Key gene RcERF110 for regulating stress resistance of Chinese rose and application of key gene RcERF110

Abstract

The invention discloses a key gene RcERF110 for regulating stress resistance of Chinese rose and application of the key gene RcERF110, the nucleotide sequence of the key gene RcERF110 is as shown in SEQ ID No.1, the amino acid sequence of the key gene RcERF110 is as shown in SEQ ID No.2, and the expression mode of the gene RcERF110 is obviously induced by drought stress and high temperature stress. A genetic transformation experiment shows that the drought tolerance and the high temperature resistance of a transgenic plant can be remarkably enhanced by overexpressing the gene in a model plant tobacco. Further, a gene silencing experiment in Chinese rose proves that the dehydration tolerance of petal tissues can be remarkably reduced and the heat stress resistance of plants can be weakened by inhibiting the expression of the gene RcERF110. The invention not only provides a new theoretical basis for analyzing a rosaceae plant abiotic stress response molecular mechanism, but also lays an important foundation for creating a drought-resistant and heat-resistant Chinese rose new germplasm through a molecular breeding technology, and has an important application value for horticultural plant stress resistance genetic improvement.

Description

Technical Field

[0001] The present invention relates to the technical field of rose genetic engineering, and specifically relates to a key gene RcERF110 for regulating the stress resistance of roses and its application. Background Art

[0002] Drought stress and high temperature stress are two of the most common abiotic stresses in plant growth and development. At the physiological level, cell and tissue damage in plants leads to weakened growth and development. The cell membrane, accumulation of osmoregulatory substances, and photosynthetic characteristics of plants are all affected, seriously reducing the quality and yield of plants and causing economic losses. Drought has a serious impact on important organs such as the roots and leaves of plants. To cope with the harsh environment, plants adopt various strategies such as stomatal closure, enhanced water transport, and synthesis and deposition of epidermal wax to resist drought stress. There is a correlation between drought and high temperature stress, which often occur simultaneously or successively, affecting the geographical distribution of plants to a certain extent and reducing species diversity. Drought causes plants to lack water, leading to growth and development inhibition and reduced survival rate by affecting processes such as photosynthesis, respiration, physiological metabolism, hormone accumulation, and membrane damage. High temperature stress has a greater impact on the reproductive stage of plants (Pang Yanping et al., 2024; Si Fuyan et al., 2014; Ji Yuanzu et al., 2023; Fan Chao et al., 2024; Zhang Cui et al., 2023). At this time, plants are most sensitive to temperature, and high temperature stress will cause a decrease in flower buds, flower drop, and fruit sterility in plants. For example, high temperature will reduce the pollen viability of soybeans, resulting in a decrease in yield. The germination of plant seeds is affected by temperature, and high temperature will cause a decrease in the germination rate of seeds, poor seedling activity, abnormal development, and a reduction in radicles and plumules. Affected by high temperature stress, the plant height, tiller number, and total biomass of plants will all decrease, and their morphological characteristics will change, with leaves wilting and falling off, root and stem growth inhibited, and branches and fruits damaged (Cao W et al. 2024; Tong N et al. 2024; Jing L et al. 2024; Poletto T et al. 2019).

[0003] Abiotic stress inhibits the growth and development of plants and changes the production and distribution of hormones. The AP2 / ERF family responds to stress signals to cope with stress responses. The AP2 / ERF family can also play a role in various abiotic stresses by activating some downstream functional genes responsive to stress (Shao Wenjing, 2020; Chen Yushu, 2023). It has been reported that the dehydration-responsive element binding proteins (DREBs) of the DREB family are important transcription factors regulating plant drought. Some transcription factors can be overexpressed in rice and Arabidopsis to improve drought and salt stress tolerance, and the expression of some transcription factors leads to the tolerance of Arabidopsis to high salt and drought (Salman S et al., 2024; Pratap B S et al., 2022; Song Yating, 2024). After plants are subjected to high-temperature stress, the expression of AP2 / ERF family transcription factors is induced, improving the high-temperature tolerance of plant seeds and vegetative growth periods (SeongIm P et al., 2021). Some transcription factors of the AP2 / ERF subfamily can be expressed under dehydration, high salt, and high-temperature induction without depending on ABA, and the ectopic expression in the constitutively activated form enhances the resistance of plants to drought, high salt, and heat. The above has been reported in Arabidopsis, maize, rice, apples, chrysanthemums, etc. (Kun L et al., 2021, Xinping D et al., 2021).

[0004] Chinese rose (Rosa chinensis) has a long cultivation history, a wide cultivation range, rich varieties, and is widely used in landscaping projects. However, unsuitable environments will lead to a decrease in the ornamental and economic values of Chinese rose, and in severe cases, it will cause its death. Therefore, there is an urgent need to improve the drought and heat tolerance of Chinese rose through gene editing technology to provide a practical solution for the breeding of Chinese rose varieties with drought and heat tolerance. Summary of the Invention

[0005] The object of the present invention is to provide a key gene RcERF110 for regulating the stress resistance of Chinese rose and its application in view of the current situation of the lack of key elements in the plant stress resistance molecular regulation network. The key gene RcERF110 of the present invention is derived from the ancient Chinese rose variety 'Old Blush' (Rosa chinensis 'Old Blush') and is one of the members of the ERF family of Chinese rose. AP2 / ERF is a superfamily of transcription factors existing in plants, and the AP2 / ERF family plays an important role in plant signal transduction, growth and development, and stress response.

[0006] To achieve the above object, the technical solutions designed by the present invention are as follows:

[0007] The present invention provides a key gene RcERF110 for regulating the stress resistance of Chinese rose, and its nucleotide sequence is shown in SEQ ID No. 1.

[0008] The present invention also provides a protein RcERF110 encoded by the above-mentioned key gene RcERF110, and its amino acid sequence is shown as SEQ ID No. 2.

[0009] The present invention also provides a primer pair for obtaining the above-mentioned key gene RcERF110, and the primer pair is:

[0010] Forward primer of RcERF110: 5’-GGGGTACCATGTGCCTTCTGAAGGTGGCG-3’,

[0011] Reverse primer of RcERF110: 5’-:CGGGATCCTTAGCCGGAAGACGAATGATTG-3’.

[0012] The method for obtaining the above RcERF110 gene is as follows:

[0013] Using the cDNA of Rosa chinensis ‘Old Blush’ leaves as a template and the above primer pair of the key gene RcERF110, perform PCR amplification, and purify to obtain the RcERF110 gene; wherein,

[0014] PCR system:

[0015]

[0016]

[0017] PCR conditions:

[0018]

[0019] The present invention also provides a primer pair for obtaining the silent region fragment RcERF110i of the above-mentioned key gene RcERF110, and the primer pair is:

[0020] Forward primer of RcERF110i: 5’-GCTCTAGACAGCCACTACAACACCAAC-3’,

[0021] Reverse primer of RcERF110i: 5’-GGGGTACCGCCCGATGAACCGCCC-3’;

[0022] The method for obtaining the silent region fragment RcERF110i of the key gene RcERF110 is as follows:

[0023] Using the obtained key gene RcERF110 fragment as a template and the primer pair of the above-mentioned silencing region fragment RcERF110i, perform PCR amplification, and purify to obtain the silencing region fragment RcERF110i; the PCR amplification method and system are the same as the above method and system.

[0024] The present invention also provides a recombinant expression vector, and the recombinant expression vector contains a plant expression vector of the above-mentioned key gene RcERF110, wherein the plant expression vector is pCAMBIA2300s.

[0025] The construction method of the above-mentioned recombinant expression vector includes the following steps:

[0026] Introduce the target fragment into the cloning vector 18T, and then perform the cloning vector containing the target gene 18T and pCAMBIA2300s are digested with BamHⅠ and XbaI double enzymes, and then the obtained target fragment is ligated to the digested pCAMBIA2300s vector to obtain the recombinant expression vector pCAMBIA2300s-RcERF110.

[0027] The present invention also provides a recombinant silencing vector, and the recombinant silencing vector contains a plant silencing vector of the above-mentioned silencing region fragment RcERF110i, wherein the plant expression vector is pTRV2.

[0028] The construction method of the above-mentioned recombinant silencing vector includes the following steps:

[0029] Introduce the key gene RcERF110 silencing region fragment RcERF110i into the cloning vector 18T, and then respectively digest the cloning vector containing the gene silencing fragment 18T and pTRV2 with XbaⅠ and KpnⅠ, and then ligate the obtained target fragment RcERF110i to the digested pTRV2 vector to obtain the recombinant silencing vector pTRV2-RcERF110i.

[0030] The present invention also provides a recombinant host cell, the host cell is Agrobacterium tumefaciens GV3101, and the host cell contains the above-mentioned recombinant expression vector or the above-mentioned recombinant silencing vector.

[0031] The application of any one of the following in regulating plant drought tolerance includes:

[0032] (1) The above-mentioned key gene RcERF110;

[0033] (2) The above-mentioned recombinant expression vector;

[0034] (3) The above-mentioned host cells.

[0035] As a preferred embodiment, the plant is tobacco or rose.

[0036] Use of any of the following in breeding new drought-tolerant plant varieties, comprising:

[0037] (1) The key gene RcERF110 mentioned above;

[0038] (2) the above-mentioned recombinant expression vector; (3) the above-mentioned host cell.

[0039] The idea of ​​the present invention is as follows:

[0040] The present invention systematically analyzes the regulatory mechanism of the key gene RcERF110 on plant abiotic stress tolerance by integrating forward genetics and reverse genetics strategies. The experimental results of RcERF110 overexpressing tobacco under drought and high temperature (45°C) stress conditions show that RcERF110 overexpressing tobacco shows significantly enhanced stress resistance under drought and high temperature stress conditions; while rose petals treated with virus-induced gene silencing show the opposite phenotype under dehydration and heat stress. The present invention verifies that the key gene RcERF110 is induced by high temperature and drought, and overexpressing the gene in tobacco enhances the drought and high temperature tolerance of transgenic plants, while the gene in the silent rose shows weakened resistance to drought and high temperature stress; thus revealing that the key gene RcERF110 enhances plant stress resistance by improving the ability of plants to scavenge reactive oxygen species, providing a new gene target and theoretical framework for molecular breeding of stress resistance in Rosaceae crops, and has important guiding value for the directional improvement of plant drought and heat resistance based on gene editing technology; the general method is as follows:

[0041] (1) Based on the rose transcriptome data, the full-length coding region sequence of the key gene RcERF110 was cloned by RT-PCR technology;

[0042] (2) Construction of recombinant expression vector and genetic transformation: The open reading frame of the gene RcERF110 was directionally linked to the downstream of the CaMV35S constitutive promoter to construct the plant overexpression vector pCAMBIA2300s-RcERF110, and the T3 generation homozygous transgenic tobacco strains were obtained by Agrobacterium-mediated leaf disc transformation;

[0043] (3) Construction of virus-induced gene silencing system: Design specific fragments for the conserved domain of gene RcERF110, construct pTRV2-RcERF110 silencing vector, and use Agrobacterium-mediated transient transformation system to perform VIGS treatment on rose petals in vitro;

[0044] (4) Functional verification: The molecular characterization of transgenic plants was carried out using qRT-PCR technology, combined with drought / high temperature stress phenotype analysis and determination of physiological indexes (electrical conductivity, MDA level, H 2 O 2 content, etc.), to systematically analyze the molecular mechanism by which the gene RcERF110 enhances plant stress tolerance by regulating the downstream target gene network. The research results clarify the core role of this gene in plant stress signal transduction and provide key gene resources for crop stress-resistant genetic improvement.

[0045] Advantages of the present invention:

[0046] The gene RcERF110 identified in the present invention has been functionally verified to play a key role in regulating plant stress tolerance. By constructing an overexpression vector pCAMBIA2300s-RcERF110 based on the CaMV 35S promoter and using the Agrobacterium-mediated genetic transformation technology, a stably inherited transgenic tobacco line was obtained, and its drought stress tolerance and heat stress resistance were significantly enhanced compared with the wild-type control. At the same time, after the pTRV2-RcERF110i vector constructed based on the virus-induced gene silencing system was transformed into rose petals by Agrobacterium infiltration, the interference group showed increased sensitivity to dehydration stress and aggravated heat damage phenotypes. Molecular mechanism studies have shown that the gene RcERF110 maintains cell osmotic balance and redox homeostasis by regulating the downstream stress response gene network. This research result not only reveals the core regulatory function of the gene RcERF110 in plant abiotic stress responses, but also provides an important target gene for molecular design breeding of Rosaceae crops, and has important application value for precisely regulating plant stress tolerance traits and creating stress-resistant and high-quality new varieties through gene editing technologies such as CRISPR / Cas9.

[0047] In summary: The present invention isolates and identifies the biological function of the gene RcERF110 in rose stress tolerance. At the same time, plant drought tolerance and heat tolerance can be enhanced through gene editing technology, the degree of plant damage can be reduced, and the quality and ornamental value of plants can be improved; it has important practical significance for improving plant drought tolerance and heat tolerance through gene editing technology in the future. Brief description of the drawings

[0048] Figure 1 It is a schematic diagram of the structure of the overexpression vector pCAMBIA2300s of the original plant (the vector size is 11630bp);

[0049] Figure 2 It is a schematic diagram of the structure of the original plant silencing vector pTRV2 (the vector size is 9663bp);

[0050] Figure 3 It is a diagram showing the expression of the RcERF110 gene in rose 'Yu Yue Fen' under different stresses;

[0051] In the figure, A is the diagram showing the expression of gene RcERF110 in the leaves of 'Yueyuefen' at different time points under high-temperature treatment;

[0052] B is the diagram showing the expression of gene RcERF110 in the leaves of 'Yueyuefen' at different time points under water stress treatment.

[0053] Figure 4 It is the diagram for the spatio-temporal expression analysis of gene RcERF110 in Rosa chinensis 'Yueyuefen';

[0054] In the figure, A is the diagram showing the expression of gene RcERF110 in different tissue parts of Rosa chinensis 'Yueyuefen';

[0055] B is the diagram showing the expression of gene RcERF110 in the leaves of 'Yueyuefen' at different time points under high-temperature treatment.

[0056] Figure 5 It is the diagram for the drought tolerance analysis of wild-type tobacco and RcERF110 transgenic tobacco;

[0057] In the figure, A is the phenotype diagram of wild-type and RcERF110 transgenic tobacco before, after drought treatment, and after rehydration;

[0058] B is the diagram showing the detection results of the expression of RcERF110 gene in wild-type and RcERF110 transgenic tobacco;

[0059] C is the diagram showing the detection of the relative H 2 O 2 content in the leaves of wild-type and RcERF110 transgenic tobacco before and after drought treatment;

[0060] D is the diagram showing the detection of the MDA content in the leaves of wild-type and RcERF110 transgenic tobacco before and after drought treatment.

[0061] E is the diagram showing the detection of the relative electrical conductivity in the leaves of wild-type and RcERF110 transgenic tobacco before and after drought treatment;

[0062] Figure 6 It is the diagram for the heat tolerance analysis of wild-type tobacco and RcERF110 transgenic tobacco;

[0063] In the figure, A is the phenotype diagram of wild-type and RcERF110 transgenic tobacco before, after high-temperature treatment, and after recovery;

[0064] B is the diagram showing the detection of the relative electrical conductivity in the leaves of wild-type and RcERF110 transgenic tobacco before and after high-temperature treatment;

[0065] C is the H in the leaves of wild-type and RcERF110 transgenic tobacco before and after high-temperature treatment 2 O2 Content detection chart;

[0066] D is the content detection chart of MDA in leaves of wild-type and RcERF110 transgenic tobacco before and after high-temperature treatment;

[0067] E is the relative conductivity detection chart of leaves of wild-type and RcERF110 transgenic tobacco before and after high-temperature treatment.

[0068] Figure 7 It is the analysis chart of the dehydration stress tolerance ability of petals with transient silencing of RcERF110 in Rosa chinensis;

[0069] In the figure, A is the phenotype chart of petals of Rosa chinensis control and RcERF110-silenced petals before, after dehydration treatment and after rehydration;

[0070] B is the detection result chart of the RcERF110 gene in petals of Rosa chinensis control and RcERF110-silenced petals;

[0071] C is the H 2 O 2 content detection chart of petals of Rosa chinensis control and RcERF110-silenced petals after dehydration stress treatment and after rehydration;

[0072] D is the content detection chart of MDA in petals of Rosa chinensis control and RcERF110-silenced petals after dehydration stress treatment and after rehydration;

[0073] E is the relative effective area chart of petal discs of Rosa chinensis control and RcERF110-silenced petals before and after dehydration stress treatment;

[0074] Figure 8 It is the analysis chart of the heat tolerance ability of petals with transient silencing of RcERF110 in Rosa chinensis;

[0075] In the figure, A is the phenotype chart of petals of Rosa chinensis control and RcERF110-silenced petals after normal temperature and high-temperature treatment;

[0076] B is the DAB staining result chart of petal discs of Rosa chinensis control and RcERF110-silenced petals after normal temperature and high-temperature treatment;

[0077] C is the detection result chart of the RcERF110 gene in petals of Rosa chinensis control and RcERF110-silenced petals;

[0078] D is the H 2 O 2 content chart of petal discs of Rosa chinensis control and RcERF110-silenced petals after normal temperature and high-temperature treatment;

[0079] E is the content detection chart of MDA in petals of Rosa chinensis control and RcERF110-silenced petals after dehydration stress treatment and after rehydration;

[0080] F is the detection chart of the relative conductivity of petal discs of rose control and RcERF110 - silenced petals before and after dehydration stress treatment.

[0081] Figure 9 A is the construction diagram of the expression vector pCAMBIA2300s - RcERF110 (the inserted fragment size is 1356bp);

[0082] Figure 9 B is the construction diagram of the silencing vector pTRV2 - RcERF110 (the inserted fragment size is 354bp). Detailed implementation mode

[0083] The present invention will be further described in detail below in combination with specific embodiments for the understanding of those skilled in the art.

[0084] Example 1 Isolation of gene RcERF110 and detection of the gene expression of this gene in rose 'Yu Yue Fen' leaves at different time points under water loss stress and high - temperature treatment

[0085] 1) Isolation of gene RcERF110

[0086] The gene RcERF110 was isolated from rose 'Yu Yue Fen'. Its sequence is shown as SEQ ID No.1, and the protein RcERF110 encoded by it has an amino acid sequence shown as SEQ ID No.2.

[0087] Using the cDNA of rose 'Yu Yue Fen' leaves as a template to amplify the required fragment, the specific steps are as follows:

[0088] According to the RcERF110 sequence shown in SEQ ID No.1, a primer pair for the RcERF110 gene was designed:

[0089] RcERF110 forward primer: 5’ - GGGGTACCATGTGCCTTCTGAAGGTGGCG - 3’,

[0090] RcERF110 reverse primer: 5’ - CGGGATCCTTAGCCGGAAGACGAATGATTG - 3’.

[0091] And using the cDNA obtained by reverse transcription of the RNA extracted from rose 'Yu Yue Fen' leaves as a template and the above - mentioned primer pair of the RcERF110 gene for PCR. Among them, the PCR amplification conditions are as follows:

[0092] Table 1 PCR amplification system

[0093]

[0094] Table 2 PCR amplification conditions

[0095]

[0096] The amplified product was purified to obtain the key gene RcERF110;

[0097] The amplified gene RcERF110 was ligated into the 18-T vector, positive clones were screened and sequenced to obtain the required full-length gene; this clone was named the 18-RcERF110 plasmid.

[0098] 2) Detection of the gene expression level of gene RcERF110 in the leaves of roses at different time points under water loss stress and high temperature treatment

[0099] Rose water loss stress treatment: After the tissue culture seedlings of rose 'Yueyuefen' were transplanted into the ground and grown for one month, 15 healthy plants were taken out of the soil, their roots were washed, and they were cultured in clean water for 1 day. Then the plants were taken out, blotted dry with filter paper, and placed on clean filter paper for water loss treatment. The middle and upper leaf tissues of the plants were collected at 0 h, 0.5 h, 1 h, 2 h, 4 h, 6 h, 8 h, and 10 h after water loss treatment.

[0100] Rose high temperature treatment: After the tissue culture seedlings of rose 'Yueyuefen' were transplanted into the ground and grown for two months, 30 healthy plants were subjected to high temperature (42 °C) stress treatment. The middle and upper leaf tissues of the plants were collected at 0 h, 0.5 h, 1 h, 3 h, 6 h, 9 h, 12 h, and 24 h after high temperature treatment.

[0101] The total RNA extraction method for roses was to extract using the Huayueyang Qucik Plant microRNA Rapid Extraction Kit (ZH011-50PLUS), and reverse transcription was performed using the Aike Rui Reverse Transcription Kit (AG11705).

[0102] The expression of gene RcERF110 was detected by qRT-PCR method. The qRT-PCR reaction was carried out using the Aike Rui Fluorescent Quantitative PCR Kit (AG11718), and the instrument model used was ABI QuantStudio 3 (Applied Biosystems, CA, USA). Each sample was subjected to three technical replicates, and the 2 -△△CT method was used to calculate the relative expression level, and the SPSS software was used to statistically analyze the original data.

[0103] The specific primer sequences for the qRT-PCR reaction were:

[0104] qRcERF110-F: 5’-CTTATGGAGGTGGCTATGCTGATTT-3’;

[0105] qRcERF110-R: 5'-GGCAGTGGTGACAGATTTCGT-3'.

[0106] The RcGAPDH gene was selected as the internal reference gene, and the primer sequences were as follows:

[0107] qGAPDH-F: 5'-CTTATGGAGGTGGCTATGCTGATTT-3';

[0108] qGAPDH-R: 5'-GGCAGTGGTGACAGATTTCGT-3'.

[0109] Real-time fluorescence quantitative PCR detection found that the expression level of the gene RcERF110 in rose leaves showed a peak after 3 h of high-temperature (42 °C) stress treatment, and then gradually decreased ( Figure 3 A) Another peak appeared at 9 h and then decreased; in addition, the expression level of this gene was overall induced and up-regulated after drought stress treatment, and a peak of gene expression appeared at 6 h ( Figure 3 B).

[0110] In summary, it is shown that the gene RcERF110 is induced to express by water loss stress and high-temperature stress, and may be involved in the process of plant response to water loss stress and high-temperature stress.

[0111] Example 2 Construction and transformation of the overexpression vector of the gene RcERF110

[0112] The cloned gene fragment was overexpressed in tobacco, and the biological function of RcERF110 was verified by observing the phenotypes of transgenic tobacco and measuring physiological indexes. The specific steps are as follows:

[0113] 1) Construction of the overexpression vector:

[0114] First, the positive clone obtained in Example 1 The plasmid of 18-RcERF110 and the overexpression vector pCAMBIA2300s ( Figure 1 ) were digested with BamHⅠ and XbaI. After digestion, a ligation reaction was performed using the digested fragment containing the RcERF110 gene and the digested pCAMBIA2300s vector, and then transformed into Escherichia coli DH5α. Positive clones were screened by PCR amplification to obtain the transformation vector, which was named pCAMBIA2300s-RcERF110 ( Figure 9 A).

[0115] 2) Genetic transformation of tobacco

[0116] In this example, the Agrobacterium-mediated method was used to genetically transform tobacco (Nicotiana tabacum L.). After transforming the recombinant plasmid pCAMBIA2300s-RcERF110 into Agrobacterium tumefaciens strain GV3101, tobacco leaf explants were selected for genetic transformation. After Agrobacterium infection (OD600 = 0.8 - 1.0) and co-cultivation (25 ± 1 °C, dark culture for 48 h), the explants were transferred to an MS selection medium containing 100 mg / L kanamycin and 400 mg / L cefotaxime for resistant bud induction. Through multiple rounds of selective culture (subcultured once every 21 days), transformed adventitious buds with kanamycin resistance were obtained. After obtaining complete plants through in vitro rooting culture, progressive acclimation treatment was carried out on the tissue culture seedlings:

[0117] First, the seedlings were hardened off in an artificial climate chamber for 7 days, and then transplanted into sterilized substrate for cultivation. The RT-qPCR technique was used to analyze the expression level of the RcERF110 gene in T0 generation plants, and positive transgenic lines with significantly increased transcriptional levels (p < 0.01) were screened. Finally, an RcERF110 overexpression transgenic tobacco line (RcERF110-OE) was successfully constructed.

[0118] Example 3 Construction of the gene RcERF110 silencing vector, transformation

[0119] The VIGS technique was used to silence the gene RcERF110 in rose petals, and phenotypic observation and physiological index determination were used to determine the potential role of this gene in dehydration stress and high-temperature stress of rose petals. The specific steps are as follows:

[0120] 1) Construction of the silencing vector:

[0121] First, using the full-length CDS fragment of the gene RcERF110 obtained in Example 1 as a template, the required gene silencing fragment was obtained by PCR amplification using the gene silencing fragment RcERF110i primer pair.

[0122] RcERF110i forward primer: 5’-GCTCTAGACAGCCACTACAACACCAAC-3’,

[0123] RcERF110i reverse primer: 5’-GGGGTACCGCCCGATGAACCGCCC-3’;

[0124] Among them, the PCR amplification system and conditions were the same as those for the amplification of the full-length CDS fragment of the gene RcERF110 in Example 1 above.

[0125] The silencing fragment RcERF110i of the gene RcERF110 was introduced into the cloning vector In 18T, the cloning vector containing RcERF110i 18T and pTRV2 ( Figure 2 ) were simultaneously double digested with XbaⅠ and KpnⅠ. After digestion, the gene silencing fragment RcERF110i obtained and the digested pTRV2 vector were subjected to a ligation reaction and transformed into Escherichia coli DH5α. Positive clones were detected by PCR to obtain the transformation vector, which was named pTRV2-RcERF110i ( Figure 9 B).

[0126] 2) Transient transformation of rose petals:

[0127] By the method of Agrobacterium-mediated transient genetic transformation of rose petals, pTRV2-RcERF110 i was introduced into rose petals. After infection and co-culture, rose petals with silenced RcERF110 gene were obtained.

[0128] The main steps of the above transient transformation of rose petals are described as follows:

[0129] The virus-induced gene silencing (VIGS) technique was used to analyze the gene function of rose petals. The specific operation was as follows: The Agrobacterium strains carrying the recombinant vectors pTRV1, pTRV2, and pTRV2-RcERF110s were respectively cultured in LB liquid medium (containing 50 mg / L rifampicin and 100 mg / L kanamycin) at 28 °C with shaking until OD 600 ≥1.8. The cells were collected by centrifugation at 5000×g for 10 min, resuspended in the induction medium of MES buffer (pH 5.6) containing 10 mM MgCl2, 200 mM acetosyringone, and 10 mM MES, and the OD of each bacterial solution 600 was adjusted to 0.9±0.05. Subsequently, pTRV1 was mixed with the pTRV2 and pTRV2-RcERF110s bacterial solutions at a volume ratio of 1:1 and left to stand in the dark at room temperature (25±1 °C) for 4 h to activate the bacterial type III secretion system.

[0130] Select the middle petals of rose flowers at the initial full-bloom stage, and use a sterile punch to prepare petal discs with a diameter of 1 cm. Through vacuum infiltration treatment (vacuum degree 0.08 MPa, lasting for 10 min), the petal discs are fully infiltrated with the bacterial solution. After removing the residual liquid on the surface with sterile filter paper, place the samples in a petri dish containing sterile distilled water. First, perform low-temperature induction: culture in the dark at 8 °C for 48 h to promote the transfer of Agrobacterium T-DNA; then transfer to a 24 °C artificial climate chamber for gene silencing induction, and set the photoperiod to 16 h / 8 h (day / night) and continue to culture for 24 h. Throughout the experiment, a blank vector control group (pTRV1 + pTRV2) and an experimental group (pTRV1 + pTRV2-RcERF110s) are set for parallel treatment.

[0131] Example 4 Detection of Drought Tolerance and Heat Tolerance of Transgenic Tobacco RcERF110

[0132] 1) Detection of drought tolerance of transgenic tobacco

[0133] Using wild-type (WT) tobacco plants at 7 weeks old and RcERF110 overexpressing (OE) tobacco plants (RcERF110-OE) obtained in Example 2 as experimental materials, conduct a soil drought stress experiment. Before the experiment, the plants are saturatedly irrigated, and then water supply is stopped for 25 days of drought treatment (growth chamber conditions: day / night temperature 25 °C / 20 °C, photoperiod 16 h / 8 h, relative humidity 45% ± 5%). After 7 days of drought treatment, observe the phenotypes and measure the physiological indexes before and after the treatment, and then take pictures to record the plant status after rehydration for 30 h. The determination of cell membrane permeability uses the conductivity method, and the determination of malondialdehyde (MDA) content uses the thiobarbituric acid TBA colorimetric method. The determination methods of conductivity and MDA content refer to "Principles and Techniques of Plant Physiological and Biochemical Experiments" by Li Hesheng (2000). The content of H 2 O 2 is measured using a test kit from Nanjing Jiancheng H 2 O 2 (product number A064-1-1), and the tobacco is subjected to soil drought treatment.

[0134] The results show that: compared with RcERF110 transgenic tobacco (RcERF110-OE), the leaves of the control group tobacco showed severe wilting after drought treatment, and more serious yellowing damage appeared after rehydration ( Figure 5 A); after the treatment, the contents of H 2 O 2 and MDA in the leaves of the control group increased ( Figure 5 C, D), and the relative conductivity increased significantly ( Figure 5 E), indicating that overexpression of the RcERF110 gene reduces the damage degree of transgenic tobacco (RcERF110-OE) and enhances its drought tolerance.

[0135] 2) Detection of heat tolerance in transgenic tobacco

[0136] In this example, wild-type (WT) and RcERF110-overexpressing tobacco plants (RcERF110-OE) at the 7-week seedling stage were used as experimental materials, and high-temperature stress tolerance analysis was carried out in an artificial climate chamber. The plants were placed in a high-temperature treatment group (continuous stress at 45°C ± 0.5°C, relative humidity 60% ± 5%, photoperiod 16h / 8h) for 84h. The fourth fully expanded leaf was collected before treatment (0h) and after treatment (84h) respectively, the phenotype was observed, and the electrical conductivity, H 2 O 2 and MDA content were measured before and after treatment, and then the plant state was photographed and recorded after 1 day of recovery at room temperature (25°C).

[0137] As Figure 6 shown: After 84h of high-temperature stress, the WT plants showed significant phenotypic damage: large-area yellowing occurred after 30h of recovery at room temperature ( Figure 6 A). Physiological index analysis showed that the H 2 O 2 content, MDA content and relative electrical conductivity of the WT plant leaves increased significantly after treatment ( Figure 6 C-E). This result indicates that the overexpression of the gene RcERF110 significantly inhibits the burst of reactive oxygen species and membrane lipid peroxidation damage induced by high temperature, proving that this gene improves the tolerance of tobacco to continuous high-temperature stress by enhancing cellular redox homeostasis and membrane system stability. All experiments were set up with three independent biological replicates, and the data were statistically verified by one-way analysis of variance (ANOVA).

[0138] Example 5 Detection of dehydration tolerance and heat tolerance of transiently silenced RcERF110 in rose petals

[0139] 1) Detection of dehydration tolerance of rose gene-silenced discs

[0140] The rose petal discs with the gene RcERF110 silenced obtained in Example 3 above were placed on filter paper, dehydrated for 8h, and then immersed in distilled water for rehydration. Photos were taken, the relative effective area of the petal discs was counted, and the H 2 O 2 and MDA content of the petals at 0h and 8h of dehydration treatment were measured at 0h of dehydration treatment, 8h of dehydration treatment, 3h of rehydration, and 6h of rehydration respectively.

[0141] By silencing the rose gene RcERF110 through VIGS technology, it was found that the gene-silenced petals showed a more severe wilting phenotype than the control after 8 hours of dehydration treatment, and the recovery ability was significantly weakened after 3 hours of rehydration ( Figure 7A). Compared with the control, the accumulation of H 2 O 2 and MDA in the petals of the silenced group increased significantly ( Figure 7 C, D), and at the same time, the relative effective area of the petal discs decreased compared with the control group ( Figure 7 E). These results indicate that the silencing of the gene RcERF110 weakens the dehydration tolerance of petals, suggesting that this gene may be positively involved in the dehydration stress adaptation response of roses by regulating the antioxidant defense system and membrane integrity.

[0142] 2) Detection of heat tolerance of gene-silenced discs in roses

[0143] Similarly, the petal discs of roses with silenced gene RcERF110 obtained in Example 3 above were subjected to high-temperature stress treatment. After treatment at 42 °C for 50 h, photos were taken, and DAB staining of rose discs and detection of hydrogen peroxide content were carried out (the DAB staining method refers to Luo et al., 2016, and the detection of H 2 O 2 content was detected using the test kit (A007-1-1) from Nanjing Jiancheng.

[0144] The experimental results showed that the petals of the experimental group showed a significant yellowing phenotype ( Figure 8 A), while the degree of phenotypic damage in the control group was relatively mild. DAB staining showed that the accumulation of H 2 O 2 in the silenced group was deeper than that in the control ( Figure 8 B), and its H 2 O 2 content, MDA content and relative conductivity were all significantly higher than those in the control group ( Figure 8 D-F). The silencing of the gene RcERF110 exacerbated the oxidative damage and membrane system disruption under high-temperature stress and weakened the heat tolerance of rose petals. In summary, it is shown that silencing the RcERF110 gene in roses can weaken the heat tolerance of rose petals.

[0145] Other parts not described in detail are all prior arts. Although the above embodiments have described the present invention in detail, they are only a part of the embodiments of the present invention, not all of them. People can also obtain other embodiments based on this embodiment without creative efforts, and these embodiments all belong to the protection scope of the present invention.

Claims

1. A key gene RcERF110 for regulating rose stress resistance and its application, the nucleotide sequence of which is shown in SEQ ID No.

1.

2. A protein RcERF110 encoded by the key gene RcERF110 according to claim 1, whose amino acid sequence is shown in SEQ ID No.

2.

3. A primer pair for obtaining the key gene RcERF110 according to claim 1, characterized in that: The primer pairs are: RcERF110 forward primer: 5'-GGGGTACCATGTGCCTTTGAAGGTGGCG-3', RcERF110 reverse primer: 5'-CGGGATCCTTAGCCGGAAGACGAATGATTG-3'.

4. A primer pair for constructing a silencing vector for obtaining the key gene RcERF110 according to claim 1, characterized in that: The primer pairs are: RcERF110i forward primer: 5'-GCTCTAGACAGCCACTACAACACCAAC-3', RcERF110i reverse primer: 5′-GGGGTACCGCCCGATGAACCGCCC-3′.

5. A recombinant expression vector, characterized in that: The recombinant expression vector contains the plant expression vector of the key gene RcERF110 according to claim 1, wherein the plant expression vector is pCAMBIA2300s.

6. A recombinant silencing vector, characterized in that: The recombinant silencing vector contains the plant silencing vector of the key gene RcERF110 according to claim 1, wherein the plant expression vector is pTRV2.

7. A recombinant host cell, characterized in that: The host cell is Agrobacterium GV3101, and the recombinant host cell contains the recombinant expression vector according to claim 5 or the recombinant silencing vector according to claim 6.

8. Use of any of the following for regulating drought tolerance or high temperature tolerance of plants, characterized in that: It includes: (1) The key gene RcERF110 described in claim 1; (2) The recombinant expression vector according to claim 5; (3) The host cell according to claim 7.

9. The use according to claim 8, characterized in that: The plants are tobacco or rose respectively.

10. Use of any of the following in breeding new plant varieties that are drought-resistant and heat-resistant, characterized in that: It includes: (1) The key gene RcERF110 described in claim 1; (2) The recombinant expression vector according to claim 5; (3) The host cell according to claim 7.

Images