Wheat scab disease-resistant protein TaSnRK1alpha and fusarium graminearum secretory protein Osp24 interaction key site and application thereof
By identifying the key interaction sites of the wheat gibberellosis disease-resistant protein TaSnRK1α and Fusarium secretory protein Osp24, the problem of difficulty in accurately blocking bacterial targeting in the prior art is solved, and the goal of improving wheat disease resistance without affecting the normal function of the plant is achieved.
Patent Information
- Application Number
- CN202510226436.0
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-02-27
- Publication Date
- 2025-06-10
- Estimated Expiration
- 2045-02-27
AI Technical Summary
The prior art is difficult to effectively identify the key points of interaction between the anti-disease protein TaSnRK1α of wheat gibberellia and the secretory protein Osp24 of Fusarium granite, making it difficult to accurately block the targeting and manipulation of bacteria in gene editing technology.
By deeply analyzing the interaction relationship between TaSnRK1α and Osp24, it was identified that the 381-500aa segment of TaSnRK1α protein and the specific segments in its homologous protein were key interaction regions. It was further verified by yeast two-hybrid assay and determined that valine position 479 of TaSnRK1α was the key site that determines the interaction with Osp24.
The interaction between pathogenic proteins and TaSnRK1α was successfully blocked, providing an ideal molecular target for precise editing using CRISPR-Cas9 technology, and improving the possibility of resistance to wheat gibberellosis.
Smart Images

Figure BDA0005290257640000052 
Figure BDA0005290257640000061 
Figure HDA0005290257650000011
Abstract
Description
Technical Field
[0001] The present invention belongs to the technical field of genetic engineering, and particularly relates to the key interaction sites between the wheat scab resistance protein TaSnRK1α and the Fusarium graminearum secreted protein Osp24 and their applications. Background Art
[0002] Wheat scab is a major fungal disease caused by the Fusarium graminearum dominant Fusarium species. It not only causes a significant reduction in wheat yield and quality, but also the large amount of fungal toxins accumulated in infected wheat ears can lead to excessive toxin levels in grains and wheat products, seriously threatening the health of humans and livestock, and posing a double challenge to agricultural production and food safety.
[0003] Cultivating disease-resistant varieties is the most economical, durable, and effective measure for controlling wheat scab. However, there is currently a severe lack of high-quality and high-yield resistant materials, and the available resistance sources are very limited. In addition, due to the complex resistance mechanism of wheat scab, the lack of major disease-resistant genes, and the long traditional breeding cycle, there are great difficulties in the molecular breeding of scab. During the long-term co-evolution process between plants and pathogens, rich disease-resistant gene resources have been accumulated. When infecting wheat, Fusarium graminearum uses secreted proteins to inhibit or manipulate key immune regulatory factors to assist infection. Therefore, identifying key disease-resistant and -susceptible genes among the targets of the core pathogenic secreted proteins of Fusarium graminearum, analyzing the interaction and resistance mechanisms, and performing genetic manipulation on them are expected to create wheat materials with improved scab resistance, providing new ideas for solving the current problems of wheat scab prevention and control and molecular breeding.
[0004] However, since key disease-resistant and -susceptible genes often play important roles in the life activities of plants, overexpression, silencing, or knockout may bring some negative impacts, such as affecting main agronomic traits, yield, and quality. Therefore, using gene editing technology to precisely modify the interaction sites to block the targeting and manipulation of pathogens can avoid affecting the biological functions of target genes. This is a new idea for achieving the genetic improvement of crop disease resistance while maintaining the excellent traits of crops. An important basis for achieving this goal is to have an in-depth understanding of the interaction relationship between pathogen proteins and host targets, especially the identification of key interaction sites.
[0005] The key disease-resistant protein of wheat head blight, sucrose non-fermenting-1-related protein kinase 1 catalytic subunit alpha protein TaSnRK1α, is a member of the sucrose non-fermenting-1-related protein kinase family, and members of this family play important roles in plant growth, metabolism, and stress responses. The core pathogenic secreted protein Osp24 of Fusarium graminearum targets and reduces the protein stability of TaSnRK1α, interfering with the resistance of wheat head blight mediated by TaSnRK1α. In order to effectively utilize the CRISPR-Cas9 gene editing technology, while maintaining the core function of the TaSnRK1α protein, modify specific sites of TaSnRK1α to block the targeting of Osp24 and create wheat materials with improved resistance to head blight, it is necessary to accurately identify the key interaction sites between TaSnRK1α and Osp24 in depth. However, there is no relevant report on the key interaction sites between TaSnRK1α and Osp24 in the existing technology. Summary of the Invention
[0006] In view of the deficiencies of the existing technology, the present invention deeply analyzes the interaction relationship between the important disease-resistant protein TaSnRK1α of wheat and the core secreted protein of Fusarium graminearum, and then identifies the key sites that determine the interaction. Mutating this site can block the targeting of the pathogen. This provides an important basis for subsequent precise editing of this site by technologies such as CRISPR-Cas9 to improve wheat disease resistance.
[0007] The main contents of the present invention are as follows:
[0008] The present invention relates to the important disease-resistant protein TaSnRK1α of wheat and the core pathogenic secreted protein of Fusarium graminearum. The nucleotide sequence of TaSnRK1α is shown in SEQ ID NO:1, and the amino acid sequence is shown in SEQ ID NO:2. The nucleotide sequence of the secreted protein Osp24 is shown in SEQ ID NO:9, and the amino acid sequence is shown in SEQ ID NO:10. The disease-resistant protein TaSnRK1α plays a positive regulatory role in the defense response of wheat against head blight. The core pathogenic secreted protein Osp24 of Fusarium graminearum targets and reduces the protein stability of TaSnRK1α to interfere with the resistance of wheat head blight and promote the infection of the pathogen.
[0009] The present invention also relates to 3 homologous genes of TaSnRK1α, namely TaSnRK1α2, TaSnRK1α3, and TaSnRK1α4, and the nucleotide sequences correspond to SEQ ID NO:3, SEQ ID NO:4, and SEQ ID NO:5 respectively, and the amino acid sequences correspond to SEQ ID NO:6, SEQ ID NO:7, and SEQ ID NO:8 respectively.
[0010] On the one hand, the present invention provides the key interaction regions between the wheat Fusarium head blight resistance protein TaSnRK1α and the Fusarium graminearum secreted protein Osp24. The key interaction regions are located at positions 381 - 500 of the sequence shown in SEQ ID NO: 2, positions 392 - 513 of the sequence shown in SEQ ID NO: 6, or positions 391 - 512 of the sequence shown in SEQ ID NO: 8. The present invention also provides the key interaction sites between the wheat Fusarium head blight resistance protein TaSnRK1α and the Fusarium graminearum secreted protein Osp24. The key interaction site is located at position 479 of the sequence shown in SEQ ID NO: 2.
[0011] Specifically, in the present invention, by analyzing the distribution of protein domains and sequence characteristics, TaSnRK1α is divided into multiple forms. The yeast two-hybrid assay is used to verify the interaction with Osp24, and it is determined that the 381 - 500aa segment of TaSnRK1α is the key region determining the interaction with Osp24. Further, through experimental verification in the present invention, the corresponding segments (392 - 513aa and 391 - 512aa respectively) of the homologous proteins TaSnRK1α3 and TaSnRK1α4 of TaSnRK1α in the wheat genome interact with Osp24, while TaSnRK1α2 does not. Based on this, by comparing the amino acid sequences of this segment in TaSnRK1α, TaSnRK1α2, TaSnRK1α3, and TaSnRK1α4, it is found that there are 6 amino acids that are the same in TaSnRK1, TaSnRK1α3, and TaSnRK1α4 and different from TaSnRK1α2. Point mutations are respectively made on the above 6 amino acids, and finally it is proved that the valine at position 479 of TaSnRK1α is the key site determining the interaction with Osp24.
[0012] Furthermore, based on the above research results, the present invention proposes the application of the key interaction region in blocking the interaction between the wheat Fusarium head blight resistance protein TaSnRK1α and the Fusarium graminearum secreted protein Osp24. And the application of the key interaction site in blocking the interaction between the wheat Fusarium head blight resistance protein TaSnRK1α and the Fusarium graminearum secreted protein Osp24. The application is to block the interaction between the wheat Fusarium head blight resistance protein TaSnRK1α and the Fusarium graminearum secreted protein Osp24 by mutating the valine at position 479 of the sequence shown in SEQ ID NO: 2. Further, the mutation includes amino acid substitution or deletion.
[0013] On the other hand, the present invention provides a method for blocking the interaction between the wheat scab resistance protein TaSnRK1α and the Fusarium graminearum secreted protein Osp24, and the method comprises the following steps: mutating the valine at the 479th position of the sequence shown in SEQ ID NO: 2 into other amino acids, so as to block the interaction between the wheat scab resistance protein TaSnRK1α and the Fusarium graminearum secreted protein Osp24.
[0014] Further, the mutation is mutating the valine at the 479th position of the sequence shown in SEQ ID NO: 2 into alanine.
[0015] Beneficial effects of the present invention:
[0016] The present invention provides the key region for the interaction between the wheat scab resistance protein TaSnRK1α and the Fusarium graminearum secreted protein Osp24, and precisely identifies that the valine at the 479th position of the TaSnRK1α protein is the site determining the interaction with Osp24. After the valine at the 479th position of the TaSnRK1α protein is mutated, the interaction with Osp24 disappears, and the targeting of the pathogenic bacterium protein is successfully blocked. The identification of this site provides an ideal molecular target for precisely modifying TaSnRK1α by using the CRISPR-Cas9 technology, blocking the targeting and inhibition of the pathogenic bacterium, and creating scab resistance materials.
[0017] On the other hand, the present invention provides an innovative idea for modifying the functionally conserved regulatory genes of wheat and improving disease resistance. By precisely identifying the sites where proteins play a core role in disease resistance regulation and combining the CRISPR-Cas9 gene editing technology to finely regulate these key sites, the disease resistance of crops can be improved without affecting the normal physiological functions of plants. This provides an efficient and precise gene improvement scheme for the field of agricultural biotechnology. Description of the drawings
[0018] Figure 1 It is a schematic diagram of the TaSnRK1α protein domain. "KD" is "Kinase Domain", indicating the kinase domain; "NKR" is "Non-kinase Region", indicating the non-kinase region.
[0019] Figure 2 It is a schematic diagram of the segmented non-kinase region of the TaSnRK1α protein and the result diagram of the interaction with Osp24. Figure 2 a is a schematic diagram of the segmented non-kinase region of the TaSnRK1α protein and the interaction intensity with Osp24. "+" or "-" indicates the interaction situation. Specifically, "+++" indicates strong interaction, "+" indicates weak interaction, and "-" indicates no interaction. Figure 2 b is a yeast two-hybrid result diagram of the interaction between different truncated forms of the TaSnRK1α protein and Osp24.
[0020] Figure 3 Schematic diagram of the amino acid sequence alignment of the non-kinase regions of TaSnRK1α with its homologous proteins TaSnRK1α2, TaSnRK1α3, and TaSnRK1α4. "TaSnRK1α381-500aa" represents the key region in the TaSnRK1α protein that mediates strong interaction with Osp24.
[0021] Figure 4 Schematic diagram of the sequence division of the TaSnRK1α381-500aa region and the corresponding conserved regions in the homologous proteins TaSnRK1α2, TaSnRK1α3, and TaSnRK1α4, and the interaction results with Osp24. "+++" indicates strong interaction, and "-" indicates no interaction.
[0022] Figure 5 Amino acid sequence alignment of the TaSnRK1α381-500aa region with the corresponding conserved regions in the homologous proteins TaSnRK1α2, TaSnRK1α3, and TaSnRK1α4. "396I", "444I", "462I", "479V", "483Q", and "495T" represent the sites where TaSnRK1α is the same as TaSnRK1α3 and TaSnRK1α4 and different from TaSnRK1α2 in the illustrated region.
[0023] Figure 6 Schematic diagram of the interaction of the TaSnRK1α381-500aa region with Osp24 after the amino acids at the "396I", "444I", "462I", "479V", "483Q", and "495T" sites are mutated to the corresponding amino acids of TaSnRK1α2. "+++" indicates strong interaction, "++" indicates that the interaction intensity is slightly lower than "+++", and "-" indicates no interaction.
[0024] Figure 7 Result diagram for verifying that the valine at the 479th position in TaSnRK1α is the key site determining the interaction with Osp24. Detailed implementation manner
[0025] To better understand the technical content of the present invention, the present invention will be further described below in conjunction with specific embodiments and drawings.
[0026] Embodiment 1
[0027] In this embodiment, the key region of the interaction between the wheat scab resistance protein TaSnRK1α and the core pathogenic secretion protein Osp24 of Fusarium graminearum was identified.
[0028] The nucleotide sequence of the wheat sucrose non-fermenting-1-related protein kinase 1 catalytic subunit α gene TaSnRK1α is shown in SEQ ID NO: 1, and the nucleotide sequence of the secreted protein gene Osp24 is shown in SEQ ID NO: 9. Based on this, specific primers TaSnRK1α1-F (5'ATGGACGCAGCAGGCAGAG 3') and TaSnRK1α1-R (5'TCAAAGGACTCTCAGCTGGGTTAGG 3') for TaSnRK1α1, and specific primers Osp24-F (5'ATGGTTGCGCCATCCACTG 3') and Osp24-R (5'TCACAAGCTCGAGCGGTAGCAAAG 3') for Osp24 were designed. Homologous arms for one-step cloning of the yeast two-hybrid vectors pKADT7 and pKBKT7 were added to the 5' ends of the TaSnRK1α and Osp24 primers respectively.
[0029] Using the Norm wheat variety grown in normal soil in the greenhouse as the material, the wild-type strain PH-1 of Fusarium graminearum was inoculated on the wheat ears at the flowering stage. After 3 days, the spikelets were taken, total RNA was extracted, and it was reverse-transcribed into cDNA as the template for PCR amplification. Using FastPfu DNA Polymerase (TransGen Biotech Co., Ltd., Beijing), the PCR reaction system is shown in Table 1.
[0030] Table 1. PCR reaction system for TaSnRK1α gene
[0031]
[0032]
[0033] The PCR reaction program was: pre-denaturation at 95°C for 5 min; 95°C for 30 sec, 58.5°C for 40 sec, 72°C for 1 min, for 35 cycles; additional extension at 72°C for 10 min.
[0034] The PCR products were subjected to Sanger sequencing to confirm that the nucleotide sequence of the wheat sucrose non-fermenting-1-related protein kinase 1 catalytic subunit α gene TaSnRK1α obtained was consistent with SEQ ID NO: 1, and the encoded amino acid sequence was consistent with SEQ ID NO: 2. The nucleotide sequence of the secreted protein gene Osp24 was consistent with SEQ ID NO: 9, and the encoded amino acid sequence was consistent with SEQ ID NO: 10.
[0035] Using the yeast two-hybrid system, the interaction region between TaSnRK1α and Osp24 was explored. TaSnRK1α consists of a kinase domain at the amino terminus (1 - 266aa) and a non-kinase domain at the carboxyl terminus (267 - 500aa). It is known that the non-kinase region 267 - 500aa of TaSnRK1α is the interaction region with Osp24( Figure 1 ). Further, the non-kinase region of TaSnRK1α was evenly divided into three segments: 267 - 344aa (TaSnRK1α1 M1 ), 268 - 423aa (TaSnRK1α1 M2 ), and 424 - 500aa (TaSnRK1α1 M3 ) to identify the key region mediating the interaction with Osp24. Using the constructed TaSnRK1α1-pKADT7 as a template, DNA fragments of the above three regions were amplified by PCR and constructed into the pKADT7 vector respectively. The yeast two-hybrid results showed( Figure 2 ), TaSnRK1α1 M1 and TaSnRK1α1 M2 did not interact with Osp24, only TaSnRK1α1 M3 had a weak interaction with Osp24, indicating that the 424 - 500aa at the carboxyl terminus of TaSnRK1α was crucial for its interaction with Osp24, and there were important motifs mediating the strong interaction between the two in the M1 or M2 region.
[0036] Alignment of the amino acid sequences of the non-kinase regions of TaSnRK1α with its homologous proteins TaSnRK1α2, TaSnRK1α3, and TaSnRK1α4 found( Figure 3 ), outside the above 424 - 500aa region, there was a relatively long conserved region 381 - 500aa (TaSnRK1α1 M4 ). The yeast two-hybrid experimental results showed( Figure 2 ), the interaction intensity of TaSnRK1α1 M4 with Osp24 was equivalent to that of the full-length TaSnRK1α, indicating that the 381 - 500aa region of TaSnRK1α was the key region mediating its strong interaction with Osp24.
[0037] Example 2
[0038] This example describes the identification of the key interaction sites between the wheat scab resistance protein TaSnRK1α and the Fusarium graminearum secreted protein Osp24.
[0039] By comparing the sequence differences of TaSnRK1α homologous proteins and their interaction with Osp24, the key sites affecting the interaction between TaSnRK1α and Osp24 were identified.
[0040] Select the conserved regions of the homologous proteins TaSnRK1α2 (the nucleotide sequence is shown in SEQ ID NO: 3 and the amino acid sequence is shown in SEQ ID NO: 4), TaSnRK1α3 (the nucleotide sequence is shown in SEQ ID NO: 5 and the amino acid sequence is shown in SEQ ID NO: 6), and TaSnRK1α4 (the nucleotide sequence is shown in SEQ ID NO: 7 and the amino acid sequence is shown in SEQ ID NO: 8) corresponding to the above TaSnRK1α381-500aa region, specifically TaSnRK1α2 384-503aa (TaSnRK1α2 M1 ), TaSnRK1α3 392-513aa (TaSnRK1α3 M1 ), and TaSnRK1α4 391-512aa (TaSnRK1α4 M1 ). Referring to Example 1, construct the corresponding pGADT7 vector. The results of the yeast two-hybrid experiment showed ( Figure 4 ), TaSnRK1α3 M1 interacted with Osp24, and the interaction intensity with TaSnRK1α and Osp24 was comparable, while TaSnRK1α2 M1 did not interact with Osp24. M1
[0041] Comparing the amino acid sequences of TaSnRK1α M4 , TaSnRK1α2 M1 , TaSnRK1α3 M1 , and TaSnRK1α4 M1 , it was found that there were 6 sites conserved in TaSnRK1α M4 , TaSnRK1α3 M1 , and TaSnRK1α4 M1 , but not conserved in TaSnRK1α2 M1 , which were 396I, 444I, 462I, 479V, 483Q, 495T in TaSnRK1α1 M4 ( Figure 5 ).
[0042] Change the above 6 sites in the TaSnRK1α1 M4 region into the form of TaSnRK1α2 M1 respectively, that is, TaSnRK1α M4 -I396V, TaSnRK1α M4 -I444P, TaSnRK1α M4 -I462L, TaSnRK1α M4 -V479A, TaSnRK1αM4 -Q483H and TaSnRK1α M4 -T495A, respectively construct the pGADT7 vector. The results of the yeast two-hybrid experiment showed ( Figure 6 ), after the valine (V) at the 479th position of TaSnRK1α M4 was changed to alanine (A), the interaction with Osp24 disappeared. In contrast, mutations at other sites did not significantly affect the interaction between TaSnRK1α M4 and Osp24. Further, after the valine at the 479th position of full-length TaSnRK1α was mutated to alanine (TaSnRK1α479V-A), it also did not interact with Osp24 ( Figure 7 ).
[0043] Further, the corresponding alanine in TaSnRK1α2 M1 was changed to valine (TaSnRK1α2 M1 -A482V). The results of the yeast two-hybrid showed ( Figure 7 ), the interaction between TaSnRK1α2 M1 and Osp24 changed from non-interaction to interaction. In summary, the valine at the 479th position of TaSnRK1α1 is the key site determining its interaction with Osp24.
[0044] The mutation of the valine at the 479th position of TaSnRK1α results in the loss of its interaction with the Fusarium graminearum secreted protein Osp24. Fusarium graminearum cannot promote pathogenesis by targeting and inhibiting the function of TaSnRK1α. Therefore, in the future, the CRISPR-Cas9 technology can be used to precisely edit the valine at the 479th position of TaSnRK1α, thereby blocking the targeting of Fusarium graminearum and improving the resistance of wheat to Fusarium head blight.
[0045] The above are only some embodiments of the present invention and are not intended to limit the present invention. Any modifications, equivalent replacements, improvements, etc. made within the spirit and principle of the present invention shall fall within the protection scope of the present invention.
Claims
1. The key region of interaction between wheat fusarium head blight resistance protein TaSnRK1α and Fusarium graminearum secretory protein Osp24 is characterized by: The key interaction region is located at positions 381-500 of the sequence shown in SEQ ID NO: 2, positions 392-513 of the sequence shown in SEQ ID NO: 6, or positions 391-512 of the sequence shown in SEQ ID NO:
8.
2. The key site for the interaction between wheat fusarium head blight resistance protein TaSnRK1α and Fusarium graminearum secretory protein Osp24 is characterized by: The key interaction site is located at position 479 of the sequence shown in SEQ ID NO:
2.
3. Use of the key interaction region according to claim 1 in blocking the interaction between the wheat fusarium head blight resistance protein TaSnRK1α and the Fusarium graminearum secretory protein Osp24.
4. Use of the key interaction site described in claim 2 in blocking the interaction between the wheat fusarium head blight resistance protein TaSnRK1α and the Fusarium graminearum secretory protein Osp24.
5. The use according to claim 3 or claim 4, characterized in that: The application is to mutate the valine at position 479 of the sequence shown in SEQ ID NO: 2, thereby blocking the interaction between the wheat fusarium head blight resistance protein TaSnRK1α and the Fusarium graminearum secretory protein Osp24.
6. The use according to claim 5, characterized in that: The mutation includes amino acid substitution or deletion.
7. A method for blocking the interaction between wheat fusarium head blight resistance protein TaSnRK1α and Fusarium graminearum secretory protein Osp24, characterized in that: The amino acid sequence of TaSnRK1α is shown in SEQ ID NO: 2, and the amino acid sequence of Osp24 is shown in SEQ ID NO. 10; The method comprises the following steps: mutating the valine at position 479 of the sequence shown in SEQ ID NO: 2 to other amino acids, thereby blocking the interaction between the wheat fusarium head blight resistance protein TaSnRK1α and the Fusarium graminearum secretory protein Osp24.
8. The method according to claim 7, characterized in that The mutation is to mutate the valine at position 479 of the sequence shown in SEQ ID NO: 2 to alanine.
Citation Information
Patent Citations
Biological material for regulating TaWRKY24 protein coding gene expression and application thereof
CN117821499A
Application of wheat TaSnRK1 protein and related biological materials thereof in improving heat resistance of plants
CN118812685A