Method for detecting circRNA expression level in real time and application thereof

Abstract

The invention discloses a method for detecting circRNA expression level in real time and application of the method. The method comprises the following steps: (1) modifying a specific probe based on circRNA post-splicing sites onto a nanoneedle to obtain a capture probe; (2) placing the capture probe above the cells, centrifuging and incubating; and (3) hybridizing the probe modified with the fluorescent molecules, and analyzing a fluorescent signal on the capture probe, so as to obtain a detection result. The method disclosed by the invention is simple and efficient, and the circRNA expression level in the living cells can be obtained at a single cell scale and high throughput.

Description

Technical Field

[0001] The present invention belongs to the field of biotechnology and relates to a method for real-time detecting the expression level of circRNA and its application. Background Art

[0002] Covalently closed circular RNAs (circRNAs) are a newly discovered class of non-coding RNA molecules. Compared with linear RNAs, circRNAs are not easily degraded by RNase because they do not have 3' and 5' ends, and can maintain high stability in complex biological fluids. circRNAs can act as miRNA sponges, competitively binding miRNAs and thus preventing them from binding to target mRNAs and inhibiting protein expression. In addition, it can also interact with RNA-binding proteins (RBPs) and regulate alternative splicing. Some well-studied circular RNAs (circRNAs) can form circular ribonucleoprotein (circRNP) complexes to regulate signaling pathways. In addition to acting as competing endogenous RNAs (ceRNAs) to adsorb microRNAs (miRNAs), circular RNAs (circRNAs) can also directly bind to messenger RNAs (mRNAs) to affect gene expression output. Circular RNAs (circRNAs) can also outcompete linear messenger RNAs (mRNAs) by binding to the same proteins, resulting in altered messenger RNA translation. With the continuous in-depth research, it has been revealed that circRNAs are closely related to the occurrence and development of tumors, and circRNAs are of great significance in serving as markers for tumor diagnosis and treatment.

[0003] Although there are various methods for detecting RNAs, these methods are not specific for circular RNAs (circRNAs), so the cellular detection and clinical application of circRNAs are limited by specific detection tools. Detecting circRNAs is challenging because their sequences are almost identical to those of linear homologous RNAs. Methods suitable for detecting circRNAs must distinguish circular RNAs from linear RNA species and be sensitive enough to effectively detect the closed-loop structure of circRNAs. For example, the qRT-PCR method is the most widely used technique for analyzing circRNAs, but it may have limitations in some cases. In addition, there are some other detection methods, such as linearizing circRNAs into single products by weak hydrolysis or targeted RNase H degradation to distinguish them from multiple products of linear RNAs; using gel electrophoresis to detect according to the difference in migration speed between exonic circRNAs and linear RNAs of the same length. In addition to the above detection limitations, it is difficult to directly and sensitively detect the dynamic changes of target circRNA molecules in living cells at present. Therefore, there is an urgent need to develop new strategies for directly detecting circRNAs.

[0004] With the continuous development of nanotechnology and biomedical technology, various nanomaterials are being introduced into the biomedical field due to their special structures and unique properties to achieve various special applications. Among them, the nano-needle array structure with a high aspect ratio exhibits excellent characteristics in aspects such as in-situ molecular extraction and detection within living cells due to its unique morphology and good biocompatibility, and has broad application prospects. The sharp tips and small sizes of the nano-needles enable them to gently penetrate cell membranes or interact with intracellular structures at the subcellular level. This non-destructive interaction can be applied to molecular extraction, drug delivery, cell imaging, and other biomedical research and application fields. With the help of nano-needle technology, researchers can explore the internal structure and function of cells more precisely without significantly adverse effects on cell survival and activities.

[0005] Therefore, there is an urgent need to provide a method for real-time detecting the expression level of circRNA in living cells, so as to achieve high-throughput acquisition of the circRNA expression level in living cells at the single-cell scale. Summary of the Invention

[0006] Aiming at the deficiencies of the prior art and the actual needs, the present invention provides a method for real-time detecting the expression level of circRNA in living cells and its application, which realizes high-throughput acquisition of the circRNA expression level in living cells at the single-cell scale, and the detection limit of circRNA is as low as 10 -13 M.

[0007] To achieve the purpose of this invention, the following technical solutions are adopted in the present invention:

[0008] In the first aspect, the present invention provides a method for real-time detecting the expression level of circRNA in living cells, and the method includes the following steps:

[0009] (1) Modify a specific probe based on the back-splicing site of circRNA onto the nano-needles to obtain a capture probe;

[0010] (2) Place the capture probe above the cells, centrifuge, and incubate;

[0011] (3) Hybridize a probe modified with a fluorescent molecule, and analyze the fluorescent signal on the capture probe to obtain a detection result.

[0012] The method for real-time detection of circRNA expression level in the present invention is simple and efficient, and can obtain a platform for the expression level of circRNA in living cells at the single-cell scale and with high throughput. By modifying the designed specific probe based on the circRNA back-splicing site onto the nanoneedles, and taking advantage of the good biocompatibility of the nanoneedle chip, the nanoneedles are inserted into cells under the action of controllable centrifugal force, and the specific probe binds to the target molecule in the cells through the base complementary pairing principle. When the nanoneedles are taken out, the target circRNA can be captured. Hybridize the nanoneedle chip with another fluorescent probe molecule complementary to the target molecule. Finally, the fluorescence images of the circRNA molecule expression profile can be analyzed and quantified by a confocal microscope. The expression levels of multiple circRNA targets are obtained, and based on the size of the nanoneedles, single living cell analysis can be achieved. This method provides a new perspective and detection platform for biomedical research.

[0013] The method of the present invention can accurately detect circRNA in real time. circRNA does not require special chemical modification, has good tolerance, and is more stable than linear RNA in structure, and can be effectively applied in the preparation of products for detecting cell proliferation and differentiation.

[0014] Preferably, the specific probe based on the circRNA back-splicing site in step (1) contains a nucleotide sequence complementary to the target circRNA.

[0015] Preferably, the circRNA back-splicing site in step (1) includes the BSJ site.

[0016] In a specific embodiment of the present invention, the nucleotide sequence of the circCAMSAP1 capture probe is as shown in SEQ ID No.1, and the nucleotide sequence of the circHIPK3 capture probe is as shown in SEQ ID No.2, and the 3' end is modified with biotin.

[0017] SEQ ID No.1:

[0018] CAGGGAUGUUAUCUUGUUGAUCCA-biotin.

[0019] SEQ ID No.2:

[0020] GUGAGGCCAUACCUGUAGUACCGA-biotin.

[0021] In a specific embodiment of the present invention, the nucleotide sequence of the circCAMSAP1 imaging probe is as shown in SEQ ID No.3, and the nucleotide sequence of the circHIPK3 imaging probe is as shown in SEQ ID No.4, and the 3' end is modified with biotin.

[0022] SEQ ID No.3:

[0023] GACAGGAGAAGCTTGATAACAGGC-biotin.

[0024] SEQ ID No.4:

[0025] GGTAGCTGTCACAACTGTCACTGG-biotin.

[0026] Preferably, the fluorescent molecule in step (3) includes any one of Alexa Fluor 488 dye, Alexa Fluor 555 dye, or Alexa Fluor 647 dye.

[0027] Preferably, the rotation speed of the centrifugation in step (2) is 300 - 600 rpm (such as 300 rpm, 350 rpm, 400 rpm, 450 rpm, 500 rpm, 550 rpm, or 600 rpm), and the centrifugation time is 3 - 5 min (such as 3 min, 3.5 min, 4 min, 4.5 min, or 5 min).

[0028] Preferably, the incubation temperature in step (2) is 36°C - 38°C (such as 36°C, 37°C, or 38°C), and the incubation time is 10 - 30 min (such as 10 min, 15 min, 20 min, 25 min, or 30 min).

[0029] Preferably, the analysis in step (3) includes making a standard curve after confocal imaging.

[0030] Preferably, the method for making the standard curve includes: mixing a known concentration of circRNA with a capture probe, analyzing the fluorescence signal on the nanoneedles after hybridizing the mixture, and plotting a standard curve with the concentration as the abscissa and the fluorescence signal value as the ordinate.

[0031] Preferably, the diameter of the nanoneedle is 200 - 700 nm (200 nm, 250 nm, 300 nm, 350 nm, 400 nm, 450 nm, 500 nm, 550 nm, 600 nm, 650 nm, or 700 nm), the height is 3 - 5 μm (such as 3 μm, 3.5 μm, 4 μm, 4.5 μm, or 5 μm), and the spacing is 2 - 5 μm (2 μm, 2.5 μm, 3 μm, 3.5 μm, 4 μm, 4.5 μm, or 5 μm).

[0032] The spacing of the nanoneedles is 2 - 5 μm, and the size is smaller than that of a single cell, enabling single-cell level analysis and the analysis of the heterogeneity information of single cells.

[0033] Preferably, the nano - needles include silicon nano - needles.

[0034] Silicon has good biocompatibility and is widely used in biomedical detection. Its good biocompatibility can reduce adverse reactions to organisms, improve the safety and reliability of detection. Its good stability can ensure the accuracy and reliability of detection results and reduce detection errors caused by material reasons.

[0035] In a second aspect, the present invention provides an application of the method for real - time detecting the expression level of circRNA in living cells according to the first aspect in qualitative detection of circRNA and / or quantitative detection of circRNA.

[0036] Compared with the prior art, the present invention has the following beneficial effects:

[0037] The present invention provides a single - cell detection method for in - situ detecting circRNA in living cells. The silicon nano - needle array is functionalized with specific capture probes, which can directly isolate circRNA from cells in a short time without affecting the normal proliferation of cells. The detection limit of circRNA is as low as 10 -13 M. BRIEF DESCRIPTION OF THE DRAWINGS

[0038] Figure 1 It is a schematic diagram of the principle of the platform for detecting the expression level of circRNAs in living cells using functionalized nano - needles;

[0039] Figure 2 It is an SEM characterization diagram of the nano - needle chip. Figures a, b, and c are SEM images of the nano - needles taken from different angles respectively;

[0040] Figure 3 It is a technical characterization diagram for detecting circRNA in solution. Figure a is the fluorescence statistical result verifying the BSJ - based capture probe in Example 2, Figure b is the detection specificity test result, and Figure c is the detection result of the detection limit. Here, * represents P < 0.001 through the Wilcoxon test;

[0041] Figure 4 It is a biological interface characterization diagram of the nano - needles and cells. In Figure a, the left image is an SEM image of the overall state after the nano - needles penetrate into cells under a 10μm scale bar. The right image is an enlarged image of a single cell and a cross - sectional view after FIB - SEM cutting respectively. Figure b is an SEM top - view image of the overall state after the nano - needles penetrate into cells under a 25μm scale bar. Figure c is the number of nano - needles penetrated into a single cell counted;

[0042] Figure 5 It is a staining detection result diagram of cell survival;

[0043] Figure 6 Statistical result chart for cell viability detection;

[0044] Figure 7 Bright-field result chart for cell proliferation;

[0045] Figure 8 Statistical result chart for CCK-8 of cell proliferation;

[0046] Figure 9 Statistical result chart for cell leakage;

[0047] Figure 10 Statistical result chart for live cell detection. Figure a is the statistical chart of the detection result of circCAMSAP1, and figure b is the statistical chart of the detection result of circHIPK3. *** represents P < 0.001 by Wilcoxon test;

[0048] Figure 11 Statistical result chart for detecting circCAMSAP1 in HIEC cells and HCT116 cells. Figure a is the statistical chart of the detection result by nanoneedles. *** represents P < 0.001 by Wilcoxon test, and figure b is the statistical chart of the detection result by qRT-PCR method. **** represents P < 0.0001 by Student’s t-test;

[0049] Figure 12 Fluorescence image of the change in the fluorescence intensity of circCAMSAP1 and circHIPK3 in HCT116 cells before and after adding oxaliplatin (OXA);

[0050] Figure 13Statistical graph of the detection results of the changes in circCAMSAP1 and circHIPK3 in HCT116 cells before and after adding oxaliplatin (OXA). Among them, Figure a shows the results of detecting the change of circCAMSAP1 in cells before and after adding oxaliplatin by nanoneedles, *** indicates P < 0.001 by Wilcoxon test; Figure b shows the results of detecting the change of circHIPK3 in cells before and after adding oxaliplatin by nanoneedles, *** indicates P < 0.001 by Wilcoxon test; Figure c shows the heatmap statistical graph of the changes in circCAMSAP1 and circHIPK3 in cells before and after adding oxaliplatin by nanoneedles; Figure d shows the results of detecting the change of circCAMSAP1 in cells before and after adding oxaliplatin by qRT-PCR method, ** indicates P < 0.01 by Student's t-test; Figure e shows the results of detecting the change of circHIPK3 in cells before and after adding oxaliplatin by qRT-PCR method, *** indicates P < 0.001 by Student's t-test. Detailed implementation mode

[0051] To further elaborate on the technical means and effects adopted by the present invention, the present invention will be further described below in conjunction with examples and drawings. It can be understood that the specific implementation mode described herein is only used to explain the present invention, rather than limiting the present invention.

[0052] For those not specifying specific techniques or conditions in the examples, they shall be in accordance with the techniques or conditions described in the literature in this field or in accordance with the product specifications. For reagents or instruments without indicating the manufacturer, they are all conventional products that can be obtained through regular channels.

[0053] The nanoneedle chip is from Suzhou In-situ Chip Technology Co., Ltd.

[0054] Preparation Example 1

[0055] This preparation example provides a preparation method of functionalized nanoneedles, and the method includes:

[0056] First, the nanoneedle chip will be treated with piranha solution (H 2 SO 4 :H 2 O 2, surface activation was carried out by treatment (heating at 90 °C for 1.5 h) in a ratio of 3:1. Then, sequential washing was performed with deionized water, methanol and dichloromethane (volume ratio 1:1) and pure dichloromethane, and dried with nitrogen gas. The treated nanoneedles were then reacted with 20% 3-aminopropyltriethoxysilane (APTES) overnight to introduce amino functional groups on their surfaces. The modified nanoneedles were washed step by step with methanol, ethanol and isopropanol, and then further modified with biotin groups on the amino surface. Finally, through the binding of the pair of high-affinity molecules, biotin (1 μg / mL) and streptavidin protein (10 μg / mL), the biotin-labeled probe (1 μM) was stably connected to the surface of the nanoneedles, and deionized water was used for washing between each incubation step to remove unbound reagents.

[0057] Example 1

[0058] By modifying a specific capture molecular probe based on the post-splicing site of circRNA on the nanoneedle chip, when the target molecule is present, it binds to the probe, thereby extracting the signal from the cell. The functionalized nanoneedle chip acts as a highly sensitive sensor to extract various circRNA molecules from cells without affecting cell viability and perform single-cell in-situ analysis.

[0059] To detect circRNA, specific capture molecular probes based on the post-splicing site of circRNA were designed to target circCAMSAP1 and circHIPK3. The nucleotide sequence of the circCAMSAP1 capture probe is shown in SEQ ID No.1, and the nucleotide sequence of the circHIPK3 capture probe is shown in SEQ ID No.2.

[0060] SEQ ID No.1:

[0061] CAGGGAUGUUAUCUUGUUGAUCCA-biotin.

[0062] SEQ ID No.2:

[0063] GUGAGGCCAUACCUGUAGUACCGA-biotin.

[0064] The nucleotide sequence of the circCAMSAP1 imaging probe is shown in SEQ ID No.3, and the nucleotide sequence of the circHIPK3 imaging probe is shown in SEQ ID No.4.

[0065] SEQ ID No.3:

[0066] GACAGGAGAAGCTTGATAACAGGC-biotin。

[0067] SEQ ID No.4:

[0068] GGTAGCTGTCACAACTGTCACTGG-biotin。

[0069] The preparation method of the functionalized nanoneedles refers to Example 1.

[0070] The morphology of the obtained nanoneedles was characterized by scanning electron microscopy (SEM, Philips FEG SEM XL30), and the samples were tilted at 0°, 45°, and 90° respectively to take SEM images. The results are as Figure 2 shown.

[0071] First, tests were carried out in a solution environment to evaluate the detection method.

[0072] To characterize that the probe designed based on the BSJ site has good selectivity, a probe based on BSJ was designed. The nucleotide sequence of the capture probe based on BSJ is shown in SEQ ID No.5. At the same time, a capture probe based on the common sequence of circRNA and homologous linear RNA was designed. The nucleotide sequence of the capture probe based on the common sequence is shown in SEQ ID No.6.

[0073] SEQ ID No.5:

[0074] biotin-CTGGGAACTCACCTCACCTCAGCC。

[0075] SEQ ID No.6:

[0076] biotin-CGTGAGTCTGTTCCAAGCTCCGGC。

[0077] The mimics of the corresponding circRNA and the linear sequence mimics were designed to explore the selectivity of the BSJ probe.

[0078] The nucleotide sequence of the circRNA mimic is shown in SEQ ID No.7, and the nucleotide sequence of the linear sequence mimic is shown in SEQ ID No.8.

[0079] SEQ ID No.7:

[0080] GGCCCGGCGGATGCCTCCTTTGCCGGAGCTTGGAACAGACTCACGGCCAGCGAAG TGAGTTCAATGGCTGAGGTGAGGTGAGTTCCCAGAGAACGGGGCTCCGCGCGAGGTCA GACTGGGCAGGAGATGCCGTGGACCCCGCCCTTCGGGGAGG。

[0081] SEQ ID No.8:

[0082] AAAAAGTGAGTTCCCAGAGAACGGGGCTCCGCGCGAGGTCAGACTGGGCAGGAG ATGCCGTGGACCCCGCCCTTCGGGGAGGGGCCCGGCGGATGCCTCCTTTGCCGGAGCT TGGAACAGACTCACGGCCAGCGAAGTGAGTTCAATGGCTGAGGTGAGAAAAA。

[0083] The nucleotide sequence of the target molecule imaging probe is shown in SEQ ID No.9.

[0084] SEQ ID No.9:

[0085] biotin-CTCCCCGAAGGGCGGGGTCCACGG。

[0086] Four groups of experiments were designed:

[0087] Group 1: Modify the BSJ probe and dilute the linear RNA mimic in PBS solution;

[0088] Group 2: Modify the BSJ probe and dilute the circRNA mimic in PBS solution;

[0089] Group 3: Modify the BSJ probe and dilute the linear RNA mimic and circRNA mimic in PBS solution;

[0090] Group 4: Modify the consensus sequence probe and dilute the linear RNA mimic and circRNA mimic in PBS solution.

[0091] The fluorescence signals on the nanoneedles after hybridization of Group 1, Group 2, Group 3 and Group 4 were captured by confocal microscopy (Olympus FV3000, 60x objective, oil immersion), and the statistical chart of the results is shown as Figure 3 shown in a, and the results illustrate that modifying the BSJ-based capture probe on the nanoneedles can effectively avoid the interference of homologous linear nucleic acids.

[0092] The methods for confocal microscopy imaging and image processing are as follows:

[0093] After incubating to capture the target molecules in cells and performing hybridization, confocal microscopy imaging (Olympus FV3000, 60x objective, oil immersion) was carried out to visualize and quantify the circRNAs captured on the surface of the nanoneedles. To distinguish the effective signals from background noise, the nanoneedle array with a z-resolution of 0.5 μm was scanned to obtain a stack of 10 slices, and three-dimensional reconstruction and the projection after superimposing all layers were obtained. Quantitative analysis was performed on the fluorescent spots on the surface of the nanoneedles (from the imaging sequences modified with fluorescent molecules) and used to analyze the capture of intracellular circRNA targets. The image projection information was extracted to obtain a 2-channel image stack containing fluorescence intensity and relative position information. To distinguish positive signals from background noise or debris, first, fluorescent spots with a diameter of 0.5 to 1 μm were selected as the nanoneedle regions. Then, a fluorescence threshold was applied to sort the positive nanoneedles with captured circRNAs. For each nanoneedle array, an intensity matrix representing the circRNA expression level was finally obtained.

[0094] Specific detection:

[0095] Specific detection was carried out by introducing non-binding sequences as controls. The non-binding sequences included circHNF1A and circ-luciferase, and the NC group was a PBS solution without adding any sequences.

[0096] The nucleotide sequence of the capture probe for circFOXA3 is shown in SEQ ID No.10.

[0097] SEQ ID No.10: UUAGAGGAUUCAGGGUCAUGUAGG-biotin.

[0098] The nucleotide sequence of the imaging probe for circFOXA3 is shown in SEQ ID No.11.

[0099] SEQ ID No.11: ATTAGGTTGTTGATGGAGAAAGGG-biotin.

[0100] The nucleotide sequence of circFOXA3 is shown in SEQ ID No.12.

[0101] SEQ ID No.12:

[0102]

[0103] The nucleotide sequence of circHNF1A is shown in SEQ ID No. 13.

[0104] SEQ ID No. 13:

[0105]

[0106] The nucleotide sequence of circ-luciferase is shown in SEQ ID No. 14.

[0107] SEQ ID No. 14:

[0108]

[0109] The test results are as shown in Figure 3 Figure b in. As can be seen from Figure b, the introduced interference sequence has no effect on signal detection and only generates background signals. This detection method has high specificity.

[0110] Sensitivity test:

[0111] To evaluate the analytical sensitivity of this detection method, artificial synthetic circFOXA3 samples with concentrations of 10 -13 ~10 -9 M were used for simulated detection experiments.

[0112] Test method: Prepare circFOXA3 with concentrations of 10 -13 ~10 -9 M in PBS solution. Then, put the nanoneedles modified with probes into the solution, incubate for 30 min, wash, add imaging probes modified with fluorescent molecules, incubate at room temperature for 2 h, wash, and take pictures of the fluorescent signals on the nanoneedles with a confocal microscope.

[0113] The test results are as shown in Figure 3 Figure c in. As can be seen from Figure c, within the range of circRNA concentrations of 10 -13 ~10 -9 M, there is a good linear relationship between the fluorescence intensity and the concentration.

[0114] Example 2

[0115] Test on the biological interface between the nanoneedle and cells and non-damage to cells.

[0116] Test method:

[0117] First, the biological interface between the nanoneedles and cells was characterized. The cells were passaged into a 4-well plate and could be detected using the functionalized nanoneedle chip when the cell confluence was greater than 50%. The culture medium in the well plate was aspirated, 50 μL of serum-free medium was added to each well, the nanoneedle chip was gently placed above the cells, and finally the whole device was placed in a centrifuge for centrifugation and incubation. After completion, 400 μL of serum-free medium was added to float the chip, and the nanoneedle chip was immediately washed 3 times with PBS and then immediately fixed with 2% glutaraldehyde at room temperature for 15 min. Subsequently, dehydration was carried out in gradient ethanol of 10%, 30%, 50%, 70%, 90%, 100%×2 for 5 min. Finally, it was treated with hexamethyldisilazane (HMDS) for 5 min and air-dried. To increase the conductivity of the sample when taking electron microscope images, the nanoneedles and cells were sputter-coated with gold. Finally, observations and photographs were taken under the electron microscope. To test whether the nanoneedles penetrated into the cells, after selecting the position to be cut, a platinum metal film was sprayed to protect the cross-section from damage by the ion beam, and a focused ion beam scanning electron microscope (FIB-SEM) device was used to collect the cross-section. The results are as Figure 4 shown. The left image in Figure a is the SEM image of the overall state after the nanoneedles penetrated into the cells. The right image in Figure a is the magnified image of a single cell and the cross-sectional view after cutting by FIB-SEM, respectively. It can be seen from the figure that the nanoneedles successfully penetrated into the cells. Figure b is the top view of the biological interface between the nanoneedles and cells, and Figure c shows the statistical number of nanoneedles penetrating into each cell on average, which is approximately 4.

[0118] After the functionalized nanoneedle chip penetrated into the cells by centrifugal force, the nanoneedles and cells were incubated together in a cell culture incubator for 30 min. Then the nanoneedles were taken out and the cells continued to be cultured. Viability staining experiments were carried out on the cells at 24 h, 48 h, 72 h, and 96 h. Calcein-AM is a cell staining reagent that can fluoresce-label live cells, and propidium iodide is a cell staining reagent that can fluoresce-label dead cells. That is, Hoechst, Calcein-AM, and propidium iodide were diluted to a certain multiple according to the instructions and used to stain the cells for 30 min. After washing, the cells were characterized by taking confocal images. Figure 5 and Figure 6 are the experimental results of verifying the non-damage of the cells by the penetration of the nanoneedles. From the staining results and statistical results, it can be seen that the cells were not significantly damaged at 24 h, 48 h, 72 h, and 96 h after the nanoneedles detected the live cells.

[0119] To further verify that the nanoneedle detection does not affect the normal proliferation of cells, the cells were monitored for a long time after the nanoneedles detected the cells. As Figure 7 shown, the cell states were observed under the microscope at time points of 24 h, 48 h, 72 h, and 96 h, as Figure 7It can be observed that there is no significant difference in cells compared with the control group, i.e., the group without nanoprobe detection, and the cell density increases with time. At the same time, the cell proliferation viability at 24 h, 48 h, 72 h, and 96 h time points was monitored using a CCK-8 kit. The CCK-8 kit is a colorimetric detection kit based on WST-8 and widely used for cell proliferation. In the presence of an electron coupling reagent, WST-8 can be reduced by some dehydrogenases in mitochondria to produce orange formazan. The more and faster the cell proliferation, the darker the color; the greater the cytotoxicity, the lighter the color. 100 μL of cell suspension was inoculated in a 96-well culture plate. After the cells adhered to the wall, nanoprobes were used to extract signals from the cells, and then the cells were continuously cultured. The cells were tested at 24 h, 48 h, 72 h, and 96 h time points. 100 μL of CCK-8 solution was added to each well, and the culture plate was incubated in an incubator for 2 h. The absorbance at 450 nm was measured with an enzyme-linked immunosorbent assay (ELISA) reader. As Figure 8 shown, there is no significant difference in the proliferation activity of cells detected by nanoprobes compared with the control group, that is, the detection by nanoprobes has no effect on cell proliferation.

[0120] To test that the detection of living cells with nanoneedles does not cause cell leakage, a lactate dehydrogenase detection kit was used for characterization. The destruction of the cell membrane structure caused by apoptosis or necrosis of cells will lead to the release of enzymes in the cytoplasm into the culture medium, including lactate dehydrogenase (LDH), whose enzyme activity is relatively stable. LDH release is regarded as an important indicator of cell membrane integrity and is widely used in cytotoxicity detection and cell membrane integrity detection. 100 μL of cell suspension was inoculated in a 96-well culture plate. After the cells adhered to the wall, nanoneedles were used to extract signals from the cells, and then the cells were continuously cultured. The cells were tested at 6 h, 12 h, and 24 h time points respectively. The culture wells were divided into the following groups: cell-free culture medium wells (background blank control wells), control cell wells without nanoneedle detection (sample control wells), cell wells for subsequent lysis without nanoneedle detection (sample maximum enzyme activity control wells), and cell wells detected with nanoneedles (drug-treated sample wells), and they were marked. 1 h before the scheduled detection time point, the cell culture plate was taken out of the cell incubator, and the LDH release reagent provided by the kit was added to the "sample maximum enzyme activity control well" in an amount of 10% of the original culture medium volume. After adding the LDH release reagent, it was pipetted several times to mix evenly, and then it was continued to be incubated in the cell incubator. After reaching the scheduled time, the cell culture plate was centrifuged at 400 g for 5 min with a multi-well plate centrifuge. 120 μL of the supernatant of each well was taken and added to the corresponding wells of a new 96-well plate, and then the sample determination was carried out immediately. 60 μL of LDH detection working solution was added to each well. After mixing evenly, it was incubated at room temperature (about 25 °C) in the dark for 30 min. Then the absorbance was measured at 490 nm using an enzyme-linked immunosorbent assay reader. As Figure 9 The statistical results showed that the detection with nanoneedles did not cause cell leakage.

[0121] Example 3

[0122] Tracking the dynamic changes of circRNA in living cells.

[0123] The dynamic changes of different circRNAs play important roles in various cell behaviors. Decoding the dynamic changes of circRNAs helps to better understand the complexity of the gene regulatory network, the molecular mechanism of cell fate determination, and the pathogenesis of diseases.

[0124] Compared with a single stable solution environment, the intracellular environment is more complex and variable, with more interfering substances. To verify the high specificity of the method of the present invention in living cells, a non-specific nucleotide sequence was designed, and the design purpose was not to bind to any sequence in the cellular environment. This sequence was modified onto the nanoneedles as the NC group, and HCT116 and HIEC cells were selected for the experiment. Among them, the nucleotide sequence of the circCAMSAP1 capture probe is shown in SEQ ID No.1, and the nucleotide sequence of the circHIPK3 capture probe is shown in SEQ ID No.2.

[0125] The nucleotide sequence of the NC capture probe is shown in SEQ ID No.15.

[0126] SEQ ID No.15: UUGUACUACACAAAAGUACUGAAA-Biotin.

[0127] The preparation method of the capture probe refers to Example 1.

[0128] After functionalizing the nanoneedles, the following is to use the nanoneedles to detect circRNA in living cells. Cells HCT116 and HIEC cells were cultured in McCoy’s 5A medium supplemented with 10% fetal bovine serum (FBS) and 2% penicillin-streptomycin and RPMI 1640 medium supplemented with 10% fetal bovine serum (FBS) and 2% penicillin-streptomycin, respectively. The cells were cultured in humidified air at 37 °C, 5% CO 2 (Thermo Scientific). Before the experiment, the cells were trypsinized and seeded on a 4-well plate (Nunc, Thermo Scientific) 24 hours in advance. For the detection of adherent cells, first remove the medium. Then add 50 μL of serum-free medium, place the nanoneedle chip facing the cells in the 4-well culture dish, and then place the complex in a centrifuge with a plate rotor at 400 rpm, and select 3 rpm / s and 6 rpm / s for acceleration and deceleration respectively, lasting for 5 min. After that, place the complex in the cell culture incubator and culture for 30 min to allow the target molecules in the cells to fully bind to the probes on the nanoneedles. After the reaction, wash the nanoneedles with 0.05% SDS containing 0.01% Tween-20 for 5 min, and continue to wash the nanoneedle chip with 0.05% SSC containing 0.01% Tween-20 for 15 min. After washing, dissolve the imaging probe modified with fluorescence in 0.05% SSC containing 2% BSA and 0.01% Tween-20 at a concentration of 200 nM, and hybridize with the nanoneedle chip for 2 h under dark conditions. After the reaction, wash three times with 0.05% SSC containing 0.01% Tween-20 and then perform confocal image acquisition and data analysis.

[0129] It can be seen from Figure 10 the results that in the experimental group where the NC probe was modified on the nanoneedles, the expression levels of fluorescence intensity were lower than those in the experimental group where the circCAMSAP1 and circHIPK3 capture probes were modified in the detection experiments of the two target molecules. This finding proves the excellent detection specificity of the detection method of the present invention in cells.

[0130] As Figure 11 shown, taking circCAMSAP1 as an example, the relative contents of HCT116 and HIEC cells were detected respectively, and qRT-PCR was used for verification.

[0131] For HCT116 cells, the changes of circCAMSAP1 and circHIPK3 before and after the addition of oxaliplatin were further detected. Before analysis, HCT116 cells were treated with oxaliplatin at a concentration of 50 μM for 24 h.

[0132] Oxaliplatin is an important part of anti-tumor treatment. Oxaliplatin was selected as the therapeutic drug for HCT116 cells, the changes of the targets of multiple circRNAs in living cells were dynamically detected, and qRT-PCR was used for verification.

[0133] qRT-PCR experimental method:

[0134] The internal reference was GAPDH, and total RNA was extracted from HCT116 cells using TRIzol reagent. For a 20 μL reaction, 500 ng of total RNA was reverse transcribed using Maxima H Minus reverse transcriptase (EP0751, Thermo), dNTPMix (R0191, Thermo), Rnase Inhibitor (N8080119, Thermo), and Random Hexamer Primer (SO142, Thermo). And TB Premix Ex Taq TM II (Tli RNaseH Plus) (Takara) was used for quantitative PCR, and the expression of specific circRNAs was analyzed according to the manufacturer's protocol using the method of an Applied Biosystems real-time PCR instrument. The primers used are shown in Table 1.

[0135] Table 1

[0136] Number Primer Nucleotide sequence SEQ ID No.16 circCAMSAP1-F TGATGGCCTACACTGTGGAG SEQ ID No.17 circCAMSAP1-R TGGTGGGTAGACCAAGACTTGTGA SEQ ID No.18 circHIPK3-F TATGTTGGTGGATCCTGTTCGGCA SEQ ID No.19 circHIPK3-R GTATGAGCATAGCAAAGGTCA SEQ ID No.20 GAPDH-F TGCACCACCAACTGCTTAGC SEQ ID No.21 GAPDH-R GGCATGGACTGTGGTCATGAG

[0137] It can be seen from Figure 12 and Figure 13It can be seen that among the two selected circRNA targets, compared with before drug addition, the levels of circCAMSAP1 and circHIPK3 in cells increased after drug addition. Further quantitative PCR (qPCR) verification was carried out, and it was found that the detection results based on the nanoneedles were consistent with the qPCR results in trend.

[0138] Traditional methods for detecting circRNA require cell lysis, so it is impossible to monitor its dynamic behavior in living cells in real time. Usually, substances such as fluorescent probes need to be introduced into cells, which have problems such as cytotoxicity and low detection limits. Therefore, in order to overcome the above existing problems and promote the in-situ analysis of circRNA in living cells, a functionalized nanoneedle array chip is used to achieve precise manipulation of cell entities. The unique geometric properties of the nanoneedle array and the good biochemical properties based on silicon endow the characteristics of stably detecting intracellular molecules without affecting cell viability and its normal proliferation. By designing specific molecular capture probes, the nanoneedle array achieves precise molecular targeting, thus realizing an iterative recycling and reapplication process, and finally realizing continuous tracking of the dynamics of circRNA in living cells.

[0139] As an important biomolecule, circRNA plays a key regulatory role in cells and diseases. However, there are many limitations in current detection methods, which limit the real-time monitoring of the relative level changes of circRNA in living cells. Compared with previous methods, by using a functionalized nanoneedle chip, relying on the good geometric structure and mechanical properties of the nanoneedles, the dynamic changes of circRNA in living cells are detected. At the same time, relying on the neat array and spacing characteristics of the nanoneedles, the dissection of single-cell circRNA molecules can be achieved. Through sufficient characterization, it is proved that the detection method of the present invention will not affect the activity and proliferation of cells, and long-term detection of cells can be realized.

[0140] In summary, the present invention has developed a simple, efficient and high-throughput platform for the first time, using a nanoneedle array combined with a controllable nano-cell biological interface to capture circRNA expression level information on living cells. This invention can analyze the dynamic changes of circRNA in living cells and provides a new tool for precise diagnosis, disease detection and personalized treatment.

[0141] The applicant declares that the present invention illustrates the detailed method of the present invention through the above embodiments, but the present invention is not limited to the above detailed method, that is, it does not mean that the present invention must rely on the above detailed method to be implemented. Those skilled in the art should understand that any improvement to the present invention, the equivalent replacement of each raw material of the product of the present invention, the addition of auxiliary components, and the selection of specific methods, etc., all fall within the protection scope and disclosure scope of the present invention.

Claims

1. A method for real-time detection of circRNA expression levels in living cells, characterized in that: The method comprises the following steps: (1) Modifying the specific probe based on the post-splicing site of circRNA onto the nanoneedle to obtain the capture probe; (2) placing the capture probe on top of the cells, centrifuging, and incubating; (3) hybridizing the probe modified with a fluorescent molecule, analyzing the fluorescent signal on the capture probe, and thus obtaining the detection result.

2. The method according to claim 1, characterized in that The specific probe based on the post-splicing site of circRNA in step (1) contains a nucleotide sequence complementary to the base of the target circRNA.

3. The method according to claim 1 or 2, characterized in that: The circRNA post-splicing site in step (1) includes a BSJ site.

4. The method according to any one of claims 1 to 3, characterized in that The fluorescent molecule in step (3) includes any one of Alexa Fluor 488 dye, Alexa Fluor 555 dye or Alexa Fluor 647 dye.

5. The method according to any one of claims 1 to 4, characterized in that The centrifugal speed in step (2) is 300-600 rpm, and the centrifugal time is 3-5 min.

6. The method according to any one of claims 1 to 5, characterized in that The incubation temperature in step (2) is 36° C.-38° C., and the incubation time is 10-30 min.

7. The method according to any one of claims 1 to 6, characterized in that The analysis described in step (3) includes the preparation of a standard curve after confocal imaging.

8. The method according to claim 7, characterized in that The method for preparing the standard curve includes: mixing circRNA of known concentration with the capture probe, analyzing the fluorescence signal on the nanoneedle after the hybridization, and drawing the standard curve with the concentration as the horizontal axis and the fluorescence signal value as the vertical axis.

9. The method according to any one of claims 1 to 8, characterized in that The nanoneedles have a diameter of 200-700 nm, a height of 3-5 μm, and a spacing of 2-5 μm.

10. Use of the method for real-time detection of circRNA expression level in living cells according to any one of claims 1 to 9 in qualitative detection of circRNA and / or quantitative detection of circRNA.

Images