Biomarkers associated with sweet corn lutein content traits and uses thereof
By detecting plants with the genotype GG for SNP01 and SNP02 in sweet corn, and screening or breeding sweet corn with high lutein content, the problem of low efficiency in traditional breeding methods is solved, and efficient and precise sweet corn breeding is achieved.
Patent Information
- Application Number
- CN202510364757.7
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-03-26
- Publication Date
- 2026-05-29
- Estimated Expiration
- 2045-03-26
Smart Images

Figure CN120119026B_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of molecular marker technology, and in particular to biomarkers related to the lutein content trait in sweet corn and their applications. Background Technology
[0002] Sweet corn (Zea mays var. saccharata) has become an important economic crop and health food globally due to its unique flavor and rich nutritional value. Lutein, one of the main carotenoids in sweet corn kernels, has antioxidant, anti-inflammatory, and vision-protective physiological functions, especially playing a significant role in preventing age-related macular degeneration (AMD) and other eye diseases. However, the lutein content in sweet corn is generally low, making it difficult to meet human dietary needs. Therefore, increasing the lutein content of sweet corn through genetic modification is of great significance for improving its nutritional quality and market competitiveness.
[0003] Lutein content in maize kernels is a quantitative trait controlled by multiple genes. Its genetic mechanism is complex, easily influenced by environmental factors, and requires precise instrumentation for detection. Traditional breeding methods, such as phenotypic selection to improve lutein content, are inefficient, time-consuming, and costly. With the development of molecular marker technology, marker-assisted selection (MAS) based on quantitative trait loci (QTL) mapping has become a key technology to overcome this bottleneck. Single nucleotide polymorphism (SNP) markers, due to their high density, strong stability, and high detection efficiency, have become a core tool for fine mapping of QTLs and molecular breeding. However, currently, there are few publicly available SNP markers closely linked to lutein content in sweet maize, and most are located in minor QTL regions, making them difficult to use directly for efficient breeding. Therefore, developing functional SNP markers closely linked to major QTLs can not only reveal the molecular regulatory mechanism of lutein synthesis but also provide precise technical support for the targeted breeding of high-lutein varieties of sweet maize.
[0004] Previous studies have performed QTL mapping on the trait of carotenoid content in sweet corn kernels, detecting some quantitative trait loci controlling carotenoid content in corn kernels. However, due to the influence of different marker densities, population types, genetic linkage map accuracy, and different methods for detecting kernel phenotypic traits, the QTL results obtained in these studies are not entirely consistent, and there is a lack of major-effect QTLs related to lutein content in sweet corn kernels. Summary of the Invention
[0005] To address the aforementioned problems, this invention provides biomarkers related to the lutein content trait in sweet corn and their applications. The biomarkers provided by this invention are major-effect QTLs related to the lutein content in sweet corn kernels, which can be used to screen or assist in screening sweet corn with relatively high lutein content, resulting in more accurate results.
[0006] To achieve the above objectives, the present invention provides the following technical solution:
[0007] This invention provides biomarkers related to the lutein content trait in sweet corn, the biomarkers including SNP01 and SNP02;
[0008] SNP01 is located at 82134355bp on chromosome 6 of the maize B73 RefGen_V3 genome, with bases A or G; SNP02 is located at 83130639bp on chromosome 6 of the maize B73 RefGen_V3 genome, with bases A or G.
[0009] When both SNP01 and SNP02 have the genotype GG, the lutein content of sweet corn is relatively high.
[0010] Preferably, the biomarker includes a first nucleic acid molecule containing the SNP01 information and a second nucleic acid molecule containing the SNP02 information; the nucleotide sequence of the first nucleic acid molecule is shown in SEQ ID NO.1; and the nucleotide sequence of the second nucleic acid molecule is shown in SEQ ID NO.2.
[0011] This invention provides the application of the biomarkers described in the above technical solutions or products that detect the biomarkers described in the above technical solutions in 1) and / or 2):
[0012] 1) Screening or assisting in the screening of sweet corn with relatively high lutein content;
[0013] 2) Cultivate or assist in the cultivation of sweet corn varieties with high lutein content;
[0014] When both SNP01 and SNP02 of the biomarkers have the genotype GG, the lutein content of sweet corn is relatively high.
[0015] Preferably, the lutein content is the lutein content in sweet corn kernels.
[0016] Preferably, the product includes a primer set and / or a kit.
[0017] This invention provides a primer set for detecting the biomarkers described in the above-mentioned technical solutions. The primer set includes a first primer pair and a second primer pair. The nucleotide sequence of the upstream primer of the first primer pair is shown in SEQ ID NO.3, and the nucleotide sequence of the downstream primer of the first primer pair is shown in SEQ ID NO.4. The nucleotide sequence of the upstream primer of the second primer pair is shown in SEQ ID NO.5, and the nucleotide sequence of the downstream primer of the second primer pair is shown in SEQ ID NO.6.
[0018] This invention provides a method for screening or assisting in the screening of sweet corn with relatively high lutein content, comprising the following steps:
[0019] Determine the genotypes of SNP01 and SNP02 in the biomarkers described in the above technical solution for the sweet corn to be tested;
[0020] Based on the genotype results, sweet corn varieties with genotypes GG for both SNP01 and SNP02 were selected as having relatively high lutein content.
[0021] Preferably, the determination includes: performing PCR amplification on the sweet corn to be tested, and sequencing the obtained PCR amplification product.
[0022] Preferably, the primer set for PCR amplification includes the primer set described in the above technical solution.
[0023] Preferably, the lutein content is the lutein content in sweet corn kernels.
[0024] Beneficial effects:
[0025] This invention provides biomarkers related to the lutein content trait in sweet corn, including SNP01 and SNP02; SNP01 is located at 82134355 bp on chromosome 6 of the maize B73 RefGen_V3 genome, with bases A or G; SNP02 is located at 83130639 bp on chromosome 6 of the maize B73 RefGen_V3 genome, with bases A or G; when both SNP01 and SNP02 have the genotype GG, the lutein content in sweet corn is relatively high. This invention utilizes sweet corn inbred lines SHL01 and SHL03 as parents to construct a RIL (permanent population). High-performance liquid chromatography (HPLC) was used to detect the lutein content trait in sweet corn kernels. QTL mapping was performed using this trait. Analysis revealed a major QTL on chromosome 6 of maize that regulates lutein content in kernels. This major QTL is located between SNPs S_chr6:82134355 and S_chr6:83130639, contributing 27.14% to the lutein content phenotype. This QTL can be used to screen or assist in screening sweet corn with relatively high lutein content, providing more precise results and technical support for molecular marker-assisted breeding. This is of great significance for improving the eating quality of sweet corn. Attached Figure Description
[0026] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the accompanying drawings used in the embodiments will be briefly described below.
[0027] Figure 1 QTL mapping results for lutein traits in sweet corn kernels;
[0028] Figure 2 Map showing the location of closely linked SNPs on maize chromosomes for major QTLs related to lutein content in sweet maize kernels. Detailed Implementation
[0029] This invention provides biomarkers related to the lutein content trait in sweet corn, the biomarkers including SNP01 and SNP02;
[0030] SNP01 is located at 82134355bp on chromosome 6 of the maize B73 RefGen_V3 genome, with bases A or G; SNP02 is located at 83130639bp on chromosome 6 of the maize B73 RefGen_V3 genome, with bases A or G.
[0031] When both SNP01 and SNP02 have the genotype GG, the lutein content of sweet corn is relatively high.
[0032] This invention utilizes high-performance liquid chromatography (HPLC) to detect the lutein content trait data of sweet corn kernels and uses QTL mapping based on the lutein content trait. Analysis revealed a major QTL regulating lutein content on chromosome 6 of maize, located between SNP sites S_chr6:82134355 and S_chr6:83130639, contributing 27.14% to the lutein content phenotype. This major QTL can be used for screening or assisting in the screening of sweet corn with relatively high lutein content. Only the SNP bases of SNP01 and SNP02 need to be detected to predict the lutein content trait in sweet corn kernels. The identification method is simple, highly efficient, and has a clear selection target, unaffected by environmental factors. SNP markers also enable high-throughput detection. This method can be used for marker-assisted breeding of lutein content in sweet corn kernels during the seedling stage, and can also be used for molecular aggregation breeding of the trait.
[0033] In one embodiment, the biomarker includes a first nucleic acid molecule containing the SNP01 information and a second nucleic acid molecule containing the SNP02 information; the nucleotide sequence of the first nucleic acid molecule is shown in SEQ ID NO.1; the nucleotide sequence of the second nucleic acid molecule is shown in SEQ ID NO.2, as detailed below:
[0034] SEQ ID NO.1:
[0035] 5'-ATACATGAAATGGCGCAAATTGGCGGTGCTGGTAGAACCGAAAC GATTTATTACCTGTTTCTTACATGATTTGAGTTTTCCAAGCTTTTATGCTTCTCTRTTTCCTACTTGGCCATATCTGTCAGATGTTTTGACAGCCAGCCAGGTTATTGTTTCACCGCCGTTAGTAGGTTGCGTACACTCTTGTACTCAAACTCTTC-3';
[0036] SEQ ID NO.2:
[0037] 5'-AGGCCTACTCTAGAGCAAGGCAGATAATCACCACGCACATCGACATCCTCCACAAGCTCGCCCAGCTCCTGATCGAGAAGGAGACCGTGGACGGGGAGGARTTCATGAGCTTGTTCATTGACGGCCAGGCCGAGCTGTTTGTCGCTTGAGATGTCACAAGGCTTGCGGTGCGTATGCTTTTCGGTGTTTTGTGTCAGAGCG-3';
[0038] In this case, the base R is A / G.
[0039] In this invention, the 101st base R in the first nucleic acid molecule is the physical location of SNP01, and the 101st base R in the second nucleic acid molecule is the physical location of SNP02. Those skilled in the art can screen or assist in screening sweet corn with relatively high lutein content by detecting the genotypes of SNP01 and SNP02, or by detecting the genotypes at the 101st position of the first and second nucleic acid molecules.
[0040] Based on the above advantages, the present invention provides the application of the biomarkers described in the above technical solutions or products that detect the biomarkers described in the above technical solutions in 1) and / or 2):
[0041] 1) Screening or assisting in the screening of sweet corn with relatively high lutein content;
[0042] 2) Cultivate or assist in the cultivation of sweet corn varieties with high lutein content;
[0043] When both SNP01 and SNP02 of the biomarkers have the genotype GG, the lutein content of sweet corn is relatively high.
[0044] This invention can cultivate or assist in the cultivation of sweet corn varieties with high lutein content by discarding sweet corn varieties with genotypes AA for both SNP01 and SNP02 in the biomarkers and retaining sweet corn varieties with genotypes GG for both SNP01 and SNP02 in the biomarkers.
[0045] As one implementation method, the lutein content is the lutein content in sweet corn kernels.
[0046] In one implementation, the product includes a primer set and / or a kit.
[0047] Based on the above advantages, the present invention provides a primer set for detecting the biomarkers described in the above technical solution. The primer set includes a first primer pair and a second primer pair. The nucleotide sequence of the upstream primer of the first primer pair is shown in SEQ ID NO.3, and the nucleotide sequence of the downstream primer of the first primer pair is shown in SEQ ID NO.4. The nucleotide sequence of the upstream primer of the second primer pair is shown in SEQ ID NO.5, and the nucleotide sequence of the downstream primer of the second primer pair is shown in SEQ ID NO.6, as detailed below:
[0048] SEQ ID NO.3: 5'-ATACATGAAAATGGCGCAAA-3';
[0049] SEQ ID NO.4: 5'-GAAGAGTTTGAGTACAAGAG-3';
[0050] SEQ ID NO.5: 5'-AGGCCTACTCTAGAGCAAGG-3';
[0051] SEQ ID NO. 6: 5'-CGCTCTGACACAAAACACCG-3'.
[0052] The primer set provided by this invention can specifically amplify the first and second nucleic acid molecules in the above-mentioned technical solution. Then, by sequencing and analyzing the first and second nucleic acid molecules, sweet corn with genotypes of GG for both SNP01 and SNP02 in the biomarkers can be selected, thereby screening out sweet corn with relatively high lutein content. The identification method is simple, the selection efficiency is high, the selection target is clear, and it is not affected by the environment. SNP markers can also achieve high-throughput detection.
[0053] Based on the above advantages, the present invention provides a method for screening or assisting in screening sweet corn with relatively high lutein content, comprising the following steps:
[0054] The genotypes of SNP01 and SNP02 in the biomarkers described in the above technical solution for the sweet corn to be tested were determined.
[0055] Based on the genotype results, sweet corn varieties with genotypes GG for both SNP01 and SNP02 were selected as having relatively high lutein content.
[0056] In one implementation, the determination includes: performing PCR amplification on the sweet corn to be tested, and sequencing the obtained PCR amplification product.
[0057] As one implementation method, the PCR amplification system is as follows: 2×PCRmix 25μL, ddH2O 22μL, upstream and downstream primers 1μL each, and DNA template 1μL.
[0058] As one implementation method, the PCR amplification program is as follows: denaturation at 95°C for 3 min; denaturation at 95°C for 30 s, annealing at 50°C for 30 s, extension at 72°C for 30 s, for a total of 35 cycles; and finally extension at 72°C for 5 min.
[0059] In one implementation, the primer set for PCR amplification includes the primer set described in the above-described technical solution.
[0060] As one implementation method, the lutein content is the lutein content in sweet corn kernels.
[0061] To further illustrate the present invention, the biomarkers related to the lutein content trait of sweet corn provided by the present invention and their applications are described in detail below with reference to the accompanying drawings and embodiments, but these should not be construed as limiting the scope of protection of the present invention.
[0062] Example 1
[0063] 1. Construction of a population genetic map of recombinant inbred lines of sweet corn.
[0064] Recombinant inbred lines (RILs) were constructed using sweet maize inbred lines SHL01 and SHL03 as parents and planted at the Zhuangxing Experimental Station of the Shanghai Academy of Agricultural Sciences. After emergence, leaf tissues were collected from the RIL population for DNA extraction. Genotyping by target sequencing (GBTS) was used to genotype 236 individuals from the F7 generation, yielding 10,000 SNP loci. PLINK software was used for quality control filtering, selecting SNPs with a deletion rate of less than 20%, a minimum allele frequency greater than 0.05, and a heterozygosity of less than 20%. The constructed genetic map contained 4253 high-quality SNP markers, divided into 10 linkage groups. The total distance of the genetic map was 3052.3 cM, and the average genetic distance between SNP markers was 0.7 cM.
[0065] 2. Measurement of lutein traits in sweet corn kernels
[0066] A randomized block design was used to construct RIL (Rich Inbred Line) populations using sweet maize inbred lines SHL01 and SHL03 as parents. These RIL populations were planted at the Zhuangxing Experimental Station of the Shanghai Academy of Agricultural Sciences. Each RIL family was planted in two rows, with three replicates, and normal field management was implemented. After the sweet maize kernels were harvested, the lutein content in the kernels was determined using high-performance liquid chromatography (HPLC). Three ears were taken from each replicate, and 15 intact kernels free from disease and pests were selected from each ear for lutein extraction and determination. The average value of the three replicates was used as the phenotypic data.
[0067] Table 1. Comparison of phenotypic variation and heritability among RIL populations
[0068] Properties Average value (μg / g) Amplitude Skewness Kudo Coefficient of variation (%) Lutein 1.95 0.31~8.92 0.69 -0.90 0.78
[0069] 3. Obtain the main effect QTL for the lutein content trait in sweet corn kernels.
[0070] QTL analysis was performed on the mean lutein content of grains in the RIL population using QTL IciMapping 4.2 software and Composite Interval Mapping (CIM). 1000 randomization tests were conducted at a significance level of P < 0.05 to determine the logarithm of the odds (LOD). The 2-LOD interval method was used to determine the confidence intervals (QTL intervals). The format for naming QTLs was: prefix "q" + trait abbreviation + chromosome number of the QTL + serial number of the QTL on the same chromosome, with the number connected to the chromosome number by a "-". QTL analysis of grain lutein content was performed, as follows: Figure 1 As shown, a total of three QTLs were detected, located on chromosomes 6 and 9, with LOD values ranging from 2.55 to 10.92. The contribution rate of each individual QTL to phenotypic variation ranged from 5.45% to 27.14%. A QTL with a contribution rate ≥10% to phenotypic variation was considered a major QTL. Among them, qLUT6-2, located on chromosome 6, had a contribution rate of 27.14% and was considered a major QTL; qLUT9, located on chromosome 9, had a contribution rate of 15.57% and was also considered a major QTL.
[0071] Table 2. QTL results for the lutein content trait in grains.
[0072]
[0073] 4. Development and application of SNP markers closely linked to the lutein content trait in sweet corn kernels
[0074] qLUT6-2 is a major-effect QTL located on chromosome 6 of maize that regulates the content of lutein in grains, located between the SNP sites S_chr6:82134355 and S_chr6:83130639. Figure 2 The SNP loci S_chr6:82134355 and S_chr6:83130639 have both mutated to A / G, and their physical locations are chr6:82134355-83130639 in the maize B73 RefGen_V3 genome. These two SNP loci can be used to predict the lutein content in sweet maize kernels.
[0075] Primers were designed based on two SNP sites to screen sweet corn with relatively high lutein content in the kernels. The primer set consisted of a first primer pair and a second primer pair. The nucleotide sequence of the upstream primer of the first primer pair is shown in SEQ ID NO.3, and the nucleotide sequence of the downstream primer of the first primer pair is shown in SEQ ID NO.4. The nucleotide sequence of the upstream primer of the second primer pair is shown in SEQ ID NO.5, and the nucleotide sequence of the downstream primer of the second primer pair is shown in SEQ ID NO.6. The screening method is as follows:
[0076] DNA was extracted from maize plant leaves using standard methods. PCR amplification was performed using the first and second primer pairs. The PCR amplification system consisted of: 25 μL 2×PCRmix, 22 μL ddH2O, 1 μL each of forward and reverse primers, and 1 μL DNA template. The PCR reaction conditions were: 95℃ denaturation for 3 min; 95℃ denaturation for 30 s, 50℃ annealing for 30 s, 72℃ extension for 30 s, for a total of 35 cycles; and a final extension at 72℃ for 5 min. The PCR products were sequenced. Plants with both S_chr6:82134355 and S_chr6:83130639 containing G were considered candidates for high lutein content in the grains and were retained. Plants that did not meet these two site conditions were discarded.
[0077] PCR amplification and sequencing were performed on 114 sweet maize populations from the Maize Research Center of Shanghai Academy of Agricultural Sciences, and the lutein content in the kernels was determined. The results are shown in Table 3.
[0078] When both SNP sites S_chr6:82134355 and S_chr6:83130639 were G, the lutein content of the sweet corn kernels was high (average 4.28 μg / g); when both SNP sites S_chr6:82134355 and S_chr6:83130639 were A, the lutein content of the sweet corn kernels was low (average 1.21 μg / g). The average values of the two phenotypes showed a highly significant difference (P = 1.90 × 10⁻⁶).-11 ).
[0079] Table 3. Correspondence between SNP genotypes and lutein content phenotypes of the tested sweet corn materials.
[0080]
[0081]
[0082] Note: Blank tables in Table 4 contain no data.
[0083] The aforementioned major-effect QTL tightly linked SNP markers associated with lutein content in sweet corn can be used to assist in the selection of corn with high lutein content. Specifically, SNP sites S_chr6:82134355 and S_chr6:83130639 can be used to select for the lutein content trait in sweet corn kernels. Using the SNP markers disclosed in this invention for marker-assisted selection, only the SNP bases at specific sites in the PCR amplification product need to be detected to predict the lutein content trait in sweet corn kernels.
[0084] Although the above embodiments have provided a detailed description of the present invention, they are only some embodiments of the present invention, and not all embodiments. People can obtain other embodiments based on these embodiments without creative effort, and these embodiments all fall within the protection scope of the present invention.
Claims
1. A biomarker related to the lutein content trait in sweet corn, characterized in that, The biomarker comprises a first nucleic acid molecule containing SNP01 information and a second nucleic acid molecule containing SNP02 information; the nucleotide sequence of the first nucleic acid molecule is shown in SEQ ID NO.1; the nucleotide sequence of the second nucleic acid molecule is shown in SEQ ID NO.2; the 101st base R in the first nucleic acid molecule is SNP01; the 101st base R in the second nucleic acid molecule is SNP02; When both SNP01 and SNP02 have the genotype GG, the lutein content of sweet corn is relatively high.
2. The application of the product containing the biomarker of claim 1 in 1) and / or 2): 1) Screening or assisting in the screening of sweet corn with relatively high lutein content; 2) Cultivate or assist in the cultivation of sweet corn varieties with high lutein content; When both SNP01 and SNP02 of the biomarkers have the genotype GG, the lutein content of sweet corn is relatively high.
3. The application according to claim 2, characterized in that, The lutein content refers to the lutein content in sweet corn kernels.
4. The application according to claim 2, characterized in that, The products include primer sets and / or kits.
5. A primer set for detecting the biomarker of claim 1, characterized in that, The primer set includes a first primer pair and a second primer pair; the nucleotide sequence of the upstream primer of the first primer pair is shown in SEQ ID NO.3, and the nucleotide sequence of the downstream primer of the first primer pair is shown in SEQ ID NO.4; the nucleotide sequence of the upstream primer of the second primer pair is shown in SEQ ID NO.5, and the nucleotide sequence of the downstream primer of the second primer pair is shown in SEQ ID NO.
6.
6. A method for screening or assisting in screening sweet corn with relatively high lutein content, characterized in that, Includes the following steps: Determine the genotypes of SNP01 and SNP02 in the biomarkers described in claim 1 of the sweet corn to be tested; Based on the genotype results, sweet corn varieties with genotypes GG for both SNP01 and SNP02 were selected as having relatively high lutein content.
7. The method according to claim 6, characterized in that, The assay includes: performing PCR amplification on the sweet corn to be tested, and sequencing the obtained PCR amplification product.
8. The method according to claim 7, characterized in that, The primer set for PCR amplification includes the primer set described in claim 5.
9. The method according to claim 6, characterized in that, The lutein content refers to the lutein content in sweet corn kernels.
Citation Information
Patent Citations
Biomarker related to zeaxanthin content character of sweet corn kernels and application of biomarker
CN120464767A