Application of corn ZmECT3 gene in regulation and control of plant heat resistance

Abstract

The invention relates to application of a corn ZmECT3 gene in regulation and control of plant heat resistance, and belongs to the technical field of plant gene breeding, the nucleotide sequence of the ZmECT3 gene is as shown in SEQ ID NO.1, and the amino acid sequence of the gene encoding protein is as shown in SEQ ID NO.2. By analyzing a ZmECT3 gene deleted corn plant and a ZmECT3 gene overexpressed arabidopsis thaliana plant, it is found that the ZmECT3 gene can regulate and control the heat resistance of the plants, and important theoretical significance and application value are provided for creation of heat-resistant corn new germplasm and heat-resistant corn molecular breeding.

Description

Technical Field

[0001] The present invention belongs to the technical field of plant genetic breeding, and specifically relates to the application of the maize ZmECT3 gene in regulating plant heat tolerance. Background Art

[0002] Under the background of global climate change, the frequent occurrence of extreme high-temperature events is seriously threatening agricultural sustainable development and food security. High-temperature stress not only directly reduces crop yields by disrupting core physiological processes such as the photosynthetic system, but also affects ecosystem stability by altering the geographical distribution patterns of species. Although traditional research has revealed that plants respond to high-temperature stress through the calcium signal-MAPK cascade pathway and the heat shock protein expression mechanism mediated by HSF transcription factors, there are still significant knowledge gaps in the molecular mechanisms by which plants rapidly respond to high temperatures.

[0003] ZmECT3 belongs to the members of the plant YTHDF (YT521-B homology domain family) protein family. YTHDF is an important m6A (N6-methyladenosine) modification recognition protein in eukaryotes, and its core function depends on the highly conserved YTH domain. YTHDF proteins are mainly involved in aspects such as the formation of stress granules, translational regulation, phase separation, and cell fate transition in animal heat stress research. Recent studies have shown that YTHDF proteins play regulatory roles in plant stress responses. For example, the homologous gene AtECT2 of YTHDF2 in Arabidopsis thaliana localizes to stress granules after heat stress, and the formation of stress granules driven by liquid-liquid phase separation is one of the regulatory ways for plants to cope with high-temperature stress.

[0004] However, in the field of plants, especially in economic crops such as maize, the biological functions of YTHDF proteins and their associations with high-temperature responses are still unknown areas. In this regard, the present invention provides the application of the maize ZmECT3 gene in regulating plant heat tolerance. Summary of the Invention

[0005] The purpose of the present invention is to provide the application of the maize ZmECT3 gene in regulating plant heat tolerance in order to solve the above problems.

[0006] The present invention achieves the above purpose through the following technical solutions:

[0007] The present invention provides the maize ZmECT3 gene, and the nucleotide sequence of this gene is shown in SEQ ID NO.1.

[0008] The present invention also provides the application of the above maize ZmECT3 gene in regulating plant heat tolerance.

[0009] As a further optimized solution of the present invention, overexpression of the ZmECT3 gene in plants can enhance the heat tolerance of plants.

[0010] As a further optimized solution of the present invention, the plant is corn or Arabidopsis thaliana.

[0011] The present invention also provides a coding protein of the corn ZmECT3 gene, and the amino acid sequence of the coding protein is shown in SEQ ID NO.2.

[0012] The present invention also provides a method for obtaining a heat-tolerant Arabidopsis thaliana variety, comprising the following steps:

[0013] (1) Using the corn ZmECT3 gene as the target gene, constructing it onto a plant overexpression vector to obtain a ZmECT3 overexpression vector;

[0014] (2) Transferring the ZmECT3 overexpression vector into Agrobacterium tumefaciens GV3101 and transforming it into wild-type Arabidopsis thaliana by the floral dip method to obtain ZmECT3 overexpression materials;

[0015] (3) Screening and identifying positive overexpression lines from the ZmECT3 overexpression materials, and screening for homozygotes of the offspring of the positive overexpression lines to obtain ZmECT3 overexpression homozygous lines.

[0016] As a further optimized solution of the present invention, in step (1), the method for obtaining the corn ZmECT3 gene is: designing specific amplification primers based on the nucleotide sequence of the corn ZmECT3 gene, extracting RNA from corn materials and reverse-transcribing it into cDNA, and obtaining the corn ZmECT3 gene through PCR amplification technology.

[0017] The beneficial effects of the present invention are as follows:

[0018] By analyzing ZmECT3 gene-deleted corn plants and ZmECT3 gene-overexpressed Arabidopsis thaliana plants, the present invention finds that the ZmECT3 gene can regulate the heat tolerance of plants, and overexpression of the ZmECT3 gene can enhance the heat tolerance of plants, providing important theoretical significance and application value for creating new heat-tolerant corn germplasms and molecular breeding of heat-tolerant corn. Description of the Drawings

[0019] Figure 1 Construction of a phylogenetic tree of YTHDF-like genes in three species of human, Arabidopsis thaliana, and corn (the gene in corn with the closest evolutionary distance to AtECT4 is marked in the red box);

[0020] Figure 2 Prediction of the PrD domain of the three genes in corn with the closest evolutionary distance to AtECT4;

[0021] Figure 3Liquid-liquid phase separation function detection results of ZmECT1, ZmECT2, and ZmECT3 (Bar = 5 μm);

[0022] Figure 4 Heat-induced expression and tissue expression of ZmECT3 (A: Expression levels of ZmECT3 after heat treatment at 45 °C for different times, with each time point repeated three times; B: Expression levels of ZmECT3 in different maize tissues, with each tissue repeated three times);

[0023] Figure 5 Subcellular localization analysis of ZmECT3 protein (A: In tobacco plants cultured at normal temperature, ZmECT3 is localized in the cytoplasm. In tobacco plants subjected to heat stress, ZmECT3 forms granular structures and co-localizes with UBP1C, Bar = 10 μm; B: Statistical analysis of the number of granules formed by ZmECT3 in tobacco plants cultured under normal temperature and heat stress conditions. **** indicates that the T-test result < 0.0001, showing significant differences);

[0024] Figure 6 The zmect3 mutant is sensitive to high temperature (A - B: Positions of the mutation sites of two EMS-induced mutants of zmect3 on the genome; C: Heat treatment phenotypes of the zmect3 mutant, Bar = 5 cm; D: Statistical results of the heat treatment survival rate of the zmect3 mutant. **** indicates that the T-test result < 0.0001, showing significant differences);

[0025] Figure 7 The pollen of zmect3 has a heat-sensitive phenotype (A: TTC reagent staining results of the pollen of B73 and zmect3. The redder the pollen, the stronger the cell respiration and the higher the vitality. The yellower the pollen, the weaker the respiration and the lower the vitality, Bar = 100 μm; B: Statistical analysis of the pollen vitality of B73 and zmect3. **** indicates that the T-test result < 0.0001, showing significant differences);

[0026] Figure 8Overexpression of ZmECT3 Enhances Heat Tolerance in Arabidopsis thaliana (A: Protein level detection of the T3 generation homozygous lines overexpressing ZmECT3; B: Observation of the growth and development phenotypes of the ZmECT3 overexpressing lines. Bar = 2 cm; C: Statistical chart of the number of flowering leaves of the ZmECT3 overexpressing lines, and the statistical results of the total number of leaves under normal conditions, where black represents the number of rosette leaves and gray represents the number of cauline leaves. The number of experimental statistical samples exceeds 20, and the results are shown as mean ± standard deviation. ns represents that the T-test result > 0.05, and the statistics are not significant; D: Survival phenotype diagram of the ZmECT3 overexpressing lines under high temperature stress treatment. The experiment was repeated at least three times. Bar = 1 cm.; E: Statistical chart of the survival of the ZmECT3 overexpressing lines under high temperature stress treatment. The number of experimental statistical samples exceeds 50. ** represents that the T-test result < 0.01, with significant differences. **** represents that the T-test result < 0.0001, with significant differences). Detailed implementation manners

[0027] The present application will be further described in detail below. It is necessary to point out here that the following specific implementation manners are only used to further illustrate the present application and cannot be understood as limiting the protection scope of the present application. Those skilled in the art can make some non-essential improvements and adjustments to the present application according to the above application content.

[0028] 1. Experimental materials

[0029] The methods used in the present invention are all conventional methods known to those skilled in the art unless otherwise specified. The reagents and other materials used are all commercially available products unless otherwise specified.

[0030] 1.2. Plant materials

[0031] ① All the wild-type Arabidopsis thaliana materials used in this experiment are of the Columbia-0 (Col-0) ecotype of Arabidopsis thaliana (L.) Heynh.;

[0032] ② All the wild-type maize materials used in this experiment are the inbred line B73 of maize (zea mays.L);

[0033] ③ The tobacco materials used in this experiment are Nicotiana benthamiana;

[0034] ④ The seeds of the EMS mutagenesis materials EMS4-1db323 and EMS4-17962f were all purchased from the EMS mutant library of Qilu Normal University (http: / / elabcaas.cn / memd / index.php).

[0035] ⑤hsfb2b(salk_045982c) is a material preserved in the laboratory.

[0036] 2. Analysis of YTHDF family members in maize

[0037] To explore whether the genes containing the YTH domain in maize are involved in the process of maize resisting high-temperature stress, the software MEGA7 was used to construct a phylogenetic tree for 3 YTHDF-like genes in humans, 11 genes of the ECT family in Arabidopsis thaliana, and 19 genes found in maize.

[0038] Through homologous comparison, three members with relatively close genetic relationships to AtECT2 were found among the 19 genes containing the YTH domain in maize, namely Zm00001d04842, Zm00001d027731, and Zm00001d034005, which were named ZmECT1, ZmECT2, and ZmECT3 in sequence ( Figure 1 ). Through PrD domain prediction, it was found that all three genes contain the YTH domain and the PrD domain ( Figure 2 );

[0039] By constructing prokaryotic protein expression vectors for ZmECT1, ZmECT2, and ZmECT3 respectively, and performing protein expression and purification, it was found that after concentrating the purified protein to a concentration of 100 μM, under the condition of a salt concentration of 150 mM, only ZmECT3 could undergo liquid-liquid phase separation ( Figure 3 ). Based on the above findings, further research was carried out on ZmECT3. The nucleotide sequence and amino acid sequence of ZmECT3 are shown in SEQ ID NO.1 and SEQ ID NO.2 respectively.

[0040] 3. Tissue expression and high-temperature induced expression of ZmECT3

[0041] To study whether ZmECT3 is involved in high-temperature stress, first, the expression levels of the ZmECT3 gene at different times after heat treatment were detected. Uniform-sized B73 seeds were selected for germination, and heat treatment at 45 °C was carried out at the three-leaf stage. Leaf samples were taken at 0 h, 15 min, 30 min, 45 min, 1 h, and 3 h, and then total RNA was extracted and reverse transcribed. Using ACT1 as an internal reference gene, RT-qPCR was performed to analyze the expression level of ZmECT3;

[0042] Among them, the fluorescence quantitative primers used are as follows:

[0043] SEQ ID NO.3: ACT1-F: TCACCCTGTGCTGCTGACCG;

[0044] SEQ ID NO.4: ACT1-R: GAACCGTGTGGCTCACACCA;

[0045] SEQ ID NO.5: ZmECT3-F: CCGTGACACACAAGAGGTTA;

[0046] SEQ ID NO.6: ZmECT3-R: AGTTGCTGATTCGCCCTC;

[0047] The results showed that the expression level of ZmECT3 before and after heat treatment had almost no significant change, indicating that its expression was not induced by heat stress. Figure 4 A). Thus, it was preliminarily inferred that ZmECT3 was involved in high-temperature stress not at the gene transcription level but at the protein level.

[0048] To study the function of ZmECT3 in heat stress more deeply, the tissue expression levels of ZmECT3 were detected. Roots, stems, and leaves of maize plants at the V3 stage, female inflorescences (including silk and husk), male inflorescences, and embryos 30 days after pollination at the R1 stage were collected. Then, total RNA extraction and reverse transcription were carried out in the same way, and finally, RT-qPCR was performed.

[0049] The results showed that ZmECT3 was expressed in all tissues. Figure 4 B).

[0050] 4. Subcellular localization analysis of ZmECT3 protein

[0051] ZmECT3 was tandemly linked with a GFP tag, and UBP1C (nucleotide sequence as shown in SEQ ID NO.15), the core component of stress granules in Arabidopsis thaliana, was tandemly linked with an RFP tag. Then, they were respectively constructed into the vectors for protein expression in tobacco leaves. Among them, UBP1C was constructed on the pCAMBIA3301 vector, and ZmECT3 was constructed on the pCAMBIA2300 vector. The primers used were as follows:

[0052] SEQ ID NO.7:

[0053] UBP1C-F: AAGACGCGTGGATCCTCTAGAATGCAGAATCCGAGACTGAAGCAA;

[0054] SEQ ID NO.8:

[0055] UBP1C-R: CTGGTCACCGAGCTC AAGCTT TTACTGATAGTACATGAGTTGCTG;

[0056] SEQ ID NO.9:

[0057] ZmECT3-F: AAGGGATCCTCTAGAGTCGACATGTCGACAGTTGCTCCTGCCCCT;

[0058] SEQ ID NO.10:

[0059] ZmECT3-R: TAAAGCAGGGCATGC CTGCAG TTAGTTGTCATTTGATATTCCACT;

[0060] The underlines indicate the restriction enzyme sites.

[0061] The two constructed vectors were separately transformed into Agrobacterium tumefaciens GV3101 for tobacco transient co-transformation experiments. Under normal culture conditions, ZmECT3 was observed to localize in the cytoplasm under a laser confocal microscope. However, after subjecting the tobacco plants to a high temperature treatment of 45 °C for 30 min, a change in the localization of ZmECT3 was observed. It formed granular structures in the cytoplasm and co-localized with the stress granule component UBP1C ( Figure 5 A, B).

[0062] 5. Obtaining of ZmECT3 gene deletion maize lines and observation of their thermosensitive phenotypes

[0063] To study the function of ZmECT3 under heat stress, two EMS mutagenesis mutant seed materials with different mutation sites, EMS4-1db323 and EMS4-17962f, were used. Among them, EMS4_1db323 had a single-base substitution of CAG→TAG in the exon region of the ZmECT3 gene, resulting in the mutation of glutamine (Q) at the 19th position to a stop codon (Ter); EMS4_17962f3 had a single-base substitution of CGA→TGA, causing premature termination of arginine (R) at the 186th position ( Figure 6 A, B). After continuous backcrossing for multiple generations, maize mutant plants were obtained. Genotyping of the obtained maize mutant plants was performed, that is, genomic DNA was extracted from maize leaves, PCR amplification was carried out using the extracted genomic DNA as a template, the PCR products were sent to a biological company for sequencing, and the sequencing results returned by the biological company were compared and analyzed to confirm the obtaining of homozygous mutants.

[0064] Among them, the primers used for PCR amplification were as follows:

[0065] SEQ ID NO.11:

[0066] EMS4-1db323-identification-F: TGGTGTTGGTAGCTGCGG;

[0067] SEQ ID NO.12:

[0068] EMS4-1db323 - Identification - R: GCAGCGCTCTGTGCATCT;

[0069] SEQ ID NO.13:

[0070] EMS4-17962f - Identification - F: GCAGACCGTGTATGGAGACA;

[0071] SEQ ID NO.14:

[0072] EMS4-17962f - Identification - R: GGAGAACGAACACCATTGTG;

[0073] The seedlings of the homozygous mutants were subjected to heat treatment at 45 °C for 48 h. After multiple repeated experiments, the heat-sensitive phenotype of the mutants was determined. The results showed that compared with the wild type B73, the two EMS mutagenesis mutants of ZmECT3 were significantly more wilted and had a higher leaf damage area after high-temperature treatment ( Figure 6 C). The statistical results showed that the leaf damage area of the mutants was about 70% - 77%, which was significantly higher than that of the wild type (20%) ( Figure 6 D). From this, it was concluded that ZmECT3 is involved in plant resistance to heat stress.

[0074] Further study whether ZmECT3 not only participates in heat stress regulation during the seedling stage but also regulates pollen heat tolerance during the reproductive stage. Pollen at the anthesis stage of B73 and the EMS mutagenesis mutants of ZmECT3 grown in the greenhouse was collected for heat treatment, and then stained with TTC reagent to detect cell respiration.

[0075] The results showed that the pollen viability of the mutants was the same as that of B73 without treatment. However, after a water bath treatment at 45 °C for 1 h, the pollen viability of the mutants was significantly weaker than that of B73 ( Figure 7 A), and after statistics, it was found that the pollen viability was very low, almost all died, and no longer underwent respiration ( Figure 7 B).

[0076] 6. Overexpression of ZmECT3 enhances heat tolerance in Arabidopsis

[0077] According to the results of 2.3.2 and 2.3.3, the deletion of the ZmECT3 gene would cause maize to be more heat-sensitive. Further explore whether ZmECT3 plays a promoting role in heat tolerance.

[0078] The 35S promoter, ZmECT3 gene, GFP tag, and Flag tag were successively ligated to the multiple cloning site of the pCAMBIA2300 vector to construct the p35S::ZmECT3-GFP-Flag overexpression vector. This plasmid was then transferred into Agrobacterium and transformed into wild-type Arabidopsis thaliana by the floral dip method.

[0079] According to a ratio of 1 / 1000, the prepared kanamycin stock solution was added to the slightly cooled solid medium to obtain the resistant medium. The harvested seeds were placed in the resistant medium for screening. Arabidopsis thaliana seedlings with true leaves and relatively long roots were selected as positive seedlings. Leaf samples were taken from the positive seedlings, and the protein content in the positive seedlings was detected by Western Blot experiment. Two ZmECT3 overexpression lines were identified, and then the T3 generation of ZmECT3 overexpression homozygous lines 35S:ZmECT3 16# and 35S:ZmECT3 72# were obtained.

[0080] The protein expression level of the T3 generation of ZmECT3 overexpression homozygous lines was identified again by Western blot experiment ( Figure 8 A). Observation of Arabidopsis thaliana plants overexpressing ZmECT3 and wild-type plants found that the overexpression of ZmECT3 did not affect the normal growth and development of Arabidopsis thaliana. Compared with the wild type, there were no differences in leaf development, flowering period, etc. ( Figure 8 B, C).

[0081] HSFB2b has been reported to play a negative regulatory role in the high-temperature stress response, and its mutant shows a heat-tolerant phenotype under high-temperature stress. Therefore, hsfb2b(salk_045982c) was used as a positive control. The transgenic plants, wild-type plants, and hsfb2b(salk_045982c) were treated in a water bath at 45°C for 15 min. It was found that after heat treatment, compared with the wild type, the transgenic plants were insensitive to high temperature ( Figure 8 D). After statistics, it was found that the survival rate of plants overexpressing ZmECT3 after heat treatment was about 55%, which was higher than the survival rate of the wild type of about 30% ( Figure 8 E). Based on the above experimental results, it was concluded that overexpression of ZmECT3 could enhance the heat tolerance of Arabidopsis thaliana.

[0082] The above-described embodiments only represent several implementation manners of the present invention. Their descriptions are relatively specific and detailed, but they should not be construed as limiting the scope of the present invention patent. It should be noted that for those of ordinary skill in the art, without departing from the concept of the present invention, several deformations and improvements can still be made, and these all belong to the protection scope of the present invention.

Claims

1. Maize ZmECT3 gene, characterized in that The nucleotide sequence of the gene is shown in SEQ ID NO.

1.

2. Use of the maize ZmECT3 gene as claimed in claim 1 in regulating plant heat tolerance.

3. The use according to claim 2, characterized in that: Overexpression of the ZmECT3 gene in plants can enhance the heat resistance of the plants.

4. The use according to claim 2, characterized in that: The plant is corn or Arabidopsis thaliana.

5. The protein encoded by the maize ZmECT3 gene according to claim 1, characterized in that: The amino acid sequence of the encoded protein is shown in SEQ ID NO.

2.

6. A method for obtaining a heat-resistant Arabidopsis thaliana variety, characterized in that: The following steps are involved: (1) The maize ZmECT3 gene was used as the target gene and constructed into a plant overexpression vector to obtain a ZmECT3 overexpression vector; (2) The ZmECT3 overexpression vector was transferred into Agrobacterium GV3101 and transformed into Arabidopsis wild type by inflorescence infection method to obtain ZmECT3 overexpression material; (3) Identify and select positive ZmECT3 overexpression strains from the ZmECT3 overexpression materials, and select homozygous progeny of the positive overexpression strains to obtain ZmECT3 overexpression homozygous strains.

7. The method for obtaining a heat-resistant Arabidopsis thaliana variety according to claim 6, characterized in that: In the step (1), the method for obtaining the corn ZmECT3 gene is as follows: using the nucleotide sequence of the corn ZmECT3 gene as a template to design specific amplification primers, extracting RNA from corn materials and reverse transcribing it into cDNA, and obtaining the corn ZmECT3 gene by PCR amplification technology.

Images