2-succinyl-5-enolacetonyl-6-hydroxy-3-cyclohexene-1-carboxylate synthase mutant and application thereof

Abstract

The invention relates to a 2-succinyl-5-enol acetonyl-6-hydroxy-3-cyclohexene-1-carboxylic acid synthase mutant and application thereof, and belongs to the technical field of enzyme engineering. According to the invention, a key residue of 2-succinyl-5-enolacetonyl-6-hydroxy-3-cyclohexene-1-carboxylate synthase is obtained by combining protein sequence comparison and alanine scanning strategies, the key residue is subjected to random mutation, and the menadione pathway resistant intermediate metabolite 1, 2, 3, 4-tetracarboxylic acid synthase is obtained through multiple rounds of screening. The mutant MenDW322IR323F which is subjected to feedback inhibition by using 2, 4-dihydroxy-2-naphthoic acid is synthesized, the heptaene menadione production capacity of the recombinant bacillus subtilis constructed according to the method is improved, the yield is 1.22 times that of a control strain, and the final yield reaches 186.5 mg / L. The invention not only provides a new direction for transformation of a menadione approach of bacillus subtilis, but also is beneficial to industrial expanded production of heptaene menadione.

Description

Technical Field

[0001] The present invention relates to the technical field of enzyme engineering, and in particular to a 2-succinyl-5-enolpyruvyl-6-hydroxy-3-cyclohexene-1-carboxylate synthase mutant and its application. Background Art

[0002] Vitamin K2, also known as menaquinone, is a fat-soluble vitamin that exists in a series of subtypes, often denoted as MK-n. Menaquinone-7 (MK-7) is one of its most important subtypes, which can be directly absorbed and utilized by the human body. It has a series of functions such as preventing arterial calcification, enhancing bone strength, and protecting nerves, and has attracted much attention in the fields of medicine and functional foods. In addition, MK-7 is also a key coenzyme for electron transfer in Bacillus subtilis and plays an important role in its respiratory chain, participating in the energy metabolism process.

[0003] 2-Succinyl-5-enolpyruvyl-6-hydroxy-3-cyclohexene-1-carboxylate synthase (MenD) is a key thiamine diphosphate (ThDP)-dependent decarboxylase in the vitamin K2 biosynthetic pathway. This enzyme has typical three-domain characteristics and maintains its catalytic activity through a tetrameric conformation. Its core function is to catalyze the conjugate addition reaction of α-ketoglutaric acid and isochorismic acid to generate 2-succinyl-5-enolpyruvyl-6-hydroxy-3-cyclohexadiene-1-carboxylate (SEPHCHC), accompanied by the release of carbon dioxide. This reaction is not only the rate-limiting step in menaquinone biosynthesis but also a key node connecting primary metabolism and naphthoquinone ring construction. During the synthesis of MK-7, MenD is feedback inhibited by the menaquinone pathway intermediate metabolite 1,4-dihydroxy-2-naphthoic acid (DHNA), thus affecting the biosynthesis of MK-7.

[0004] In recent years, most researchers have been committed to using technologies such as metabolic engineering and synthetic biology to achieve high yields, high conversion rates, and high productivities of MK-7 in Bacillus subtilis. Enhancing the supply of precursor substances and weakening competitive pathways are common means to improve the performance of strains. For example, the synthesis of precursors is strengthened by overexpressing key genes in the shikimate pathway and the MEP pathway, and competitive pathways are weakened by dynamically regulating key genes through CRISPRi and quorum sensing systems. However, these studies have not solved the problem of feedback inhibition by DHNA, so the improvement of MK-7 production is also in a bottleneck stage and it is difficult to make further breakthroughs. Summary of the Invention

[0005] To solve the above technical problems, the present invention combines protein sequence alignment and alanine scanning strategies to obtain the key residues of 2-succinyl-5-enolpyruvyl-6-hydroxy-3-cyclohexene-1-carboxylate synthase, randomly mutates the key residues, and obtains a mutant MenD resistant to feedback inhibition by 1,4-dihydroxy-2-naphthoic acid, an intermediate metabolite of the menaquinone pathway, through multiple rounds of screening. W322I\R323F 。

[0006] The first object of the present invention is to provide a mutant of 2-succinyl-5-enolpyruvyl-6-hydroxy-3-cyclohexene-1-carboxylate synthase, wherein the tryptophan at position 322 of the starting sequence with the amino acid sequence shown in SEQ ID NO.1 is mutated to isoleucine, and the arginine at position 323 is mutated to phenylalanine.

[0007] The present invention combines protein sequence alignment and alanine scanning to obtain the key residues R96, W322 and R323 of 2-succinyl-5-enolpyruvyl-6-hydroxy-3-cyclohexene-1-carboxylate synthase, randomly mutates the key residues, and screens the coupling relationship between MK-7 synthesis and strain growth to obtain a MenD mutant MenD with significantly improved ability to resist feedback inhibition by DHNA. W322I / R323F 。

[0008] Furthermore, the amino acid sequence of the mutant is shown in SEQ ID NO.2.

[0009] The second object of the present invention is to provide a gene encoding the above mutant.

[0010] Furthermore, the nucleotide sequence of the gene is shown in SEQ ID NO.4.

[0011] The third object of the present invention is to provide an expression vector containing the above mutant or the above gene.

[0012] The fourth object of the present invention is to provide the application of the above mutant, the above gene or the above expression vector in improving the yield of heptaprenyl menaquinone produced by Bacillus subtilis.

[0013] During the synthesis of heptaprenyl menaquinone, 2-succinyl-5-enolpyruvyl-6-hydroxy-3-cyclohexene-1-carboxylate synthase is subject to feedback inhibition by 1,4-dihydroxy-2-naphthoic acid (DHNA), an intermediate metabolite of the menaquinone pathway. The mutant MenD provided by the present invention W322I / R323F reduces the binding ability to DHNA, thereby weakening the feedback inhibition effect of DHNA on the synthesis of heptaprenyl menaquinone and improving the yield of heptaprenyl menaquinone.

[0014] The fifth object of the present invention is to provide a method for increasing the yield of heptylmenaquinone produced by Bacillus subtilis, and the method comprises introducing any one of the following into Bacillus subtilis:

[0015] (1) The above-mentioned mutant;

[0016] (2) The above-mentioned gene;

[0017] (3) The above-mentioned expression vector.

[0018] The sixth object of the present invention is to provide a recombinant Bacillus subtilis, which comprises any one of the following:

[0019] (1) The above-mentioned mutant;

[0020] (2) The above-mentioned gene;

[0021] (3) The above-mentioned expression vector.

[0022] Furthermore, the gene encoding 2-succinyl-5-enolpyruvyl-6-hydroxy-3-cyclohexene-1-carboxylate synthase with the nucleotide sequence shown in SEQ ID NO.3 is knocked out in the genome of the Bacillus subtilis.

[0023] Furthermore, the Bacillus subtilis is Bacillus subtilis 168.

[0024] In one embodiment of the present invention, the Bacillus subtilis is recombinant Bacillus subtilis 3AYAT02.

[0025] The seventh object of the present invention is to provide a microbial inoculum comprising the above-mentioned Bacillus subtilis.

[0026] The eighth object of the present invention is to provide the application of the above-mentioned mutant, the above-mentioned gene, the above-mentioned expression vector, the above-mentioned recombinant Bacillus subtilis or the above-mentioned microbial inoculum in the production of heptylmenaquinone.

[0027] The ninth object of the present invention is to provide a method for producing heptylmenaquinone, which is obtained by using a fermentation system comprising the above-mentioned recombinant Bacillus subtilis or the above-mentioned microbial inoculum.

[0028] Furthermore, the recombinant Bacillus subtilis is activated in a seed medium and then transferred into a fermentation medium for culturing for 120 - 144 hours.

[0029] In one embodiment of the present invention, the recombinant Bacillus subtilis is cultured on a shaker at 37°C and 220 rpm for 10 hours to prepare a seed solution.

[0030] In one embodiment of the present invention, the recombinant Bacillus subtilis is cultured in a shaker at 40°C and 220 rpm for 144 hours to ferment and obtain vitamin K2 (menaquinone-7).

[0031] Furthermore, the seed medium contains peptone at a concentration of 10 - 12 g / L, yeast powder at a concentration of 5 - 10 g / L, and sodium chloride at a concentration of 10 - 12 g / L.

[0032] Furthermore, the fermentation medium contains glucose at a concentration of 50 - 55 g / L, glycerol at a concentration of 50 - 55 g / L, soy peptone at a concentration of 50 - 55 g / L, and potassium dihydrogen phosphate at a concentration of 0.6 - 1 g / L.

[0033] In one embodiment of the present invention, the seed medium contains peptone at a concentration of 10 g / L, yeast powder at a concentration of 5 g / L, and sodium chloride at a concentration of 10 g / L.

[0034] In one embodiment of the present invention, the fermentation medium contains glucose at a concentration of 50 g / L, glycerol at a concentration of 50 g / L, soy peptone at a concentration of 50 g / L, and potassium dihydrogen phosphate at a concentration of 0.6 g / L.

[0035] Furthermore, it further includes the step of extracting vitamin K2 (menaquinone-7).

[0036] In one embodiment of the present invention, the extractant for vitamin K2 (menaquinone-7) is a mixture of isopropanol and n-hexane.

[0037] In one embodiment of the present invention, the volume ratio of isopropanol to n-hexane is 1:2.

[0038] Advantages of the present invention:

[0039] In the present invention, a 2-succinyl-5-enolpyruvyl-6-hydroxy-3-cyclohexene-1-carboxylate synthase mutant MenD with significantly improved ability to resist inhibition by 1,4-dihydroxy-2-naphthoic acid is screened. W322I / R323F , and a recombinant Bacillus subtilis 3AYAT02-IF capable of efficiently producing vitamin K2 (menaquinone-7) is constructed, with a yield reaching 186.5 mg / L, which is 1.22 times that of the control strain. The mutant provided by the present invention can be used as a general tool to improve the efficiency of producing vitamin K2 (menaquinone-7) by Bacillus subtilis, providing a low-cost and sustainable production scheme for vitamin K2 (menaquinone-7), meeting the industrial demands in fields such as medicine and food, and also providing a new theoretical basis for the research and modification of the menaquinone metabolic pathway. BRIEF DESCRIPTION OF THE DRAWINGS

[0040] In order to make the content of the present invention easier to be clearly understood, the following further details the present invention according to specific embodiments of the present invention in combination with the drawings, where

[0041] Figure 1 Screening results of key residues of MenD in Example 1 of the present invention, where (1) is the protein structure of MenD from Mycobacterium tuberculosis and Bacillus subtilis, (2) is the enzyme activity detection results of wild type and mutants R96A, R323A, and W322A, and (3) is the anti-feedback inhibition detection results of wild type and mutants R96A, R323A, and W322A against DHNA;

[0042] Figure 2 Mutant MenD in Example 3 of the present invention W322I / R323F Anti-DHNA feedback inhibition detection results;

[0043] Figure 3 Heptaprenyl menaquinone fermentation yield results of recombinant strain Bacillus subtilis 3AYAT02-IF in Example 5 of the present invention. Detailed implementation manners

[0044] The present invention will be further described below with reference to the accompanying drawings and specific embodiments, so that those skilled in the art can better understand the present invention and implement it, but the examples given are not intended to limit the present invention.

[0045] The culture media and reagents involved in the examples are as follows:

[0046] (1) Culture media:

[0047] The components of the seed culture medium include: 10 g / L peptone, 5 g / L yeast extract, and 10 g / L sodium chloride.

[0048] The components of the fermentation culture medium include: 50 g / L glucose, 50 g / L glycerol, 50 g / L soy peptone, and 0.6 g / L potassium dihydrogen phosphate.

[0049] (2) MK-7 extractant: A mixture of isopropanol and n-hexane (1:2, v / v).

[0050] The detection methods involved in the examples are as follows:

[0051] (1) MK-7 yield detection: An Agilent ZORBAX Eclipse XDB-C18 separation column (5 μm, 250×4.6 mm) is used, the detection temperature is 40 °C, the mobile phase uses methanol:dichloromethane (9:1, v / v), the flow rate is 1 mL / min, the detection wavelength is 254 nm, and the injection volume is 10 μL.

[0052] (2) Detection of strain growth: The absorbance value OD of the fermentation broth is measured regularly using an ultraviolet-visible spectrophotometer 600 .

[0053] The primers and sequences involved in the examples are shown in Table 1.

[0054] Table 1 Primer Sequences

[0055] Primer Name Primer Sequence (5’-3’) pHT-HF GTGAAAAAACAATGGGAACTGTAACTGCAGGTCGACGTCCCC pHT-HR AAAATAAACCTCCTTTCTTTTACTTACCCTCTATTAAAC menD-F TCGTGTTGTACAATAAATGTAGTGATAGCG menD-R TAGCCTCGTATGTTTCAACCATTTGTTC YZ-pHT-F AAAACCGGTTTTCTTATGGCTTAAGGATG YZ-pHT-R TAGTACAGGGACTATTCCTAATAAGCCG pET-HF CACCACCACCACCACCACTGAGATCCGGCTGCTAACAAAG pET-HR ATGTATATCTCCTTCTTAAAGTTAAACAAAATTATTTCTAGAGG MenD-F GAAGGAGATATACATTTGACAGTCAACCCGATTACTCATTAC MenD-R GTGGTGGTGGTGGTGGTGCAGTTCCCATTGTTTTTTCACTTCCC TB-1F GGTTGAAGCCCATTATTCANNKGTGCCTATTATTGTGTT TB-1R TGAATAATGGGCTTCAACCACAGC TB-2F CGAGGATGGAGGGNNKNNKGACCCGACA TB-2R CCCTCCATCCTCGTCAATCACGATTTGC YZ-MenDF TTATGCGACTCCTGCATTAGGAAG YZ-MenDR CGCAATAATGTTTTCCTTGTCCGCATC TBmenD-1F TTACAGTTCCCATTGTTTTTTCACTTCCCG TBMenD-1R GAGGTGAGAGGCGTTGACAGTCAACCCGATTACTCATTACATCG TBMenD-2F GGGTTGACTGTCAACGCCTCTCACCTCCTAATGCAG TBMenD-2R GAAATTGTTATCCGCTCGCGGATACAACCTTTGCTATCAGTGG TBMenD-3F CAAAGGTTGTATCCGCGAGCGGATAACAATTTCACACAGGAAAC TBMenD-3R CCTGAGAACTTTCATAATAACGCCAGGGTTTTCCCAGTC TBMenD-4F GGGAAAACCCTGGCGTTATTATGAAAGTTCTCAGGCGATCTGTTC TBMenD-4R TATTTTCACACCGGATATTTTTAATGAGCTGGAG

[0056] Example 1: Construction of MenD Mutant

[0057] Construction of MenD expression vector: Using pHT01 as the template, PCR amplification was carried out with pHT-HF / R as the upstream and downstream primers respectively. The reaction system was: 1 μL of template; 25 μL of PrimerSTAR Max; 20 mM of each forward and reverse primer; add sterile water to a total volume of 50 μL. The reaction conditions were: pre-denaturation at 98°C for 5 min; denaturation at 98°C for 10 s; annealing at 58°C for 30 s; extension at 72°C for 4 min, for a total of 30 cycles; after completion, final extension at 72°C for 10 min. The amplified product was verified by nucleic acid electrophoresis and then purified using the PCR Purification Kit. Subsequently, the template plasmid was digested with Dpn I to obtain a linearized vector.

[0058] Using wild-type Bacillus subtilis 168 as the template and menD-F / R as the upstream and downstream primers, PCR amplification was carried out. The reaction system was the same as above, and the reaction conditions were: pre-denaturation at 98°C for 5 min; denaturation at 98°C for 10 s; annealing at 58°C for 30 s; extension at 72°C for 5 min, for a total of 30 cycles; after completion, final extension at 72°C for 10 min. The product was recovered by the same method as above to obtain a fragment. The construction method and template of the promoter P43 fragment were the same as those of the MenD fragment. The linearized vector and the target fragment were mixed at a concentration ratio of 1:1:1. After adding T4 ligase and T4 buffer, water was added to make up to 10 μL, and the mixture was ligated at 40°C for 30 min. Subsequently, it was transformed into E. coli DH5α competent cells and spread on an LB plate (containing 50 μg / mL of Kan). Positive transformants were screened out, and the recombinant plasmid pHT-MenD was extracted and sent to Suzhou Genewiz Biotechnology Co., Ltd. for sequencing verification.

[0059] Screening of key residues of MenD: Bashiri et al. crystallized MenD from Mycobacterium tuberculosis (Mtb-MenD) and determined through in vitro experiments that Mtb-MenD binds to DHNA through three arginines in a cage-like structure, which they named the "arginine cage" (published in the literature Allosteric Regulation of Menaquinone (Vitamin K2) Biosynthesis in the Human Pathogen Mycobacterium Tuberculosis. Journal of Biological Chemistry 2020, 295(12), 3759–3770.). We used docking software to dock MenD from Bacillus subtilis (Bs-MenD) with DHNA, and by comparing it with the same position in the "arginine cage" of Mtb-MenD, we found that the binding site of Bs-MenD to DHNA also has a certain degree of conservation. This site retains two of the three arginines in the "arginine cage", and the other tryptophan can also play a role similar to that of arginine after moving. Subsequently, alanine scanning was used to evaluate the mutational potential of these three amino acids, R96, W322, and R323, for attenuating feedback inhibition. The results are as Figure 1 shown. After the amino acids at positions 96 and 322 were mutated to alanine, both their own activity and anti-feedback inhibition performance were improved, demonstrating the importance of these two sites for the feedback inhibition effect. After the amino acid at position 323 was mutated to alanine, there was no obvious change in performance, but because this site is close to the active site, subsequent mutations still considered this site.

[0060] Construction of MenD mutants: Using the constructed pHT-MenD as a template, the two-round whole plasmid amplification of the three sites was carried out with the corresponding upstream and downstream primers in Table 1 to obtain MenD mutants with random combinations of mutations at the three sites (R96, W322, R323). The reaction system was the same as above, and the reaction conditions were: pre-denaturation at 98°C for 5 min; denaturation at 98°C for 10 s; annealing at 58°C for 30 s; extension at 72°C for 4 min, for a total of 30 cycles; after completion, final extension at 72°C for 10 min. The amplified products were purified using a PCR Purification Kit and sent to Genewiz Biotechnology Co., Ltd. in Suzhou for sequencing verification.

[0061] Example 2: Screening of MenD mutants

[0062] The obtained pHT-MenD mutant plasmid was integrated into wild-type Bacillus subtilis 168 by chemical transformation, and the addition amount of the plasmid was about 1000 ng. Screening was carried out on LB solid medium supplemented with 100 μM DHNA and chloramphenicol resistance. After 12 hours, well-growing single colonies were picked and transferred to a medium supplemented with 150 μM concentration of DHNA for screening. After 12 hours, well-growing single colonies were selected again and transferred to a medium supplemented with 200 μM concentration of DHNA. Finally, a mutant with the strongest ability to resist DHNA feedback inhibition was screened out, and other mutants were eliminated during the process of increasing the addition amount of DHNA. The amino acid sequence of the mutation site of the final mutant strain was determined by sequencing to obtain the mutant MenD W322I / R323F 。

[0063] Example 3: Detection of the anti-feedback inhibition ability of the MenD mutant

[0064] Protein purification of MenD: The wild-type menD gene (the sequence is shown in SEQ ID NO.3) and its mutant gene (the sequence is shown in SEQ ID NO.4) were amplified using the menD-F / R primer pair. At the same time, the plasmid pET28a(+) was linearized using the pET-HF / R primer pair. Subsequently, the menD and its mutant DNA fragments were inserted into the linearized pET-28a(+) plasmid through the Gibson Assembly Cloning Kit (NEB) and transformed into Escherichia coli BL21. Then single colonies were screened and cultured in LB medium supplemented with kanamycin (concentration 50 μg / mL) with shaking at 37 °C and 220 r / min for 8 h. 4% (v / v) of the inoculum in this culture broth was transferred into 50 mL of TB fermentation medium containing an equal amount of kanamycin, and cultured at 37 °C and 220 r / min for about 1.5 h (OD 600 = 0.6). To induce the expression of MenD, IPTG (0.2 mM) was added to the culture broth, and then cultured with shaking at 16 °C at a rotation speed of 200 r·min-1 for 16 h. Then the cells were collected and ultrasonically lysed in Tris-HCl (pH = 8.0, 20 mM). The obtained supernatant was loaded onto a His GraviTrap column (GE Healthcare), and used with Purification was carried out using an FPLC system (GE Healthcare). Then, the chromatography column was washed with 15 mL of buffer A (20 mM Tris, 0.5 M NaCl, 5 mM imidazole, pH = 8.0) and 15 mL of buffer B (20 mM Tris, 0.5 M NaCl, 100 mM imidazole, pH = 8.0). Finally, 5 mL of buffer C (20 mM Tris, 0.5 M NaCl, 200 mM imidazole, pH = 8.0) was used to elute MenD and mutant MenD W322I / R323F protein.

[0065] Detection of the anti - feedback inhibition ability of the MenD mutant: The activities of MenD and its mutant MenD W322I / R323F were quantified by detecting the consumption rate of the substrate α - ketoglutaric acid. The reaction system included 1 μM of MenD enzyme and 300 μM of ThDP, and the buffer included 100 mM Tris - HCl (pH = 7.8), 100 mM NaCl and 5 mM MgCl 2 . The mixture was first pre - heated at 25 °C for 30 min, and then 2 μM of isochorismic acid and 300 μM of α - ketoglutaric acid were added to start the reaction. Analysis and detection were carried out using a MARS MOA chromatographic column (FLM) and an ultraviolet detector. The column temperature was 50 °C, and the mobile phase was 5 mM H 2 SO 4 , and the flow rate was 0.5 mL / min. The degree of decrease in enzyme activity with the gradual increase in the addition amount of DHNA represented the anti - feedback inhibition ability of MenD. Different concentrations of DHNA were added to the reaction system to measure the enzyme activities of MenD and its mutant MenD W322I / R323F , and the measurement results are as Figure 2 shown.

[0066] Example 4: Construction of recombinant Bacillus subtilis 3AYAT02 - IF

[0067] The mutated MenD W322I / R323F fragment was integrated into the MenD locus in the genome of strain 3AYAT02 (the strain description is shown in Table 2) to construct recombinant Bacillus subtilis 3AYAT02 - IF. The specific construction process is as follows.

[0068] Table 2 Construction of recombinant Bacillus subtilis

[0069]

[0070]

[0071] The following sequences were amplified by overlap extension PCR. The amplified sequences required for the integration cassette were the upstream sequence of menD (1000 bp in length, sequence as SEQ ID NO.5), the zeocin sequence of the chloramphenicol resistance gene (1309 bp, sequence as SEQ ID NO.6), and the first 1000 bp of the MenD W322I / R323F mutant sequence (sequence as SEQ ID NO.7). The menDup-lox71-zeo-lox66-menD fusion expression cassette was obtained by fusion PCR.

[0072] The obtained fusion expression cassette fragment was integrated into the genome of recombinant Bacillus subtilis 3AYAT02 by chemical transformation. The addition amount of the integrated fragment was about 1000 ng. Screening was carried out by adding chloramphenicol-resistant LB solid medium, and single colonies were picked for sequencing verification to confirm successful integration.

[0073] The chloramphenicol resistance of the successfully integrated recombinant Bacillus subtilis was eliminated. The Cre plasmid was transferred into the constructed recombinant Bacillus subtilis by chemical transformation. After screening with LB solid medium supplemented with kanamycin antibiotics, the expression of the Cre plasmid was induced by IPTG to eliminate the resistance gene. The elimination of the Cre plasmid was achieved by picking single colonies and inoculating them into LB liquid medium, and culturing them in a shaker at 50 °C for 12 h. Screening was carried out by spotting on LB plates without antibiotics, supplemented with chloramphenicol antibiotics, and supplemented with kanamycin antibiotics. Single colonies that successfully eliminated chloramphenicol resistance and the Cre plasmid were selected, and finally, recombinant Bacillus subtilis integrating the MenD mutant was obtained and named 3AYAT02-IF.

[0074] Example 5: Fermentation of strains to produce MK-7

[0075] (1) Preparation of seed liquid

[0076] Single colonies of recombinant Bacillus subtilis 3AYAT02 and 3AYAT02-IF constructed in Example 4 were respectively inoculated into 15 mL shaking tubes, each tube containing 3 mL of liquid seed medium, and cultured in a shaker at 37 °C and 220 rpm for 10 h. 3AYAT02 was used as a control, with three parallels for each strain.

[0077] (2) Fermentation culture

[0078] The seed liquid obtained in step (1) was inoculated into 250 mL conical flasks at an inoculation amount of 2%. Each flask was filled with 20 mL of fermentation medium and cultured in a shaker at 40 °C and 220 rpm for 6 d. After fermentation, samples were prepared. The specific method is as follows.

[0079] Take 1.2 mL of the fermentation broth after 6 days of fermentation. Take 500 μL of the fermentation broth and add it to 4 times the volume of the MK-7 extractant. After vortex oscillation extraction for 10 min, filter out the extract and centrifuge at 8000 r / min for 5 min. Collect the supernatant and detect the content of MK-7 in the whole cell components by HPLC. The detection results are shown in Figure 3 , after 6 days of fermentation, the yield of 3AYAT02-IF is 1.22 times that of the control strain 3AYAT02, indicating that it is feasible to promote the synthesis of MK-7 by improving the anti-DHNA feedback inhibition ability of MenD.

[0080] Obviously, the above embodiments are only examples for clear illustration and not limitations on the implementation manners. For those of ordinary skill in the art, other different forms of changes or modifications can be made based on the above description. It is not necessary and impossible to list all the implementation manners here. And the obvious changes or modifications derived therefrom are still within the protection scope of the present invention.

Claims

1. A mutant of 2-succinyl-5-enolacetonyl-6-hydroxy-3-cyclohexene-1-carboxylic acid synthase, characterized in that: In the mutant, the tryptophan at position 322 of the starting sequence as shown in SEQ ID NO.1 is mutated to isoleucine, and the arginine at position 323 is mutated to phenylalanine.

2. A gene encoding the mutant according to claim 1.

3. The gene according to claim 2, characterized in that: The nucleotide sequence of the gene is shown in SEQ ID NO.

4.

4. An expression vector comprising the mutant according to claim 1 or the gene according to claim 2 or 3.

5. Use of the mutant according to claim 1, the gene according to claim 2 or 3, or the expression vector according to claim 4 in increasing the yield of heptenylmenadione produced by Bacillus subtilis.

6. A method for increasing the yield of heptene menaquinone produced by Bacillus subtilis, characterized in that: The method introduces any of the following into Bacillus subtilis: (1) The mutant according to claim 1; (2) The gene according to claim 2 or 3; (3) The expression vector according to claim 4.

7. A recombinant Bacillus subtilis, characterized in that: The recombinant Bacillus subtilis comprises any one of the following: (1) The mutant according to claim 1; (2) The gene according to claim 2 or 3; (3) The expression vector according to claim 4.

8. The recombinant Bacillus subtilis according to claim 7, characterized in that: The genome of the recombinant Bacillus subtilis has a knockout nucleotide sequence of a 2-succinyl-5-enolacetonyl-6-hydroxy-3-cyclohexene-1-carboxylic acid synthase encoding gene as shown in SEQ ID NO.

3.

9. The recombinant Bacillus subtilis according to claim 7, characterized in that: The Bacillus subtilis is Bacillus subtilis 168.

10. A microbial agent comprising the recombinant Bacillus subtilis according to any one of claims 7 to 9.

11. Use of the mutant according to claim 1, the gene according to claim 2 or 3, the expression vector according to claim 4, the recombinant Bacillus subtilis according to any one of claims 1 to 9, or the microbial agent according to claim 10 in the production of heptenylmenadione.

12. A method for producing heptene menaquinone, characterized in that: Heptene-methyl menadione is produced by using a fermentation system comprising the recombinant Bacillus subtilis described in any one of claims 7 to 9 or the microbial agent described in claim 10.

13. The method according to claim 12, characterized in that: The recombinant Bacillus subtilis is activated in the seed culture medium and then transferred to the fermentation medium for culturing for 120-144 hours.

14. The method according to claim 12, characterized in that: The seed culture medium contains 10-12 g / L of peptone, 5-10 g / L of yeast powder and 10-12 g / L of sodium chloride.

15. The method according to claim 12, characterized in that: The fermentation medium contains 50-55 g / L of glucose, 50-55 g / L of glycerol, 50-55 g / L of soy peptone and 0.6-1 g / L of potassium dihydrogen phosphate.

Images