PagMOM1 gene and application thereof in wood improvement

Abstract

The invention relates to the technical field of gene engineering, in particular to a PagMOM1 gene and application thereof in wood improvement. The nucleotide sequence of the PagMOM1 gene is as shown in SEQ ID No. 1. According to the invention, a gene PagMOM1 in Popus alba * Popus glatulosa (poplar, 84K) is identified, and the PagMOM1 gene is knocked out by utilizing a CRISPR / Cas9 gene editing technology, so that the thickening of a secondary wall can be promoted, the cell expansion can be inhibited, and the characteristics of wood cells can be changed, thereby obtaining an improved forest variety pagmom1 mutant with thickened secondary cell walls and reduced cells.

Description

Technical Field

[0001] The present invention relates to the technical field of genetic engineering, and specifically relates to a PagMOM1 gene and its application in improving wood. Background Art

[0002] The formation of wood results from the secondary growth process of plants, which is mainly driven by the continuous development of secondary xylem. Secondary xylem originates from the vascular cambium and consists of fiber cells and vascular cells with significantly thickened cell walls. In woody plants, after secondary xylem cells stop expanding, a thickened secondary cell wall (SCW) is deposited on the inner side of the primary cell wall. This secondary cell wall is mainly composed of cellulose, hemicellulose, and lignin, which not only provides mechanical support for plants but also undertakes the functions of transporting water and nutrients in conduit cells. The formation of the secondary cell wall involves a series of complex biosynthetic pathway enzymes, and its development process directly affects the structure and properties of wood. Therefore, studying the molecular mechanism of secondary growth is of great significance for understanding plant development laws, improving wood quality, and developing new biomaterials.

[0003] The MOM1 protein is an important non-classical epigenetic regulator, which plays a key role in plant genome stability, gene expression regulation, transposon silencing, and environmental adaptability. Different from classical epigenetic regulators (such as DNA methyltransferases or histone modification enzymes), the function of the MOM1 protein does not completely depend on DNA methylation, but regulates gene expression by affecting chromatin structure and dynamics. The study of MOM1 in plants originated from the screening of epigenetic mutants in Arabidopsis thaliana. In mom1 mutants, transposons and some repetitive sequence genes in the silent state are abnormally activated, while the DNA methylation state does not change significantly. This phenomenon indicates that MOM1 may participate in epigenetic regulation through a mechanism independent of DNA methylation. In the study of Arabidopsis thaliana, it was found that the MOM1 complex participates in the RdDM pathway by interacting with the MORC6 protein and plays an important role in DNA methylation and gene silencing. However, currently, there is little research on MOM1 genes in woody plants, and the functional mechanism it plays in the formation and development of xylem still needs to be further explored. Summary of the Invention

[0004] Aiming at the above deficiencies in the prior art, the purpose of the present invention is to provide a PagMOM1 gene and its application in improving wood. The present invention identified Populus alba×Populus glandulosa a gene in PagMOM1 Populus alba × Populus glandulosa (84K), and determined its function in the process of wood formation through CRISPR / Cas9 gene editing technology.

[0005] To achieve the above-mentioned invention object, the technical solution adopted by the present invention is as follows: On the one hand, there is provided a PagMOM1 gene, whose nucleotide sequence is as shown in SEQ ID No.1.

[0006] On the other hand, there is provided PagMOM1 the application of the gene in improving wood. Deleting PagMOM1 the gene can promote the thickening of the secondary wall, inhibit cell expansion, change the characteristics of wood cells, and thus obtain fine tree varieties with thickened secondary cell walls and smaller cells pagmom1 mutants.

[0007] Furthermore, PagMOM1 the method for improving wood with the gene specifically includes the following steps: Step 1: Clone PagMOM1 the gene and design target primers; Step 2: Construct a gRNA expression cassette, connect the gRNA expression cassette to the pYLCRISPR / Cas9 vector, and construct PagMOM1 a gene knockout vector; Step 3: Transfer the constructed PagMOM1 gene knockout vector into Agrobacterium tumefaciens GV3101, and use the Agrobacterium-mediated method to infect, proliferate, differentiate, and root-culture the leaves of Populus alba×Populus glandulosa tissue culture seedlings to obtain fine tree varieties pagmom1 mutants.

[0008] Furthermore, in Step 1, the target primers are MOM1-AtU3dT1F, MOM1-AtU3dT1R, MOM1-AtU3bT2F, MOM1-AtU3bT2R, and their nucleotide sequences are as follows: MOM1-AtU3dT1F GTCATAGTCGCAAAGCTAAGGCTG; MOM1-AtU3dT1R AAACCAGCCTTAGCTTTGCGACTA; MOM1-AtU3bT2F GTCATGCACTCCATCTGATAAGTC; MOM1-AtU3bT2R AAACGACTTATCAGATGGAGTGCA.

[0009] The beneficial effects of the present invention are as follows: The present invention has identified a gene in Populus alba×Populus glandulosa (84K), and uses the CRISPR / Cas9 gene editing technology to knockout PagMOM1 , PagMOM1Genes that can promote secondary wall thickening, inhibit cell expansion, and change the characteristics of wood cells, thereby obtaining improved forest tree varieties with thickened secondary cell walls and smaller cells pagmom1 mutants. BRIEF DESCRIPTION OF THE DRAWINGS

[0010] Figure 1 For PagMOM1 gene knockout lines mom1-6 , mom1-9 , mom1-10 sequencing identification diagrams; Figure 2 For wild-type Populus alba × P. glandulosa and pagmom1 plant phenotype diagrams of Populus alba × P. glandulosa mutants; Figure 3 For wild-type Populus alba × P. glandulosa and pagmom1 schematic diagram of the comparison of plant height and basal stem diameter of Populus alba × P. glandulosa mutants; Figure 4 For wild-type Populus alba × P. glandulosa and pagmom1 optical micrographs of sections of Populus alba × P. glandulosa mutants; Figure 5 For wild-type Populus alba × P. glandulosa and pagmom1 schematic diagram of the comparison of xylem width between Populus alba × P. glandulosa mutants; Figure 6 For wild-type Populus alba × P. glandulosa and pagmom1 scanning electron micrographs of Populus alba × P. glandulosa mutants; Figure 7 For wild-type Populus alba × P. glandulosa and pagmom1 schematic diagram of the comparison of the sizes of vessel and fiber cells between Populus alba × P. glandulosa mutants; Figure 8 For wild-type Populus alba × P. glandulosa and pagmom1 schematic diagram of the comparison of the wall thicknesses of vessel and fiber cells between Populus alba × P. glandulosa mutants. DETAILED DESCRIPTION OF THE INVENTION

[0011] The following describes the specific embodiments of the present invention to facilitate those skilled in the art of the present technology to understand the present invention. However, it should be clear that the present invention is not limited to the scope of the specific embodiments. For those of ordinary skill in the art of the present technology, as long as various changes are within the spirit and scope of the present invention defined and determined by the appended claims, these changes are obvious, and all inventions made using the concept of the present invention are within the scope of protection.

[0012] Example 1 PagMOM1 Construction of the gene knockout vector: (1) Design of target primers: Using the Populus alba × P. glandulosa genomic sequence as a template, primers MOM1-F and MOM1-R for cloning the first 1700 bp length of this gene were designed according to its genomic sequence to clone PagMOM1 gene.PagMOM1 The nucleotide sequence of the gene is shown in SEQ ID No.1. Based on the consideration of the GC content, target primers MOM1-AtU3dT1F, MOM1-AtU3dT1R, MOM1-AtU3bT2F, and MOM1-AtU3bT2R were designed at the first coding region of non-SNP (Single nucleotide polymorphism site) sites. Their nucleotide sequences are as follows: MOM1-F: TACAGTATGGGAAATGATGCTAAAG; MOM1-R: CAGTAGACCCCAACAGGTAAAGAG; MOM1-AtU3dT1F: GTCATAGTCGCAAAGCTAAGGCTG; MOM1-AtU3dT1R: AAACCAGCCTTAGCTTTGCGACTA; MOM1-AtU3bT2F: GTCATGCACTCCATCTGATAAGTC; MOM1-AtU3bT2R: AAACGACTTATCAGATGGAGTGCA.

[0013] (2) Preparation of target adaptors: Dilute the target primers to 10 μM with double-distilled water. Take 10 μl each of the forward and reverse adaptors, mix them, denature at 94 °C for 30 s, and cool down to room temperature by gradient cooling to form double strands.

[0014] (3) Ligation of target primers to the gRNA expression cassette (cutting and ligating method):

[0015] Reaction conditions: 37 °C for 5 min, 20 °C for 5 min, 8 cycles.

[0016] (3) Two-round nested PCR amplification: For the first round of PCR, use the universal U-F / gRNA-R for 1 reaction, and for the second round of PCR, use specific primers for amplification. This protocol has good and stable amplification effects.

[0017] The universal primers for the first round of amplification are: U-F: CTCCGTTTTACCTGTGGAATCG; gRNA-R: CGGAGGAAAATTCCATCCAC.

[0018] The specific primers for the second round of amplification are: B1’: TTCAGAGGTCTCTCTCGACTAGTGGAATCGGCAGCAAAGG; B2: AGCGTGGGTCTCGTCAGGGTCCATCCACTCCAAGCTC; B2’: TTCAGAGGTCTCTCTGACACTGGAATCGGCAGCAAAGG; BL: AGCGTGGGTCTCGACCGACGCGTCCATCCACTCCAAGCTC.

[0019] The first-round PCR amplification system:

[0020] Reaction conditions: 95°C for 1 min; 98°C for 15 s, 55°C for 15 s, 68°C for 10 s, 10 cycles; 98°C for 10 s, 65°C for 15 s, 68°C for 10 s, 20 cycles.

[0021] Take 5 μl of the PCR product and perform 1% agarose gel electrophoresis for detection; and take 1 μl of the PCR product, dilute it 10 times with ddH 2 2O and pipette 1 μl from it as the template for the second-round PCR reaction.

[0022] The second-round PCR amplification system:

[0023] Reaction conditions: 98°C for 10 s, 60°C for 15 s, 68°C for 30 s, 25 cycles.

[0024] Take 5 μl of the PCR product and perform 1% agarose gel electrophoresis for detection, and purify and recover the remaining product.

[0025] (5) Connect the gRNA expression cassette to the pYLCRISPR / Cas9 vector:

[0026] Reaction conditions: 37°C for 10 min; 37°C for 5 min, 10°C for 5 min, 20°C for 5 min, 15 cycles.

[0027] Transform the ligation product into Escherichia coli, spread it on solid LB medium with kanamycin resistance, and wait for monoclonal colonies to grow overnight for identification.

[0028] (6) Identification of the vector: Extract the plasmid from the colony and use the SP-DL primer for sequencing to verify the correctness of the constructed vector.

[0029] SP-DL: GTCGTGCTCCACATGTTGACCG。

[0030] Example 2 Genetic transformation of Populus alba×P. glandulosa: The constructed vector plasmid was transformed into Agrobacterium tumefaciens GV3101 by heat shock method. The genetic transformation of Populus alba×P. glandulosa was carried out by Agrobacterium-mediated method. Agrobacterium cells were picked and cultured overnight in 5 mL LB (50 mg / L rifampicin + 50 mg / L kanamycin) liquid medium at 28 °C in an oscillating incubator until the OD600 value reached 0.8. 1 mL was taken and added to 100 mL LB (50 mg / L rifampicin + 50 mg / L kanamycin) liquid medium for subculture until OD600 = 0.4 - 0.5. The infected leaves used were the well-grown leaves of Populus alba×P. glandulosa tissue culture seedlings about 4 weeks old. The veins were transversely cut with a scalpel and infected in Agrobacterium for 12 min, then transferred to the co-culture medium for dark culture for 2 - 3 d and then transferred to the selection medium (hygromycin at 3 mg / L) for dark culture until callus grew. When the callus grew to about 0.5 cm, the callus was transferred to the differentiation medium (hygromycin at 3 mg / L). When the bud height reached 1 cm, the bud was transferred to the rooting medium to induce rooting. Subculture was carried out in the rooting medium.

[0031] Example 3 PagMOM1 Identification of gene knockout lines: Genomic DNA of wild type and transgenic plants was extracted and used as a template for amplification with gene sequencing primers MOM1-F and MOM1-R. The amplification products were ligated to T vectors and transformed into Escherichia coli. Single colonies were picked and sent to the company for sequencing. The sequencing results are as Figure 1 shown. A total of three different types of mutants were identified and named mom1-6 , mom1-9 and mom1-10 respectively. Base insertions or deletions existed in the PagMOM1 gene on both chromosomes, and this position was close to the transcription start site.

[0032] Example 4 PagMOM1 Phenotype observation of gene knockout lines: The PagMOM1 gene knockout plants and wild type plants were planted in the climate chamber at the same time. A total of three batches were planted. After growing for about 45 days, phenotypic observation, photographing, microscopic section observation, scanning electron microscopy observation and statistics were carried out on the plants of different batches respectively. As Figure 2 shown, the plant phenotype diagrams of wild type Populus alba×P. glandulosa (WT) and pagmom1 mutant Populus alba×P. glandulosa are shown. Compared with the wild type, PagMOM1The height of the gene knockout plants was reduced ( Figure 3 ). To observe the changes in its secondary growth, the basal stem segments of the plants were taken for vibration slicing, with a slice thickness of 50 μm. Immediately after slicing, TBO (toluidine blue) staining was performed, and after washing off the floating color, ordinary optical photography was carried out for observation. As Figure 4 shown, compared with the WT, PagMOM1 the secondary growth of the gene knockout lines was significantly slower, and the width of the xylem became narrower ( Figure 5 ). Compared with the WT, its vessel and fiber cells were significantly smaller, and the statistical results are as Figure 7 shown. Scanning electron microscopy observation of the 14th internode found that ( Figure 6 ), PagMOM1 the thickness of the vessel and fiber cell walls of the gene knockout plants was significantly thicker ( Figure 8 ). The above results indicate that PagMOM1 the gene plays a certain regulatory role in xylem development, and its deletion can promote secondary wall thickening and inhibit cell expansion.

[0033] In summary, the present invention identified a gene in Populus alba×Populus glandulosa (84K silver gland poplar) PagMOM1 , and using the CRISPR / Cas9 gene editing technology to knockout PagMOM1 the gene can promote secondary wall thickening, inhibit cell expansion, change the characteristics of wood cells, and thus obtain excellent forest tree varieties with thickened secondary cell walls and smaller cells pagmom1 mutants.

[0034] For those skilled in the art, it is obvious that the present invention is not limited to the details of the above exemplary embodiments, and without departing from the spirit or basic characteristics of the present invention, the present invention can be implemented in other specific forms. Therefore, in any regard, the embodiments should be regarded as exemplary and non-limiting. The scope of the present invention is defined by the appended claims rather than the above description. Therefore, it is intended to include all changes falling within the meaning and scope of the equivalent elements of the claims in the present invention.

[0035] In addition, it should be understood that although this specification is described according to the embodiments, not every embodiment only contains an independent technical solution. This narrative way of the specification is only for clarity. Those skilled in the art should regard the specification as a whole, and the technical solutions in each embodiment can also be appropriately combined to form other embodiments that can be understood by those skilled in the art.

Claims

1. A PagMOM1 A gene characterized by Its nucleotide sequence is shown in SEQ ID No.

1.

2. The method according to claim 1 PagMOM1 The application of genes in improving wood is characterized by: Missing PagMOM1 The gene can promote the thickening of secondary walls, inhibit cell expansion, and change the characteristics of wood cells, thereby obtaining forest mutants with thickened secondary cell walls and smaller cells.

3. The use according to claim 2, characterized in that: PagMOM1 The method for genetically modifying wood specifically comprises the following steps: Step 1. Clone PagMOM1 Gene and design target primers; Step 2: Construct a gRNA expression cassette and connect the gRNA expression cassette to the pYLCRISPR / Cas9 vector to construct PagMOM1 Gene knockout vectors; Step 3: PagMOM1 The gene knockout vector was transferred into Agrobacterium GV3101, and the leaves of Populus argentatus tissue culture seedlings were infected, proliferated, differentiated, and rooted by Agrobacterium-mediated method to obtain forest tree varieties. pagmom1 Mutant.

4. The use according to claim 3, characterized in that: In step 1, the target primers are MOM1-AtU3dT1F, MOM1-AtU3dT1R, MOM1-AtU3bT2F, MOM1-AtU3bT2R, and their nucleotide sequences are as follows: MOM1-AtU3dT1F GTCATAGTCGCAAAGCTAAGGCTG; MOM1-AtU3dT1R AAACCAGCCTAGCTTTGCGACTA; MOM1-AtU3bT2F GTCATGCACTCCATCTGATAAGTC; MOM1-AtU3bT2RAAACGACTTATCAGATGGAGTGCA.

Images