A type III pullulan hydrolase mutant with improved enzyme activity and a method for constructing the same
By performing site-directed mutagenesis on type III pullulan hydrolase TK-PUL, especially the C282R/C283E mutation, the problem of low catalytic efficiency was solved, and efficient hydrolysis of cassava starch to produce linear maltooligosaccharides was achieved, reducing production costs and simplifying the process.
Patent Information
- Application Number
- CN202510283939.1
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-03-11
- Publication Date
- 2025-09-16
- Estimated Expiration
- 2045-03-11
AI Technical Summary
The existing type III pullulan hydrolase TK-PUL has low catalytic efficiency, making it difficult to efficiently hydrolyze starch to produce linear maltooligosaccharides. There is also no research on its application in using cassava starch as raw material, resulting in high production costs and complex processes.
By performing site-directed mutagenesis on type III pullulan hydrolase TK-PUL, specifically mutating the 282nd amino acid to arginine (R) and the 283rd amino acid to glutamate (E), a type III pullulan hydrolase mutant C282R/C283E was constructed to improve its enzyme activity towards cassava starch.
The specific enzyme activity of the mutant C282R/C283E increased to 89.08 U/mg, significantly improving the degradation ability of cassava starch. The conversion rate of linear maltooligosaccharides in the product increased from 84.50% to 92.23%, meeting the requirements of linear maltooligosaccharide production.
Smart Images

Figure CN120137950B_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the technical fields of genetic engineering and enzyme engineering, and in particular to a type III pullulan hydrolase mutant with improved enzyme activity and a construction method thereof. Background Art
[0002] Linear maltooligosaccharides are typically composed of 2 to 10 glucose molecules linked by α-1,4-glycosidic bonds. These oligosaccharides are widely used in food because they are relatively low in sweetness, can slow starch aging, and play an important role in maintaining blood sugar balance and improving the intestinal environment.
[0003] Currently, the industry primarily uses enzymatic starch hydrolysis to produce linear maltooligosaccharides. The production process for linear maltooligosaccharides involves two steps: liquefaction and saccharification. During these steps, different glycoside hydrolases hydrolyze the α-1,4-glycosidic bonds and α-1,6-glycosidic bonds in the starch feedstock, ultimately producing linear maltooligosaccharides. The use of multiple glycoside hydrolases complicates the production process and increases production costs.
[0004] The thermophilic acidophilic type III pullulanase (TK-PUL), derived from the thermophilic archaeon Thermococcus kodakarensis, hydrolyzes α-1,4- and α-1,6-glycosidic bonds in starch. Application of TK-PUL in the production of linear maltooligosaccharides (MLOS) allows the liquefaction and saccharification steps to be combined, significantly simplifying the production process, reducing costs, and improving efficiency. Previous studies have shown that when TK-PUL is added to a 30% corn starch emulsion (100 mM sodium citrate buffer, pH 4.2) at a concentration of 1 mg / g starch dry matter and reacted at 100°C for 10 minutes followed by 90°C for 96 hours, the product contains 85.5% G2-G10 residues. This suggests that TK-PUL has significant potential for application in the production of LOS. However, the catalytic efficiency of TK-PUL is relatively low, making it difficult to efficiently exert its hydrolysis effect in actual industrial production, which limits the application of TK-PUL in the production and preparation of linear maltooligosaccharides. In addition, compared with traditional production raw materials such as corn starch and wheat starch, "non-grain" production raw materials such as cassava starch have advantages such as wide sources and low cost. As an alternative biomass energy source, it has great application and development prospects. At present, there is no research on the production of linear maltooligosaccharides using cassava starch as raw material by type III pullulan hydrolase. Therefore, the development of type III pullulan hydrolase mutants with improved cassava starch degradation ability is of great significance for the application of type III pullulan hydrolase in the production of linear maltooligosaccharides using cassava starch as raw material. Summary of the Invention
[0005] The present invention aims to provide a type III pullulan hydrolase mutant with enhanced enzymatic activity and a method for its construction to address the aforementioned problems of the prior art. The type III pullulan hydrolase mutant prepared by the present invention has a high cassava starch degradation ability, and its enzymatic properties meet the requirements of the linear maltooligosaccharide production process. The enzyme has significant application potential in the production of linear maltooligosaccharides.
[0006] To achieve the above object, the present invention provides the following solutions:
[0007] The present invention provides a type III pullulan hydrolase mutant, the amino acid sequence of which is shown in SEQ ID NO.3.
[0008] The present invention also provides a gene encoding the above-mentioned type III pullulan hydrolase mutant.
[0009] Furthermore, the nucleotide sequence of the encoding gene is shown as SEQ ID NO.4.
[0010] The present invention also provides a recombinant vector comprising the above-mentioned encoding gene.
[0011] The present invention also provides a recombinant microbial strain comprising the above-mentioned recombinant vector.
[0012] The present invention also provides the use of the above-mentioned encoding gene, recombinant vector or recombinant microbial strain in preparing a type III pullulan hydrolase mutant.
[0013] The present invention also provides the use of the above-mentioned type III pullulan hydrolase mutant in producing linear maltooligosaccharides using cassava starch as raw material.
[0014] The present invention also provides a method for preparing linear maltooligosaccharides, comprising the steps of using cassava starch as a substrate, employing the above-mentioned type III pullulan hydrolase mutant as an enzyme catalyst, and performing an enzymatic hydrolysis reaction to prepare the linear maltooligosaccharides.
[0015] Furthermore, the mass ratio of the type III pullulan hydrolase mutant to the cassava starch is (1-4) mg:1 g.
[0016] The present invention also provides a method for improving the enzymatic activity of type III pullulan hydrolase TK-PUL in catalyzing the hydrolysis of cassava starch into linear maltooligosaccharides, characterized in that the amino acid sequence of the type III pullulan hydrolase TK-PUL is as shown in SEQ ID NO.1;
[0017] The method comprises the steps of mutating the 282nd amino acid of the type III pullulan hydrolase TK-PUL into arginine (R) and mutating the 283rd amino acid into glutamic acid (E).
[0018] The present invention discloses the following technical effects:
[0019] The present invention provides a type III pullulan hydrolase mutant with enhanced enzymatic activity. This type III pullulan hydrolase mutant is based on the type III pullulan hydrolase TK-PUL from Thermococcus kodakarensis, with enhanced enzymatic activity achieved through site-directed mutagenesis. The specific enzyme activity of this type III pullulan hydrolase mutant on cassava starch is increased from 48.68 U / mg in the control (before mutation) to 89.08 U / mg, a 1.83-fold increase. Using cassava starch as a substrate, the optimal reaction temperature of this type III pullulan hydrolase mutant is 100°C, the optimal reaction pH is 4.5, and the half-life at 90°C is 20 hours. Using 30% cassava starch as a substrate and adding 4 mg / g of dry cassava starch to this type III pullulan hydrolase, the substrate conversion rate of linear maltooligosaccharide G2-G10 components in the product is increased from 84.50% in the control (before mutation) to 92.23%. The cassava starch degradation ability of the type III pullulan hydrolase mutant is significantly improved, and its enzymatic properties meet the requirements of the production and preparation process of linear maltooligosaccharides, thereby increasing the application potential of the enzyme in the production and preparation of linear maltooligosaccharides. BRIEF DESCRIPTION OF THE DRAWINGS
[0020] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the following briefly introduces the drawings required for use in the embodiments. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying any creative work.
[0021] Figure 1 Statistical graph of the specific enzyme activities of type III pullulan hydrolase TK-PUL and mutant C282R / C283E at different reaction temperatures;
[0022] Figure 2 Statistical graph of the specific enzyme activities of type III pullulan hydrolase TK-PUL and mutant C282R / C283E at different reaction pH;
[0023] Figure 3 The figure shows the results of the determination of the thermal stability of type III pullulan hydrolase TK-PUL and mutant C282R / C283E at 90°C;
[0024] Figure 4Statistical graph showing the substrate conversion rate of type III pullulan hydrolase TK-PUL and mutant C282R / C283E using cassava starch as substrate to prepare linear maltooligosaccharides (G2-G10). DETAILED DESCRIPTION
[0025] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as limiting the present invention, but rather as a more detailed description of certain aspects, features, and embodiments of the present invention.
[0026] It should be understood that the terms described herein are intended only to describe particular embodiments and are not intended to limit the present invention. In addition, for numerical ranges herein, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. The intermediate value within any stated value or stated range, and each smaller range between any other stated value or intermediate value within the stated range, is also encompassed within the present invention. The upper and lower limits of these smaller ranges may be independently included or excluded within the scope.
[0027] Unless otherwise indicated, all technical and scientific terms used herein have the same meaning as commonly understood by those skilled in the art. Although only preferred methods and materials are described herein, any methods and materials similar or equivalent to those described herein may also be used in the practice or testing of the present invention. All documents mentioned in this specification are incorporated by reference to disclose and describe the methods and / or materials associated with the documents. In the event of any conflict with any incorporated document, the contents of this specification shall prevail.
[0028] It will be apparent to those skilled in the art that various modifications and variations may be made to the specific embodiments described herein without departing from the scope or spirit of the invention. Other embodiments will be apparent to those skilled in the art from the description of the invention. The description and examples are intended to be exemplary only.
[0029] The words “include,” “including,” “have,” “contain,” etc. used in this document are open-ended terms, meaning including but not limited to.
[0030] The experimental materials used in the following examples are as follows:
[0031] 1. Strains and vectors
[0032] Escherichia coli JM109 (provided by the Institute of Microbiology, Jiangxi Academy of Sciences), Bacillus subtilis WB600 (provided by the Institute of Microbiology, Jiangxi Academy of Sciences), and Bacillus subtilis expression vector pSTOP1622 (purchased from MoBiTec).
[0033] 2. Enzymes and other biochemical reagents
[0034] The gene site-directed mutagenesis kit was purchased from Shanghai Biyuntian Biotechnology Co., Ltd., KOD-Plus-neo DNA polymerase was purchased from Toyobo, DNA restriction endonucleases and T4 DNA ligase were purchased from Fermentase, DNA gel recovery kit and plasmid extraction kit EZNA were purchased from Omega Bio-tek, and Chelating Sepharose TM Fast Flow was purchased from GE Healthcare, USA, cassava starch was purchased from Beijing Biolab Technology Co., Ltd., and other chemical reagents were domestically produced or imported of analytical grade.
[0035] 3. Culture medium
[0036] LB medium: 10 g / L tryptone, 5 g / L yeast extract, 10 g / L NaCl, pH 7.0. The screening medium used LB medium containing 100 μg / mL ampicillin.
[0037] The molecular cloning and protein detection techniques used in the present invention are conventional techniques in the art. Techniques not described in detail in the following examples were performed according to the relevant sections of the following laboratory manual: Green MR, Sambrook J. Molecular cloning: a laboratory manual [M]. New York: Cold Spring Harbor Laboratory Press, 2012.
[0038] 4. Wild enzymes and their mutants
[0039] The type III pullulan hydrolase mutant of the present invention is obtained by site-directed mutagenesis based on the type III pullulan hydrolase TK-PUL derived from Thermococcus kodakarensis, wherein the amino acid sequence of the type III pullulan hydrolase TK-PUL is shown in SEQ ID NO.1, and the nucleotide sequence of the gene encoding it is shown in SEQ ID NO.2; the amino acid sequence of the type III pullulan hydrolase mutant C282R / C283E is shown in SEQ ID NO.3, and the nucleotide sequence of the gene encoding it is shown in SEQ ID NO.4.
[0040] SEQ ID NO.1:
[0041] 。
[0042] SEQ ID NO.2:
[0043]
[0044] SEQ ID NO.3:
[0045] 。
[0046] SEQ ID NO.4:
[0047] ATGAAAAAAGGTGGTCTGCTGCTCATTCTCCTGATTCTGGTCTCAATCGCCGAGAAAGGCTGTCCCTCCGGAAGAGTCCCGGTGAAGTTCACGTACAACCCCGGAAACAAGACCGTAAAGTCTGTCAGCCTCCGCGGGAGCTTCAACAACTGGGGAGAGTGGCCGATGGAGCTGAAGAACGGCACGTGGGAGACGACCGTCTGTCTCCGCCCTGGAAGGTATGAGTATAAGTACTTCATCAACGGCCAGTGGGTCAAGGACATGTCCGACGACGGGACGGGAAGGCCCTACGACCCCGATGCAGACGCCTATGCCCCCGATGGCTACGGGGGAAAGAACGCCGTGA
[0048] GGGTAGTTGAGGGCCGCGAAGCGTTCTACGTGGAGTTCGATCCAAGAGACCCAGCCTA
[0049] CCTCAGCATCGCGGACAAAAGAACCGTGGTCAGGTTCGAGGCTAAGAGAGACACCGTC
[0050] GAGTCTGCGGTTCTCGTTACGGATCACGGGAACTACACGATGAAGCTTCAGGTCTGGTG
[0051] GGACTTCGGCGAAACCTGGCGCGCCGAGATGCCAGTTGAACCCGCTGATTATTACATTC
[0052] TCGTAACCTCCTCCGACGGCGGGAAGTTTGCCGTCCTAAACACAAGCGAAAGCCCGTTC
[0053] TTCCACTTTGATGGCGTTGAGGGGTTCCCCCAGCTGGAGTGGGTGAGCAACGGGATAAC
[0054] CTACCAGATATTCCCCGACAGGTTCAACAACGGCAATAAAAGCAACGATGCCCTAGCTT
[0055] TGGATCACGACGAGCTAATTTTGAACCAGGTTAATCCAGGGCAGCCAATCCTCTCCAAC
[0056] TGGAGCGACCCGATAACGCCCCTCCACCGCGAACACCAGTACTTCGGCGGCGACATAAA
[0057] GGGAATAACGGAGAAGCTCGACTACCTTCAGAGCCTAGGTGTTACTATAATCTACATCAA
[0058] CCCGATTTTCCTCTCGGGAAGCGCCCACGGCTACGACACCTACGACTACTACCGGCTCG
[0059] ACCCCAAGTTCGGGACCGAGGATGAGCTGAGAGAGTTCCTCGATGAGGCCCACAGGAG
[0060] GGGAATGAGGGTAATCTTCGATTTCGTGCCCAACCACTGCGGCATAGGGAATCCAGCCT
[0061] TCCTCGACGTCTGGGAGAAGGGCAACGAAAGCCCATACTGGGACTGGTTCTTCGTCAA
[0062] GAAGTGGCCCTTCAAGCTCGGCGATGGGAGCGCCTACGTCGGCTGGTGGGGCTTTGGG
[0063] AGCCTTCCGAAGCTCAACACTGCCAACCAGGAGGTCAGGGAGTACCTGATAGGAGCGG
[0064] CCCTCCACTGGATAGAGTTCGGCTTTGACGGCATTAGGGTGGATGTGCCGAACGAAGTC
[0065] CTCGACCCGGGGACGTTCTTCCCGGAGCTGAGAAAGGCAGTTAAGGAGAAAAACCCCG
[0066] ACGCGTACCTCGTCGGCGAGATATGGACGGAATCCCCGGAGTGGGTGAAGGGAGACCG
[0067] CTTCGACTCCCTCATGAACTACGCCCTCGGGAGGGACATCCTCCTGAACTACGCTAAGG
[0068] GCCTGCTCAGCGGAGAAAGTGCAATGAAAATGATGGGACGTTACTACGCTTCCTACGGC
[0069] GAGAACGTAGTTGCGATGGGCTTCAACCTCGTTGATTCGCACGACACTTCGAGGGTTCT
[0070] CACTGACCTCGGTGGTGGCAAACTGGGAGACACACCGTCAAACGAGTCAATTCAGAGG
[0071] CTCAAGCTCCTCTCAACGCTCCTCTATGCCCTGCCCGGAACTCCCGTCACCTTCCAGGG
[0072] GGACGAGAGGGGACTGCTCGGAGACAAGGGACACTACGATGAGCAACGCTATCCGATA
[0073] CAGTGGGATACTGTGAACGAGGACGTCCTGAACCACTACAGGGCACTGGCGGAGCTCA
[0074] GAAAAAGAGTTCCCGCATTGAGGAGCAGCGCAATGAGGTTCTACACTGCCAAAGGCGG
[0075] CGTTATGGCCTTCTTCAGGGGACATCATGACGAGGTTCTCGTCGTTGCCAACAGCTGGA
[0076] AGAAGCCAGCCCTACTGGAGCTTCCCGAGGGAGAGTGGAAAGTAATCTGGCCTGAGGA
[0077] TTTCAGCCCGGAACTGCTTCGCGGCACAGTTGAAGTGCCAGCCATAGGGATAATCATCC
[0078] TTGAGCGGGGTCATCATCATCATCATCATTGA。
[0079] Example 1 Construction of Type III Pullulan Hydrolase Mutants
[0080] (1) Construction of recombinant plasmid pSTOP1622-tkpul
[0081] PCR amplification was performed using the nucleotide sequence shown in SEQ ID NO. 2 as a template and primers P1 and P2 (Table 1). PCR amplification conditions were: 95°C for 10 min; 98°C for 30 sec, 60°C for 30 sec, 74°C for 1 min, 30 cycles; and 74°C for 5 min. The amplified product was double-digested with Spe I and BamH I and ligated into the pSTOP1622 vector to construct the recombinant plasmid pSTOP1622-tkpul.
[0082] Table 1 Primers used to construct recombinant plasmids
[0083]
[0084]
[0085]
[0086] Note: The underlined part is the restriction enzyme cleavage site.
[0087] (2) Construction and screening of site-directed saturation mutants
[0088] Cysteine 282 or 283 in type III pullulan hydrolase TK-PUL was selected as the site of saturation mutation, 38 mutants were constructed, and the specific enzyme activities of the mutants using 1% (m / v) cassava starch as substrate were measured.
[0089] Construction of mutants:
[0090] For the construction of mutant C282A, the recombinant plasmid pSTOP1622-tkpul was used as a template, and primers C282A-F and C282A-R (Table 1) were used. A site-directed mutagenesis kit was used to mutate the cysteine coding sequence at position 282 to the coding sequence for alanine. PCR amplification conditions were: 94°C for 5 minutes, followed by 35 cycles of 94°C for 30 seconds, 55°C for 20 seconds, and 68°C for 4 minutes, and finally 68°C for 10 minutes.
[0091] The amplified product was treated with Dpn I and then electroporated into competent E. coli JM109 cells. The cells were plated on LB plates containing 100 μg / mL ampicillin and cultured overnight at 37°C. A single transformant was picked from the LB plate, and the recombinant plasmid pSTOP1622-tkpulC282A contained within was extracted. PCR amplification was performed using the recombinant plasmid pSTOP1622-tkpulC282A as a template and primers P1 and P2. The amplified DNA was sent to Shanghai Sangon Biotechnology Co., Ltd. for sequencing. Sequencing confirmed the presence of the mutant gene tkpulC282A. The correctly sequenced recombinant plasmid pSTOP1622-tkpulC282A was then transformed into B. subtilis WB600 to obtain the genetically engineered strain B. subtilis WB600 / pSTOP1622-tkpulC282A.
[0092] The construction of the remaining mutants was carried out according to the construction method of mutant C282A.
[0093] Induction expression and purification of mutants: Genetically engineered bacteria were inoculated into 20 mL LB liquid medium containing 20 μg / mL tetracycline and cultured overnight at 37°C with rapid shaking. The overnight culture was transferred to 50 mL LB liquid medium containing 20 μg / mL tetracycline at a 1% inoculum volume and cultured at 37°C with rapid shaking until the bacterial solution OD 600nm Add xylose to a final concentration of 0.5%, continue to culture at 37°C for 30 hours, and then centrifuge at 12000r / min for 10 minutes to collect the fermentation supernatant. 2+ The target protein in the fermentation supernatant was purified using an affinity chromatography column and eluted with 200 mmol / L imidazole elution buffer to obtain the purified mutant. The purity of the mutant was determined by SDS-PAGE, and the concentration of the mutant was determined by the Bradford method.
[0094] Mutant Screening: The specific enzyme activity of type III pullulan hydrolase TK-PUL and its mutants was determined using cassava starch as a substrate. 10 μL of enzyme solution was mixed with 490 μL of 50 mmol / L 2-(N-morpholino)ethanesulfonic acid (MES) buffer (pH 4.5) containing 1% (m / v) cassava starch. The mixture was reacted at 100°C for 30 minutes and then immediately placed in an ice-water bath to terminate the reaction. The amount of reducing sugar in the reaction system was then determined using the 3,5-dinitrosalicylic acid method. The resulting reducing sugar was converted to maltose mass using a maltose standard working curve. One unit of enzyme activity (U) is defined as the amount of enzyme that catalyzes the production of 1 μmol of maltose per minute under defined reaction conditions.
[0095] The specific enzyme activity of type III pullulan hydrolase TK-PUL on cassava starch was 48.68 ± 1.32 U / mg. The results of the specific enzyme activity assays of the mutants on cassava starch are shown in Table 2. The specific enzyme activity assays showed that the specific enzyme activities of mutants C282K, C282R, C283D, C283E, and C283S were significantly higher than that of type III pullulan hydrolase TK-PUL. Among them, the specific enzyme activity of mutant C282K was 49.35 U / mg, which increased by 1.01 times; the specific enzyme activity of mutant C282R was 49.92 U / mg, which increased by 1.03 times; the specific enzyme activity of mutant C283D was 65.08 U / mg, which increased by 1.34 times; the specific enzyme activity of mutant C283E was 68.93 U / mg, which increased by 1.42 times; and the specific enzyme activity of mutant C283S was 59.90 U / mg, which increased by 1.23 times.
[0096] Table 2 Results of enzyme activity assay of mutants on cassava starch
[0097]
[0098]
[0099] (3) Construction and screening of combined mutants
[0100] Construction of combined mutants: Mutations that improve the specific enzymatic activity of type III pullulan hydrolase were combined and superimposed to construct the combined mutants C282K / C283D, C282K / C283E, C282K / C283S, C282R / C283D, C282R / C283E, and C282R / C283S. The construction method is illustrated using the mutant C282K / C283D as an example:
[0101] PCR amplification was performed using the recombinant plasmid pSTOP1622-tkpulC282K as a template and primers C282K / C283D-F and C282K / C283D-R listed in Table 1. PCR amplification conditions were: 94°C for 5 minutes, followed by 35 cycles of 94°C for 30 seconds, 55°C for 20 seconds, and 68°C for 4 minutes, and finally 68°C for 10 minutes. The amplified product was treated with Dpn I and then electroporated into competent E. coli JM109 cells. The cells were plated on LB plates containing 100 μg / mL ampicillin and incubated overnight at 37°C. Individual transformants were picked from the LB plates and the recombinant plasmid pSTOP1622-tkpulC282K / C283D contained within them was isolated. PCR amplification was performed using the recombinant plasmid pSTOP1622-tkpulC282K / C283D as a template and primers P1 and P2. The amplified DNA was sent to Shanghai Sangon Biotechnology Co., Ltd. for sequencing. Sequencing confirmed the presence of the mutant gene tkpulC282K / C283D. The correctly sequenced recombinant plasmid pSTOP1622-tkpulC282K / C283D was transformed into B. subtilis WB600 to obtain the genetically engineered strain B. subtilis WB600 / pSTOP1622-tkpulC282K / C283D.
[0102] The construction of the remaining combination mutants was carried out according to the construction method of the combination mutant C282K / C283D.
[0103] Induction expression and purification of combined mutants: Genetically engineered bacteria were inoculated into 20 mL LB liquid medium containing 20 μg / mL tetracycline and cultured overnight at 37°C with rapid shaking. The overnight culture was transferred to 50 mL LB liquid medium containing 20 μg / mL tetracycline at a 1% inoculum volume and cultured at 37°C with rapid shaking until the bacterial solution OD 600nm Add xylose to a final concentration of 0.5%, continue to culture at 37°C for 30 hours, and then centrifuge at 12000r / min for 10 minutes to collect the fermentation supernatant. 2+ The target protein in the fermentation supernatant was purified using an affinity chromatography column and eluted with 200 mmol / L imidazole elution buffer to obtain the purified mutant. The purity of the mutant was determined by SDS-PAGE, and the concentration of the mutant was determined by the Bradford method.
[0104] Screening of combined mutants: The specific enzyme activity of the combined mutants was determined using cassava starch as a substrate. 10 μL of enzyme solution was mixed with 490 μL of 50 mmol / L MES buffer (pH 4.5) containing 1% (m / v) cassava starch. The mixture was reacted at 100°C for 30 minutes, then immediately placed in an ice-water bath to terminate the reaction. The amount of reducing sugar in the reaction system was then determined using the 3,5-dinitrosalicylic acid method. The resulting reducing sugar was converted to maltose mass using a maltose standard working curve. One unit of enzyme activity (U) is defined as the amount of enzyme that catalyzes the production of 1 μmol of maltose per minute under defined reaction conditions.
[0105] The results of the enzyme activity assays of the combined mutants on cassava starch are shown in Table 3. These assays showed that the specific enzyme activities of the combined mutants were significantly higher than those of type III pullulan hydrolase TK-PUL. Among them, the combined mutant C282R / C283E exhibited the highest specific enzyme activity, at 89.08 U / mg, a 1.83-fold increase.
[0106] Table 3 Results of enzyme activity assay of combined mutants on cassava starch
[0107]
[0108] Example 2 Verification of the enzymatic properties of the type III pullulan hydrolase mutant C282R / C283E
[0109] (1) Optimal reaction temperature of type III pullulan hydrolase mutant C282R / C283E
[0110] 10 μL of enzyme solution was mixed with 490 μL of 50 mmol / L MES, pH 4.5 buffer containing 1% (m / v) cassava starch. The mixture was reacted at 40-110°C for 30 min, and the specific enzyme activity was measured under different temperature conditions. The highest specific enzyme activity measured was defined as 100%, and the percentage of relative enzyme activity was plotted against temperature to determine the optimal reaction temperature of the enzyme. The optimal reaction temperature determination results of type III pullulan hydrolase TK-PUL and mutant C282R / C283E are shown in Figure 2. Figure 1 The optimal reaction temperature of type III pullulan hydrolase TK-PUL and its mutant C282R / C283E is 100℃.
[0111] (2) Optimal reaction pH of type III pullulan hydrolase mutant C282R / C283E
[0112] 10 μL of enzyme solution was mixed with 1% (m / v) cassava starch solution of different pH values, and the sample was reacted at 100°C for 30 minutes to determine the specific enzyme activity. The highest specific enzyme activity measured was defined as 100%, and the percentage of relative enzyme activity was plotted against pH value to determine the optimal reaction pH of the enzyme. 1% (m / v) cassava starch solutions of different pH values were prepared using different buffers: 50 mmol / L MES (pH 3.0-7.0), 50 mmol / L MOPS (pH 7.0-9.0). The optimal reaction pH determination results of type III pullulan hydrolase TK-PUL and mutant C282R / C283E are shown in the figure. Figure 2 The optimal reaction pH of type III pullulan hydrolase TK-PUL and mutant C282R / C283E is about 4.5, and the changing trends of the optimal reaction pH curves of TK-PUL and mutant C282R / C283E are basically the same.
[0113] (3) Thermal stability of type III pullulan hydrolase mutant C282R / C283E at 90°C
[0114] The enzyme solution was kept at 90°C, and samples were taken out at different time intervals. The specific enzyme activity of the samples was measured using a 1% (m / v) cassava starch solution (50 mmol / LMES, pH 4.5) as a substrate at 100°C for 30 minutes. The enzyme activity of the untreated enzyme solution was defined as 100%, and the percentage of relative enzyme activity was plotted against time to evaluate the thermal stability of the enzyme. The thermal stability test results of type III pullulan hydrolase TK-PUL and mutant C282R / C283E are shown in Figure 2. Figure 3 The half-life of type III pullulan hydrolase TK-PUL and mutant C282R / C283E at 90℃ was about 20h.
[0115] The above enzymatic property determination results showed that the optimal reaction temperature, optimal reaction pH and thermal stability of the mutant C282R / C283E were basically consistent with those of TK-PUL.
[0116] Example 3 Preparation of linear maltooligosaccharides by type III pullulan hydrolase mutant C282R / C283E
[0117] Method for preparing linear maltooligosaccharides using type III pullulan hydrolase and product analysis: 100 mL of 30% (m / v) cassava starch emulsion (50 mmol / L MES, pH 4.5) was prepared and slurried in a 70°C waterbath at a stirring rate of 400 rpm for 10 minutes. Type III pullulan hydrolase was then added to the emulsion at enzyme dosages of 1 mg enzyme / g dry cassava starch, 2 mg enzyme / g dry cassava starch, and 4 mg enzyme / g dry cassava starch. Each mixture was stirred at 100°C for 10 minutes at the same stirring rate. The reaction was then terminated after each mixture was stirred at 90°C for 6, 12, 18, 24, or 36 hours at the same stirring rate. After completion of the reaction, 1 mL of the reaction mixture was removed, ice-cooled, and centrifuged at 12,000 × g for 10 minutes. The supernatant was collected. Half of the supernatant was freeze-dried to obtain dry starch saccharides, which were then weighed. The remaining half of the supernatant was diluted 10,000-fold and filtered through a 0.22 μm pore size water filter to obtain the product to be analyzed. The linear maltooligosaccharide G2-G10 component content in the product was determined by HPAEC-PAD using a linear maltooligosaccharide G2-G10 standard as a quantitative and qualitative standard. The substrate conversion rate of the linear maltooligosaccharide G2-G10 component was also calculated. The substrate conversion rate of the linear maltooligosaccharide G2-G10 component was calculated as follows: G2-G10 substrate conversion rate = [(G2-G10 component content × dry starch sugar mass g × 200) / 30 g (dry cassava starch mass)] × 100%.
[0118] Type III pullulan hydrolase TK-PUL and mutant C282R / C283E were used to prepare linear maltooligosaccharides using cassava starch as substrate. The substrate conversion rates of G2-G10 components in the products were determined as shown in the following table. Figure 4 As shown. Figure 4It can be seen that with the extension of reaction time, the substrate conversion rate of the G2-G10 component in the product increases until it remains unchanged; with the increase of the addition amount of type III pullulan hydrolase, the substrate conversion rate of the G2-G10 component in the product also gradually increases. When the addition amount of type III pullulan hydrolase was 1 mg enzyme / g dry cassava starch and the enzyme reaction time was 36 h, the substrate conversion rate corresponding to TK-PUL was 65.41%, and the substrate conversion rate corresponding to mutant C282R / C283E was 77.19%; when the addition amount of type III pullulan hydrolase was 2 mg enzyme / g dry cassava starch and the enzyme reaction time was 36 h, the substrate conversion rate corresponding to TK-PUL was 79.15%, and the substrate conversion rate corresponding to mutant C282R / C283E was 83.29%; when the addition amount of type III pullulan hydrolase was 4 mg enzyme / g dry cassava starch and the enzyme reaction time was 36 h, the substrate conversion rate corresponding to TK-PUL was 84.50%, and the substrate conversion rate corresponding to mutant C282R / C283E was 92.23%. Under the same conditions, the C282R / C283E mutants achieved higher substrate conversion rates than the type III pullulan hydrolase TK-PUL in producing linear maltooligosaccharides using cassava starch as a substrate. Compared with the type III pullulan hydrolase TK-PUL, the type III pullulan hydrolase C282R / C283E mutants have greater application potential in the production of linear maltooligosaccharides.
[0119] The embodiments described above are merely descriptions of preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Without departing from the spirit of the present invention, various modifications and improvements made to the technical solutions of the present invention by persons skilled in the art should fall within the scope of protection defined by the claims of the present invention.
Claims
1. A type III pullulan hydrolase mutant, characterized in that The amino acid sequence is shown in SEQ ID NO.
3.
2. A gene encoding the type III pullulan hydrolase mutant according to claim 1.
3. The coding gene according to claim 2, characterized in that The nucleotide sequence of the coding gene is shown in SEQ ID NO.
4.
4. A recombinant vector, characterized in that Comprising the coding gene according to claim 2 or 3.
5. A recombinant microbial strain, characterized in that Comprising the recombinant vector according to claim 4.
6. Use of the encoding gene according to claim 2 or 3, the recombinant vector according to claim 4 or the recombinant microbial strain according to claim 5 in preparing a type III pullulan hydrolase mutant.
7. Use of the type III pullulan hydrolase mutant according to claim 1 in producing linear maltooligosaccharides using cassava starch as raw material.
Citation Information
Patent Citations
Pullulanase variants and uses thereof
CN102791854A
Thermophilic acidic III-type pullulan hydrolase mutant with improved starch degradation capability as well as preparation method and application of thermophilic acidic III-type pullulan hydrolase mutant
CN114934035A