Method for representing intracellular NADPH generation amount of yarrowia lipolytica through xylose consumption

Abstract

The invention relates to a method for characterizing intracellular NADPH (Nicotinamide Adenine Dinucleotide Phosphate) generation amount of yarrowia lipolytica through xylose consumption, and belongs to the technical field of biology. According to the method, the yarrowia lipolytica overexpressing xylose reductase, xylitol dehydrogenase and xylulokinase is inoculated into a culture medium taking xylose as a unique carbon source for culture, and a linear relation between the xylose consumption and the NADPH generation amount is established, so that the generation level of the NADPH can be represented by measuring the xylose consumption in the culture medium. The invention provides an effective method for characterizing the intracellular NADPH level of the yarrowia lipolytica, the intracellular NADPH level can be characterized only by detecting the consumption of xylose, and the detection method is simple and efficient.

Description

Technical Field

[0001] The present invention relates to the field of biotechnology, and in particular to a method for characterizing the intracellular NADPH production amount of Yarrowia lipolytica by the xylose consumption amount. Background Art

[0002] Reduced nicotinamide adenine dinucleotide phosphate (NADPH) is an important cofactor and energy source in microbial cells. It directly participates in 1058 biochemical reactions catalyzed by 586 enzymes in the cell in the form of hydrogen and electron donor / carrier (Updated at Dec 16, 2021; www.kegg.com). These reactions affect the metabolism, signal transduction and substrate transport of microbial substances through the regeneration and competitive utilization of NADPH. The supply of NADPH is considered to be one of the key factors affecting the synthesis of reducing substances (such as fatty acids and sterols) in microorganisms. Therefore, it is very important to monitor the intracellular NADPH level of Yarrowia lipolytica in real time.

[0003] However, NADPH is difficult to extract and has poor stability. There are large errors in characterizing intracellular NADPH by conventional delayed cell wall breaking extraction detection methods. The oxidation reaction system in yeast composed of transcription factor Yap1p, thioredoxin, glutathione and reductase uses NADPH as the final electron donor, and the NADPH / NADP + level can specifically regulate the oxidation / reduction state of thioredoxin and glutathione, thereby changing the conformation of Yap1p and regulating its distribution and transcriptional potential in the cytoplasm and nucleus. The team of Professor Jay D. Keasling at the University of California, Berkeley developed a biosensor that can respond to NADPH / NADP + in Saccharomyces cerevisiae using this mechanism, and used the expression intensity of fluorescent protein GFP to characterize the intracellular NADPH level. However, Yarrowia lipolytica can synthesize lipids accounting for more than 38% of the cell dry weight. The lipids accumulated in the cells of Yarrowia lipolytica will produce fluorescence background interference, resulting in the method of using the sensor to express GFP to characterize the cytoplasmic NADPH level being inapplicable to Yarrowia lipolytica. In addition, there is also a method to detect the NADPH content through a coenzyme II NADP(H) content kit, but this kit is expensive and the detection process is complex. Therefore, developing a method for characterizing the intracellular NADPH level applicable to Yarrowia lipolytica is crucial for monitoring its intracellular NADPH level. Summary of the Invention

[0004] Therefore, the technical problem to be solved by the present invention is to overcome the lack of a method for characterizing the intracellular NADPH production amount of Yarrowia lipolytica by the xylose consumption amount in the prior art.

[0005] To solve the above technical problems, the present invention provides a method for characterizing the intracellular NADPH production of Yarrowia lipolytica by the xylose consumption. Based on the recombinant Yarrowia lipolytica overexpressing xylose reductase, xylitol dehydrogenase, and xylulokinase, the recombinant Yarrowia lipolytica is inoculated into a medium with xylose as the sole carbon source for fermentation, and the intracellular NADPH production of Yarrowia lipolytica is monitored by measuring the xylose consumption. The genome of Yarrowia lipolytica contains genes encoding xylose reductase, xylitol dehydrogenase, and xylulokinase, but due to insufficient expression levels, Yarrowia lipolytica cannot grow in a medium with xylose as the sole carbon source. In the present invention, xylose is used as the sole carbon source. Compared with other substrates such as glucose and starch, xylose as the initial substrate has a simple detection method for its consumption. During the process of reducing xylose to xylitol, NADPH is consumed, so the xylose consumption can be directly correlated with the NADPH production. In addition, in addition to overexpressing xylose reductase, xylitol dehydrogenase, and xylulokinase, the present invention also overexpresses glucose-6-phosphate dehydrogenase and 6-phosphogluconate dehydrogenase, resulting in an increase in the produced NADPH, and the xylose consumption increases with the increase in NADPH, demonstrating the feasibility of coupling the NADPH production by detecting the xylose consumption. Therefore, the present invention provides an effective method for characterizing the intracellular NADPH level of Yarrowia lipolytica. Only by detecting the xylose consumption can the NADPH production be reflected, and the detection method is simple and efficient.

[0006] The first object of the present invention is to provide a method for characterizing the intracellular NADPH production of Yarrowia lipolytica by the xylose consumption, comprising the following steps:

[0007] S1. Introduce the gene sequences encoding xylose reductase, xylitol dehydrogenase, and xylulokinase into a plasmid to form a recombinant plasmid, and introduce the recombinant plasmid into Yarrowia lipolytica to obtain recombinant Yarrowia lipolytica;

[0008] S2. Inoculate the recombinant strain into a medium with xylose as the sole carbon source for fermentation culture, detect the NADPH production and xylose consumption, and obtain the linear relationship between the xylose consumption and the NADPH production.

[0009] Further, in step S1, the recombinant Yarrowia lipolytica overexpresses the glucose-6-phosphate dehydrogenase encoding gene and 6-phosphogluconate dehydrogenase.

[0010] Further, in step S1, the copy number of the xylose reductase is 1 or 2.

[0011] Furthermore, the NCBI number of the gene sequence encoding xylose reductase is YALI1_D09870g, the NCBI number of the gene sequence encoding xylitol dehydrogenase is YALI1_E15452g, and the NCBI number of the gene sequence encoding xylulokinase is YALI1_F14583g.

[0012] Furthermore, the NCBI number of the gene encoding 6-phosphogluconate dehydrogenase is YALI1_E26811g, and the NCBI number of the gene encoding 6-phosphogluconic acid dehydrogenase is YALI1_B20462g.

[0013] Furthermore, the Yarrowia lipolytica yeast includes Yarrowia lipolytica po1f.

[0014] Furthermore, the Ku70 gene of the Yarrowia lipolytica po1f yeast is knocked out.

[0015] Furthermore, the NCBI number of the Ku70 gene is YALI1_C11925g.

[0016] Furthermore, the temperature of the fermentation culture in step S1 is 25 - 30°C.

[0017] Furthermore, the inoculation amount of the recombinant bacteria is 1% - 3% of the medium volume ratio.

[0018] The second object of the present invention is to provide a method for quantitatively detecting NADPH, comprising the following steps:

[0019] (1) Inoculate the recombinant Yarrowia lipolytica yeast in a medium with xylose as the sole carbon source for fermentation culture, detect the amount of NADPH generated and the amount of xylose consumed, and obtain a standard curve of the xylose consumption amount and the NADPH generation amount;

[0020] (2) Inoculate the recombinant Yarrowia lipolytica yeast in (1) in a medium with xylose as the sole carbon source for fermentation culture, detect the xylose consumption amount and substitute it into the standard curve in (1) to obtain the amount of NADPH generated.

[0021] Furthermore, the recombinant Yarrowia lipolytica yeast overexpresses 6-phosphogluconate dehydrogenase and 6-phosphogluconic acid dehydrogenase.

[0022] The beneficial effects of the present invention:

[0023] The present invention provides a method for characterizing the intracellular NADPH production of Yarrowia lipolytica by the consumption of xylose. The production of NADPH is reflected by detecting the consumption of xylose in a medium with xylose as the sole carbon source, and then the intracellular NADPH level of Yarrowia lipolytica is characterized by the production of NADPH. In the present invention, Yarrowia lipolytica overexpressing xylose reductase, xylitol dehydrogenase, and xylulokinase is inoculated in a medium with xylose as the sole carbon source for culture, and the production of intracellular NADPH in Yarrowia lipolytica is reflected by detecting the consumption of xylose. The present invention provides an effective method for characterizing the intracellular NADPH level of Yarrowia lipolytica. The intracellular NADPH level can be characterized only by detecting the consumption of xylose, and the detection method is simple and efficient. BRIEF DESCRIPTION OF THE DRAWINGS

[0024] In order to make the content of the present invention easier to be clearly understood, the following further describes the present invention in detail according to the specific embodiments of the present invention in combination with the drawings, wherein

[0025] Figure 1 is the standard curve of xylose consumption and NADPH production;

[0026] Figure 2 is the structural diagram of the recombinant plasmid pYLXP’-XR-XK-XDH-XR;

[0027] Figure 3 is the structural diagram of the recombinant plasmid pYLXP’-XR-XK-XDH-XR-H6PD-6-PGDH;

[0028] Figure 4 is the OD comparison of Yarrowia lipolytica po1fk-pYLXP’-XR-XK-XDH-XR with the control strain; 600 ;

[0029] Figure 5 is the consumption of the substrate xylose by Yarrowia lipolytica po1fk-pYLXP’-XR-XK-XDH-XR-H6PD-6-PGDH (recombinant strain B) and Yarrowia lipolytica po1fk-pYLXP’-XR-XK-XDH-XR (recombinant strain A). DETAILED DESCRIPTION OF THE EMBODIMENTS

[0030] The following further describes the present invention in combination with the drawings and specific embodiments, so that those skilled in the art can better understand the present invention and be able to implement it, but the examples given are not intended to limit the present invention.

[0031] Yarrowia lipolytica po1f is a derivative strain of Yarrowia lipolytica ATCC20460, directly provided by Professor Peng Xu of the University of Maryland, and purchased from Yeastern Biotech (Taiwan) Co., Ltd.; the plasmid pYLXP’ is stored in the laboratory; the xylose standard is purchased from Shanghai Sangon Biotech Co., Ltd., with the product number A600998-0100. Unless otherwise specified, all reagents and media used are commercially available products, and all methods used are conventional methods.

[0032] 1. Medium

[0033] Leucine-deficient plate: 20 g / L glucose, 5 g / L ammonium sulfate, 1.7 g / L yeast nitrogen base without amino acids (YNB), 10 mg / L adenine hemisulfate, 0.05 g / L L-arginine, 0.08 g / L L-aspartic acid, 0.02 g / L L-histidine, 0.05 g / L L-isoleucine, 0.05 g / L L-lysine, 0.02 g / L L-methionine, 0.05 g / L L-phenylalanine, 0.1 g / L L-threonine, 0.05 g / L L-tryptophan, 0.05 g / L L-tyrosine, 0.14 g / L L-valine, 0.1 g / L uracil, 20 g / L agar;

[0034] Seed medium: 15 - 25 g / L xylose, 1.5 - 2.0 g / L yeast nitrogen base without amino acids (YNB), 5 - 10 g / L ammonium sulfate, 0.67 - 0.74 g / L CSM-leu;

[0035] Fermentation medium: 40 - 60 g / L xylose, 1.5 - 2.0 g / L yeast nitrogen base without amino acids (YNB), 1 - 2 g / L ammonium sulfate, 0.67 - 0.74 g / L CSM-leu.

[0036] 2. Detection method

[0037] Xylose residue in the fermentation broth: All samples need to be treated accordingly before measurement. First, centrifuge at 12,000 rpm for 10 min, then take 1 mL of the supernatant, and then filter it through a water-based filter membrane (pore size 0.22 μm) to remove impurities for liquid phase detection.

[0038] High performance liquid chromatography (HPLC) detection parameters, chromatographic column, and detection conditions are: Shimadzu LC-40, RID-40D detector, Bio-Rad HPX-87H chromatographic column (300×7.8 mm); the mobile phase is dilute sulfuric acid; the flow rate is 0.4 mL / min; the injection volume is set to 10 μL; the column temperature is set to 40 °C. Prepare 5 gradient concentrations of the xylose standard and detect the corresponding response values to obtain the standard curve of concentration and absorbance value, with the correlation coefficient R 2The value should be greater than 0.99, and then the xylose content in the sample is determined according to the standard curve.

[0039] Example 1: Construction of recombinant strain

[0040] Taking the plasmid pYLXP-XR as an example for the construction process of the single-gene recombinant plasmid: The plasmid pYLXP’ was digested and linearized with SnaBI and KpnI, and the large DNA fragment was recovered by agarose gel electrophoresis. At the same time, using the Yarrowia lipolytica genome as a template, the target gene XR fragment with homologous arms was amplified by primers XR-F / XR-R (nucleotide sequences are shown in SEQ ID NO: 1 and SEQ ID NO: 2), and then The target gene fragment was inserted into the amplified linearized vector fragment by rapid cloning technology to obtain the recombinant plasmid pYLXP-XR. Using the same method as above, the target gene XDH fragment with homologous arms was amplified by primers XDH-F / XDH-R (nucleotide sequences are shown in SEQ ID NO: 3 and SEQ ID NO: 4) and inserted into the linearized vector obtained by digestion to obtain the recombinant plasmid pYLXP-XDH; the target gene XK fragment with homologous arms was amplified by primers XK-F / XK-R (nucleotide sequences are shown in SEQ ID NO: 5 and SEQ ID NO: 6) and inserted into the linearized vector obtained by digestion to obtain the recombinant plasmid pYLXP-XK;

[0041] Construction process of multi-gene tandem recombinant plasmid: Linearize plasmid pYLXP-XR using Sal I and Nhe I restriction endonucleases, recover the large DNA fragment by agarose gel electrophoresis. Linearize plasmid pYLXP-XK using Sal I and Avr II restriction endonucleases, recover the small DNA fragment by agarose gel electrophoresis. Use the larger of the two recovered DNA fragments as the vector and ligate them using T4 DNA ligase to obtain recombinant plasmid pYLXP-XR-XK. Linearize plasmid pYLXP-XR-XK using Sal I and Nhe I restriction endonucleases, recover the large DNA fragment by agarose gel electrophoresis. Linearize plasmid pYLXP-XDH using Sal I and Avr II restriction endonucleases, recover the small DNA fragment by agarose gel electrophoresis. Use the larger of the two recovered DNA fragments as the vector and ligate them using T4 DNA ligase to obtain recombinant plasmid pYLXP-XR-XK-XDH. Linearize plasmid pYLXP-XR-XK-XDH using Sal I and Nhe I restriction endonucleases, recover the large DNA fragment by agarose gel electrophoresis. Linearize plasmid pYLXP-XR using Sal I and Avr II restriction endonucleases, recover the small DNA fragment by agarose gel electrophoresis. Use the larger of the two recovered DNA fragments as the vector and ligate them using T4 DNA ligase to obtain recombinant plasmid pYLXP-XR-XK-XDH-XR (the structure is shown in Figure 2 ).

[0042] Table 1 Primers and sequences involved in Example 1

[0043]

[0044]

[0045] Example 2: Construction of recombinant strain

[0046] 1. Construction of starting strain

[0047] (1) In this example, the Ku70 gene of Yarrowia lipolytica was knocked out (for the knockout method, see the literature: Iterative integration of multiple-copy pathway genes in Yarrowia lipolytica for heterologous β-carotene production). Based on the original strain MYA2613 (purchased from the American Type Culture Collection, ATCC), after knocking out the coding gene Ku70 responsible for non-homologous recombination, Yarrowia lipolytica Po1fΔKu70 was obtained as the starting strain in this example.

[0048] 2. Construction of recombinant strains

[0049] Using Yarrowia lipolytica Po1fΔKu70 as the starting strain, the Yarrowia lipolytica Po1fΔKu70 strain was cultured in 2 mL of YPD medium until the exponential growth phase (16 - 24 h). The cells in 1 mL of the fermentation broth were collected. After centrifugation to discard the supernatant, 90 μL of 50% (v / v) PEG4000 solution, 5 μL of lithium acetate (2 M), 5 μL of single-stranded DNA (salmon sperm), and 5 μL of the recombinant plasmid pYLXP-XR-XK-XDH-XR obtained in Example 1 were added. After mixing, the mixture was incubated at 37 °C for 1 h and then spread on a leucine-deficient plate to obtain recombinant strain A.

[0050] Example 3: Characterization of xylose consumption and NADPH production

[0051] (1) Pick the recombinant strain A obtained in Example 2 and inoculate it into the seed medium. Culture it at a temperature of 30 °C and a rotation speed of 220 rpm for 48 h to obtain the seed liquid of recombinant strain A.

[0052] (2) Inoculate the seed liquid of recombinant strain A obtained in step (1) into the fermentation medium with xylose as the sole carbon source at an inoculation amount of 1% (v / v). Conduct fermentation culture at a temperature of 30 °C and a rotation speed of 220 rpm. Measure the amount of xylose and NADPH in the medium every 24 h. The measurement method of NADPH is carried out according to the instruction manual of the Beyotime NADP+ / NADPH detection kit. Measure it every 24 h, calculate the increase in xylose consumption and the increase in NADPH production within 24 h, and obtain the standard curve between xylose consumption and NADPH production.

[0053] Example 4: Verification

[0054] (1) The target gene H6PD fragment with homologous arms was amplified by primers H6PD-F / H6PD-R (nucleotide sequences are shown in SEQ ID NO: 7 and SEQ ID NO: 8), and inserted into the linearized vector obtained by digestion with restriction enzymes to obtain the recombinant plasmid pYLXP-H6PD; the target gene 6-PGDH fragment with homologous arms was amplified by primers 6-PGDH-F / 6-PGDH-R (nucleotide sequences are shown in SEQ ID NO: 9 and SEQ ID NO: 10), and inserted into the linearized vector obtained by digestion with restriction enzymes to obtain the recombinant plasmid pYLXP-6-PGDH.

[0055] Using plasmid pYLXP-H6PD as a template, the H6PD expression cassette was amplified by primers PYL01-F / PYL01-R (nucleotide sequences are shown in SEQ ID NO: 11 and SEQ ID NO: 12). At the same time, plasmid pYLXP-XR-XK-XDH-XR was linearized with Avr II restriction enzyme, and then using the fast cloning technology, the target gene fragment was inserted into the enzymatically digested and linearized vector fragment to obtain the recombinant plasmid pYLXP-XR-XK-XDH-XR-H6PD; using plasmid pYLXP-6-PGDH as a template, the 6-PGDH expression cassette was amplified by primers PYL02-F / PYL02-R (nucleotide sequences are shown in SEQ ID NO: 13 and SEQ ID NO: 14). At the same time, plasmid pYLXP-XR-XK-XDH-XR-H6PD was linearized with Avr II restriction enzyme, and then using the fast cloning technology, the target gene fragment was inserted into the enzymatically digested and linearized vector fragment to obtain the recombinant plasmid pYLXP-XR-XK-XDH-XR-H6PD-6-PGDH (the structure is shown in Figure 3 ).

[0056] Table 2 Primers and sequences involved in Example 4

[0057] Primer Sequence Sequence number H6PD-F Cagcactttttgcagtactaaccgcagactggcaccttacccaagttcg SEQ ID NO: 7 H6PD-R Gggacaggccatggaactagtcggtacctcacgaggagcccttggtg SEQ ID NO: 8 6-PGDH-F Ccagcactttttgcagtactaaccgcagactgacacttcaaacatcaagcctg SEQ ID NO: 9 6-PGDH-R Gtggggacaggccatggaactagtcggtaccttaagcatcgtaagtggaagaagaaacc SEQ ID NO: 10 PYL01-F Cctaaatttgatgaaagcctagggagagaccgggttggcggcg SEQ ID NO: 11 PYL01-R Gccgccaacccggtctctgtcgtggacacgggcatctcacttg SEQ ID NO: 12 PYL02-F Ccctaaatttgatgaaagcctaggagagaccgggttggcgg SEQ ID NO: 13 PYL02-R gcgccgccaacccggtctctcggacacgggcatctcacttg SEQ ID NO: 14

[0058] (2) Using the Yarrowia lipolytica strain Yarrowia lipolytica Po1fΔKu70 as the starting strain, cultivate the Yarrowia lipolytica Po1fΔKu70 strain in 2 mL of YPD medium until the exponential growth phase (16 - 24 h). Collect the cells in 1 mL of the fermentation broth. After centrifugation to discard the supernatant, add 90 μL of a 50% volume PEG4000 solution, 5 μL of lithium acetate (2 M), 5 μL of single-stranded DNA (salmon sperm), and 5 μL of the recombinant plasmid pYLXP-XR-XK-XDH-XR-H6PD-6-PGDH obtained in step S1. After mixing evenly, incubate at 37 °C for 1 h, and then spread on a leucine-deficient plate to obtain the recombinant strain B.

[0059] (3) Inoculate the recombinant strain B into the seed medium and culture it at a temperature of 30 °C and a rotation speed of 220 rpm for 48 h to obtain the recombinant strain B seed liquid. Inoculate the recombinant strain B seed liquid into the medium with xylose as the sole carbon source at an inoculation amount of 1% volume, and carry out fermentation culture at a temperature of 30 °C and a rotation speed of 220 rpm. Measure the xylose content and NADPH amount in the medium every 24 hours (i.e., at the 24th hour, 48th hour, 72nd hour, and 96th hour), and calculate the consumption amount of xylose and the production amount of NADPH within 24 hours. Conduct three parallel experiments to obtain the average value of the xylose consumption amount and the average value of the NADPH production amount. The results are shown in Table 3, where recombinant strain B (24 - 48) represents the xylose consumed and NADPH produced from the 24th hour to the 48th hour, recombinant strain B (48 - 72) represents the xylose consumed and NADPH produced from the 48th hour to the 72nd hour, and recombinant strain B (72 - 96) represents the xylose consumed and NADPH produced from the 72nd hour to the 96th hour.

[0060] (4) The recombinant strain A obtained in Example 2 was inoculated into the seed medium and cultured at a temperature of 30 °C and a rotation speed of 220 rpm for 48 h to obtain a seed solution of the recombinant strain A. The seed solution of the recombinant strain A was inoculated into the medium with xylose as the sole carbon source at an inoculation amount of 1% by volume and fermented and cultured at a temperature of 30 °C and a rotation speed of 220 rpm. The xylose content and NADPH amount in the medium were measured at the 24th hour, 48th hour, 72nd hour, and 96th hour, respectively, and the consumption amount of xylose and the production amount of NADPH within 24 hours were calculated. Three parallel experiments were carried out to obtain the average value of the xylose consumption amount and the average value of the NADPH production amount. The results are shown in Table 3, where recombinant strain A (24 - 48) represents the xylose consumed and NADPH produced from the 24th hour to the 48th hour, recombinant strain A (48 - 72) represents the xylose consumed and NADPH produced from the 48th hour to the 72nd hour, and recombinant strain A (72 - 96) represents the xylose consumed and NADPH produced from the 72nd hour to the 96th hour.

[0061] Table 3 Verification experiment results of Example 4

[0062]

[0063]

[0064] Based on the results of the above Example 4, it can be seen that in the fermentation broth obtained by fermenting the recombinant Yarrowia lipolytica strains po1fk - pYLXP’ - XR - XK - XDH - XR - H6PD - 6 - PGDH and po1fk - pYLXP’ - XR - XK - XDH - XR in Example 4, the xylose consumption level of po1fk - pYLXP’ - XR - XK - XDH - XR - H6PD - 6 - PGDH was significantly improved compared with that of po1fk - pYLXP’ - XR - XK - XDH - XR, with an increase of 26.38%, 26.28%, and 24.65%, indicating the effectiveness of using the xylose consumption level to characterize the intracellular NADPH level.

[0065] In addition, by substituting the xylose consumption amount into the standard curve to calculate the production amount of NADPH and comparing it with the actually detected production amount of NADPH, the standard curve of the present invention can accurately evaluate the production amount of NADPH, proving the feasibility of characterizing the production amount of NADPH by the xylose consumption amount in the present invention.

[0066] Obviously, the above embodiments are merely examples for clear illustration and not limitations on the implementation manners. For those of ordinary skill in the art, other different forms of changes or modifications can be made based on the above description. It is not necessary and impossible to enumerate all the implementation manners here. And the obvious changes or modifications derived therefrom still fall within the protection scope of the present invention.

Claims

1. A method for characterizing the intracellular NADPH production of Yarrowia lipolytica by xylose consumption, characterized in that: The following steps are involved: S1, introducing gene sequences encoding xylose reductase, xylitol dehydrogenase and xylulokinase into a plasmid to form a recombinant plasmid, and introducing the recombinant plasmid into Yarrowia lipolytica to obtain a recombinant Yarrowia lipolytica; S2. Inoculating the recombinant Yarrowia lipolytica into a culture medium with xylose as the sole carbon source for fermentation and culturing, detecting NADPH generation and xylose consumption, and obtaining a linear relationship between xylose consumption and NADPH generation.

2. The method according to claim 1, characterized in that The recombinant Yarrowia lipolytica in step S1 overexpresses 6-phosphoglucose dehydrogenase and 6-phosphogluconate dehydrogenase.

3. The method according to claim 1, characterized in that The copy number of the xylose reductase in step S1 is 1 or 2.

4. The method according to claim 1, characterized in that The NCBI number of the gene sequence encoding the xylose reductase is YALI1_D09870g, the NCBI number of the gene sequence encoding the xylitol dehydrogenase is YALI1_E15452g, and the NCBI number of the gene sequence encoding the xylulokinase is YALI1_F14583g.

5. The method according to claim 2, characterized in that: The NCBI number encoding the 6-phosphoglucose dehydrogenase is YALI1_E26811g, and the NCBI number encoding the 6-phosphogluconate dehydrogenase is YALI1_B20462g.

6. The method according to claim 1, characterized in that The Yarrowia lipolytica includes Yarrowia lipolytica po1f.

7. The method according to claim 6, characterized in that The Ku70 gene of the Yarrowia lipolytica po1f is knocked out.

8. The method according to claim 1, characterized in that: The fermentation temperature in step S1 is 25-30°C.

9. A method for quantitatively detecting NADPH, characterized in that, The following steps are involved: (1) inoculating the recombinant Yarrowia lipolytica described in claim 1 into a culture medium with xylose as the sole carbon source for fermentation and culturing, detecting NADPH generation and xylose consumption, and obtaining a standard curve of xylose consumption and NADPH generation; (2) The recombinant Yarrowia lipolytica of (1) was inoculated into a culture medium with xylose as the sole carbon source for fermentation. The xylose consumption was detected and substituted into the standard curve in (1) to obtain the amount of NADPH generated.

10. The method according to claim 9, characterized in that The recombinant Yarrowia lipolytica overexpresses 6-phosphate glucose dehydrogenase and 6-phosphogluconate dehydrogenase.

Images