

[0159] Using Ala-1.5 constructed in Example 5 as the starting strain, mutate the 300th amino acid of alanine dehydrogenase (ald) on the genome from A to K to construct the L-alanine high-yield strain Ala-1.6 (ald E76R / D270E / A300K ), and the gene integration of Escherichia coli is completed by the Cas9 gene editing technology.

[0160] The specific method is as follows:

[0161] 1. Construction and expression of mutants

[0162] (1) Using the E76R / D270E-pET28a plasmid constructed in Example 5 as a template, obtain the PCR product by PCR using the mutant primer of A300K. After treating the PCR product with DpnⅠ, transform it into Escherichia coli Top10 competent cells, and select the transformants for sequencing verification.

[0163] The mutant primers are as follows (the italicized and bold parts are the mutation sites): A300K mutant primer pair:

[0164] P35 A300K upstream: 5’-GGCGCACTGCTGATCCCGGGC-3’

[0165] P36 A300K downstream: 5’-GATCAGCAGTGCGCCAACAAC-3’

[0166] The sequencing results show that no random mutations occurred except for the required mutation sites. Therefore, the mutant plasmid E76R / D270E / A300K-pET28a was successfully constructed.

[0167] (2) According to the step (2) of step 1 in Example 4, perform the enzyme activity detection. The results show that the enzyme activity of E76R / D270E / A300K is: 131.73 U / mg.

[0168] 2. Construction of the genetically engineered bacterium Ala-1.6 (ald E76R / D270E / A300K )

[0169] Using the Ala-1.5 constructed in Example 5 as the starting strain, the 300th amino acid of alanine dehydrogenase (ald) on the genome was mutated from A to K, ald E76R / D270E / A300K The nucleotide sequence is shown in SEQ ID NO.9, and the specific steps are as follows:

[0170] (1) Prepare the E76R / D270E / A300K-pET28a plasmid according to the method in step 1;

[0171] (2) Using the homologous arms obtained in Example 4, and using the E76R / D270E / A300K-pET28a plasmid as a template, amplify the E76R / D270E / A300K alanine dehydrogenase mutant gene (ald E76R / D270E / A300K ) with primers P5 and P6, and then use primers P1 and P4 to fuse the upper and lower arms and the ald E76R / D270E / A300K gene into a linearized fragment (hereinafter abbreviated as ald E76R / D270E / A300K linear fragment). This linear fragment can be obtained by separating the PCR product by electrophoresis and recovering it from the gel;

[0172] (3) Co-electroporate the pTarget-ald plasmid obtained in Example 4 and the ald E76R / D270E / A300K linear fragment into the Ala-1.5 strain. After electroporation, coat it on an LB+Kan (concentration: 50mg / mL)+Spe (concentration: 50mg / mL) plate and culture it under the culture condition of 30℃;

[0173] (4) Perform colony PCR using the verification primers P1 and P4 and sequence to screen positive clones;

[0174] (5) Inoculate the positive strain into an LB+Kan liquid medium containing 100mg / mL IPTG, culture it at 30℃ and 200r / min for about 12h. After induction culture, dilute the bacterial liquid in gradient and coat it on an LB+Kan plate, and culture it at 30℃ for about 12h. Take one LB+Kan plate and one LB+Kan+Spe plate, draw small squares at the bottom of the plate with a marker pen and number the small squares. Number the single colonies on the plate, and use a sterilized toothpick or pipette tip to inoculate the single colonies on the plate onto the LB+Kan plate and the LB+Kan+Spe plate in sequence according to the number, and culture it at 30℃ for about 12h. Observe the growth of colonies on the two plates. The strain that grows on the LB+Kan plate and does not grow on the LB+Kan+Spe plate is the strain that has eliminated the pTargetF plasmid;

[0175] (6) Inoculate the strain with the pTargetF plasmid eliminated into LB liquid medium, culture at 42 °C and 200 r / min for about 12 h. Then take an appropriate amount of the bacterial liquid, dilute and spread it on an LB plate, culture at 37 °C for 12 h. Take one LB plate and one LB + Kan plate, draw small squares on the bottom of the plates with a marker pen, and number the small squares. Use a sterilized toothpick to inoculate the single colonies on the plate onto the LB plate and the LB + Kan plate in sequence according to the numbers, culture at 37 °C for 12 h, observe the growth of colonies on the two plates. The strain that grows on the LB plate but does not grow on the LB + Kan plate is the strain with the pCas plasmid eliminated;

[0176] (7) Finally, inoculate the strain with the plasmid completely eliminated into LB liquid medium and culture at 37 °C. Take 800 μL of the bacterial liquid into a preservation tube, add 800 μL of 30% (v / v) glycerol, and preserve at -80 °C to construct the strain Ala-1.6 ( Figure 1 ).

[0177] Example 7: The recombinant strains Ala-1.1, Ala-1.2, Ala-1.3, Ala-1.4, Ala-1.5 and Ala-1.6 were respectively subjected to fed-batch fermentation in a 5 L fermenter

[0178] Use the recombinant strains Ala-1.1, Ala-1.2, Ala-1.3, Ala-1.4, Ala-1.5 and Ala-1.6 prepared in Examples 1-6 for fermentation according to the following fermentation process: frozen glycerol tube → slant activation → primary shake flask seed → secondary seed tank → fermenter.

[0179] (1) Slant activation: Streak and activate the bacteria in the frozen glycerol tube stored at -80 °C on a slant LB medium, and culture at a constant temperature of 37 °C for about 12 h.

[0180] (2) Primary shake flask seed culture: Wash the bacterial lawn on the slant medium with LB medium, inoculate it into a 500 mL Erlenmeyer flask containing 100 mL of primary seed medium at an inoculation amount of 2% (v / v), culture at 180 r / min and a constant temperature of 37 °C for 4-5 h, OD 600 is between 3.0 and 4.0 to obtain the primary seed liquid.

[0181] (3) Secondary seed tank culture: Inoculate the primary seed liquid into a 2 L secondary seed tank medium at an inoculation amount of 2-5% (v / v), expand and culture at 37 °C for 6-8 h, adjust the pH to about 6.8-6.9 with 25% ammonia water, OD 600 is between 20.0 and 25.0 to obtain the secondary seed liquid;

[0182] (4) 5L Dibeier parallel reactor fermentation: The initial liquid filling volume of the fermenter is 2L. The secondary seed liquid is inoculated into the fermentation medium at an inoculation amount of 10% (v / v) of the total volume. The temperature is 37°C, and the initial aeration rate is controlled at 2L / min. During the fermentation process, ammonia water is added dropwise to control the pH at 6.8 - 6.9. After 8 hours of aeration in the early stage, anaerobic fermentation is switched to.

[0183] Fermentation medium: Initial glucose is 10 - 20g / L, MgSO 4 ·7H 2 O is 1 - 2g / L, yeast powder is 4 - 6g / L, (NH 4 ) 2 SO 4 1 is 1 - 3g / L, K 2 HPO 4 3 is 3 - 5g / L, betaine is 0.5 - 1g / L, corn steep liquor is 10 - 20g / L, trace elements are 1mL / L.

[0184] Detect the L-alanine production after 48h of fermentation. The results show that after 48h of fermentation, the production ( Figure 2 ) of each strain is as follows:

[0185] The L-alanine production of strain Ala-1.1 can reach 62.4g / L;

[0186] The L-alanine production of strain Ala-1.2 can reach 87.8g / L;

[0187] The L-alanine production of strain Ala-1.3 can reach 112.5g / L;

[0188] The L-alanine production of strain Ala-1.4 can reach 133.8g / L;

[0189] The L-alanine production of strain Ala-1.5 can reach 139.7g / L;

[0190] The L-alanine production of strain Ala-1.6 can reach 150.2g / L.

[0191] Although the present invention has been disclosed above with preferred embodiments, it is not intended to limit the present invention. Anyone familiar with this technology can make various modifications and alterations without departing from the spirit and scope of the present invention. Therefore, the protection scope of the present invention should be defined by the claims.

Claims

1. An alanine dehydrogenase mutant, characterized in that The mutant is obtained by mutating the 76th glutamic acid of the alanine dehydrogenase shown in the amino acid sequence of SEQ ID NO.1 to arginine, and is named E76R; Or the amino acid sequence of alanine dehydrogenase as shown in SEQ ID NO.1 is obtained by mutating the glutamic acid at position 76 to arginine and the aspartic acid at position 270 to glutamic acid, which is named E76R / D270E; Or the amino acid sequence of alanine dehydrogenase as shown in SEQ ID NO.1 is obtained by mutating the glutamic acid at position 76 to arginine, the aspartic acid at position 270 to glutamic acid, and the alanine at position 300 to lysine, which is named E76R / D270E / A300K.

2. A gene encoding the mutant according to claim 1 or a recombinant vector carrying the gene.

3. A recombinant cell expressing the mutant according to claim 1 or carrying the gene or the recombinant vector according to claim 2; preferably, the recombinant cell uses bacteria or fungi as expression hosts.

4. A recombinant enzyme catalyst comprising the alanine dehydrogenase mutant sequence of claim 1, characterized in that: The recombinase catalyst is any one of the following forms: (1) culturing recombinant expression transformants and isolating transformant cells containing the recombinase; (2) culturing the recombinant expression transformant, isolating the transformant cells containing the recombinase, and disrupting the transformant cells containing the recombinase to obtain a cell disrupted liquid; (3) Cultivating the recombinant expression transformant, isolating the transformant cells containing the recombinant enzyme, disrupting the transformant cells containing the recombinant enzyme, obtaining a cell disrupted liquid, and freeze-drying the cell disrupted liquid of the recombinant enzyme to obtain a lyophilized enzyme powder.

5. A method for improving the catalytic efficiency of alanine amino acid dehydrogenase on pyruvate, characterized in that: The method comprises mutating the glutamic acid at position 76 of the alanine dehydrogenase whose amino acid sequence is shown in SEQ ID NO.1 into arginine; Or the glutamic acid at position 76 of the alanine dehydrogenase with the amino acid sequence as shown in SEQ ID NO.1 is mutated to arginine, and the aspartic acid at position 270 is mutated to glutamic acid; Or the glutamic acid at position 76 of the alanine dehydrogenase with the amino acid sequence as shown in SEQ ID NO.1 is mutated to arginine, the aspartic acid at position 270 is mutated to glutamic acid, and the alanine at position 300 is mutated to lysine.

6. A recombinant Escherichia coli strain with improved L-alanine production intensity, characterized in that: The alanine dehydrogenase mutant according to claim 1, as well as the alanine transporter, glucose-6-phosphate dehydrogenase, phosphogluconate dehydratase, and KDPG aldolase from Escherichia coli are overexpressed, and lactate dehydrogenase, alanine racemase, and pyruvate formate lyase on the Escherichia coli genome are knocked out.

7. The recombinant Escherichia coli strain according to claim 6, characterized in that Using promoter P tac The glucose-6-phosphate dehydrogenase, phosphogluconate dehydratase and KDPG aldolase in the native ED pathway of Escherichia coli were tandemly enhanced; Preferably, the nucleotide sequence encoding the alanine transporter is as shown in SEQ ID NO.2; the promoter P tac The nucleotide sequence of the nucleotide sequence is shown in SEQ ID NO.3; the nucleotide sequence encoding the glucose-6-phosphate dehydrogenase is shown in SEQ ID NO.4; the nucleotide sequence encoding the phosphogluconate dehydratase is shown in SEQ ID NO.5; the nucleotide sequence encoding the KDPG aldolase is shown in SEQ ID NO.6; Preferably, the recombinant Escherichia coli is an expression host of Escherichia coli W3110; Preferably, the recombinant Escherichia coli is a recombinant bacterium in which lactate dehydrogenase is knocked out and the alanine dehydrogenase mutant is integrated, alanine racemase is knocked out and the alanine transporter is integrated, and pyruvate formate lyase is knocked out and the promoter P is integrated. tac Glucose-6-phosphate dehydrogenase, phosphogluconate dehydratase and KDPG aldolase in the native ED pathway of Escherichia coli were tandemly enhanced.

8. A method for preparing L-alanine by fermentation, characterized in that: The method comprises fermenting the recombinant Escherichia coli strain according to claim 6 or 7 to prepare L-alanine; Preferably, the method is to inoculate the recombinant Escherichia coli into a fermentation medium, perform aerobic fermentation at a temperature of 33-37°C, and stir at 300-400rpm for 6-8h in the early stage; and perform anaerobic fermentation at a temperature of 33-37°C and continue stirring at 100-200rpm for 40-48h in the later stage.

9. A method for increasing the production intensity of L-alanine by Escherichia coli, characterized in that: The method is to overexpress the alanine dehydrogenase mutant described in claim 1, as well as alanine transporter, glucose-6-phosphate dehydrogenase, phosphogluconate dehydratase, and KDPG aldolase from Escherichia coli, and simultaneously knock out lactate dehydrogenase, alanine racemase, and pyruvate formate lyase on the Escherichia coli genome.

10. Use of the alanine dehydrogenase mutant according to claim 1, the gene or recombinant vector according to claim 2, the recombinant cell according to claim 3, the recombinant enzyme catalyst according to claim 4, the recombinant Escherichia coli strain according to claim 6 or 7, or the method according to claim 8 or 9 in the preparation of L-alanine or a product containing L-alanine.

Citation Information

Patent Citations

  • L-alanine dehydrogenase mutant zymoprotein and preparation method thereof

    CN103074309A

  • L-alanine dehydrogenase as well as preparation method and application thereof

    CN117384875A

  • Genetic engineering strain for improving de novo fermentation yield and conversion rate of L-theanine, method and application

    CN117821356A

  • Recombinant protein variants

    CN1714153A

  • Modified Phenylalanine Dehydrogenase

    US20220235333A1