Application of maize ZmECT3 gene in regulating heat tolerance of plants

Abstract

The application relates to application of a maize ZmECT3 gene in regulating heat tolerance of plants, belongs to the technical field of plant gene breeding, and discloses that the nucleotide sequence of the ZmECT3 gene is shown as SEQ ID NO. 1, and the amino acid sequence of a protein coded by the gene is shown as SEQ ID NO. 2. Through analysis of maize plants with a ZmECT3 gene deletion and Arabidopsis plants with overexpression of the ZmECT3 gene, it is found that the ZmECT3 gene can regulate heat tolerance of plants, and the application provides important theoretical significance and application value for creating new heat-tolerant maize germplasm and heat-tolerant maize molecular breeding.

Description

Technical Field

[0001] This invention belongs to the field of plant gene breeding technology, specifically involving the application of the maize ZmECT3 gene in regulating plant heat tolerance. Background Technology

[0002] The frequent occurrence of extreme heat events against the backdrop of global climate change is seriously threatening sustainable agricultural development and food security. Heat stress not only directly reduces crop yields by disrupting core physiological processes such as the photosynthetic system, but also affects ecosystem stability by altering species geographic distribution patterns. Although traditional research has revealed that plants respond to heat stress through the calcium signaling-MAPK cascade pathway and HSF transcription factor-mediated heat shock protein expression mechanisms, significant gaps remain in our understanding of the molecular mechanisms by which plants rapidly respond to heat.

[0003] ZmECT3 belongs to the plant YTHDF (YT521-Bhomology domain family) protein family. YTHDF is an important m6A (N6-methyladenosine) modification recognition protein in eukaryotes, and its core function depends on the highly conserved YTH domain. YTHDF proteins are mainly involved in stress granule formation, translational regulation, phase separation, and cell fate transition in animal heat stress studies. Recent studies have shown that YTHDF proteins play a regulatory role in plant stress responses. For example, the YTHDF2 homolog AtECT2 in Arabidopsis thaliana is localized to stress granules after heat stress, and the formation of stress granules driven by liquid-liquid phase separation is one of the regulatory mechanisms by which plants respond to high-temperature stress.

[0004] However, the biological function of YTHDF protein and its association with high-temperature response in plants, especially in economic crops such as maize, remains unknown. In this regard, the present invention provides the application of the maize ZmECT3 gene in regulating plant heat tolerance. Summary of the Invention

[0005] The purpose of this invention is to provide an application of the maize ZmECT3 gene in regulating plant heat tolerance in order to solve the above-mentioned problems.

[0006] The present invention achieves the above objectives through the following technical solutions:

[0007] This invention provides the maize ZmECT3 gene, the nucleotide sequence of which is shown in SEQ ID NO.1.

[0008] This invention also provides the application of the above-mentioned maize ZmECT3 gene in regulating plant heat tolerance.

[0009] As a further optimization of the present invention, overexpression of the ZmECT3 gene in plants can enhance the heat resistance of plants.

[0010] As a further optimization of the present invention, the plant is maize or Arabidopsis thaliana.

[0011] The present invention also provides the protein encoded by the maize ZmECT3 gene, the amino acid sequence of which is shown in SEQ ID NO.2.

[0012] This invention also provides a method for obtaining a heat-resistant Arabidopsis thaliana variety, comprising the following steps:

[0013] (1) The maize ZmECT3 gene was used as the target gene and constructed into a plant overexpression vector to obtain the ZmECT3 overexpression vector.

[0014] (2) The ZmECT3 overexpression vector was transformed into Agrobacterium GV3101 and then transformed into Arabidopsis wild-type by inflorescence infection method to obtain ZmECT3 overexpression material.

[0015] (3) Positive overexpression lines were screened and identified from ZmECT3 overexpression materials. Homozygous screening was performed on the progeny of positive overexpression lines to obtain homozygous ZmECT3 overexpression lines.

[0016] As a further optimization of the present invention, in step (1), the method for obtaining the maize ZmECT3 gene is as follows: using the nucleotide sequence of the maize ZmECT3 gene as a template, specific amplification primers are designed, RNA is extracted from maize material and reverse transcribed into cDNA, and the maize ZmECT3 gene is obtained by PCR amplification technology.

[0017] The beneficial effects of this invention are as follows:

[0018] This invention analyzes maize plants lacking the ZmECT3 gene and Arabidopsis plants overexpressing the ZmECT3 gene, and finds that the ZmECT3 gene can regulate the heat tolerance of plants, and that overexpression of the ZmECT3 gene can enhance the heat tolerance of plants. This provides important theoretical significance and application value for creating new heat-resistant maize germplasm and for molecular breeding of heat-resistant maize. Attached Figure Description

[0019] Figure 1 The phylogenetic tree of YTHDF genes in three species: human, Arabidopsis thaliana, and maize (the red box marks the gene in maize that is closest in evolutionary distance to AtECT4);

[0020] Figure 2 Predictions of the PrD domains of the three genes in maize that are most evolutionarily close to AtECT4;

[0021] Figure 3The results of liquid-liquid phase separation function tests for ZmECT1, ZmECT2, and ZmECT3 (Bar = 5μm);

[0022] Figure 4 The thermally induced expression and tissue expression of ZmECT3 were shown in the following figures: (A: Expression level of ZmECT3 after heat treatment at 45℃ for different times, with each time point repeated three times; B: Expression level of ZmECT3 in different maize tissues, with each tissue repeated three times).

[0023] Figure 5 Subcellular localization analysis of ZmECT3 protein (A: ZmECT3 in tobacco cultured at normal temperature is localized in the cytoplasm; in tobacco under heat stress, ZmECT3 forms a granular structure and co-localizes with UBP1C, Bar = 10 μm; B: The number of ZmECT3 particles formed in tobacco cultured under normal temperature and heat stress conditions was counted; **** indicates T-test result < 0.0001, indicating a significant difference).

[0024] Figure 6 The zmect3 mutant is sensitive to high temperature (AB: the mutation sites of the two EMS-induced mutants of zmect3 on the genome; C: the heat treatment phenotype of the zmect3 mutant, Bar=5cm; D: the statistical results of the heat treatment survival rate of the zmect3 mutant, **** indicates that the T-test result is <0.0001, which is a significant difference).

[0025] Figure 7 The pollen of zmect3 exhibits a heat-sensitive phenotype (A: TTC staining results of pollen from B73 and zmect3; the redder the pollen, the stronger the cellular respiration and the higher the viability; the yellower the pollen, the weaker the respiration and the lower the viability; Bar = 100 μm; B: Pollen viability statistics of B73 and zmect3; **** indicates T-test result < 0.0001, indicating a significant difference).

[0026] Figure 8To enhance the heat tolerance of Arabidopsis thaliana by overexpressing ZmECT3 (A: Protein level detection of ZmECT3-overexpressing T3 generation homozygous lines; B: Phenotypic observation of growth and development of ZmECT3-overexpressing lines. Bar = 2cm; C: Statistical graph of flowering leaves in ZmECT3-overexpressing lines, total number of leaves under normal conditions, where black represents rosette leaves and gray represents stem leaves. The experimental sample size exceeded 20 plants, and the results are shown as mean ± standard deviation. ns indicates T-test result > 0.05, statistically insignificant; D: Survival phenotype of ZmECT3-overexpressing lines under high temperature stress treatment. The experiment was repeated at least three times. Bar = 1cm; E: Survival statistics of ZmECT3-overexpressing lines under high temperature stress treatment. The experimental sample size exceeded 50 plants. ** indicates T-test result < 0.01, significant difference. **** indicates T-test result < 0.0001, significant difference). Detailed Implementation

[0027] The present application will now be described in further detail. It should be noted that the following specific embodiments are only used to further illustrate the present application and should not be construed as limiting the scope of protection of the present application. Those skilled in the art can make some non-essential improvements and adjustments to the present application based on the above application content.

[0028] 1. Experimental Materials

[0029] Unless otherwise specified, all methods used in this invention are conventional methods known to those skilled in the art, and all reagents and materials used are commercially available products.

[0030] 1.2 Plant materials

[0031] ①The wild-type Arabidopsis materials used in this experiment were all of the Arabidopsis thaliana (L.) Heynh.) Columbia-0 (Col-0) ecotype;

[0032] ②The wild-type maize material used in this experiment was all maize (zea mays.L) inbred line B73;

[0033] ③The tobacco material used in this experiment was Nicotiana benthamiana;

[0034] ④ The seeds of the EMS mutagenesis materials, EMS4-1db323 and EMS4-17962f, were purchased from the EMS mutant library of Qilu Normal University (http: / / elabcaas.cn / memd / index.php).

[0035] ⑤hsfb2b(salk_045982c) is a material preserved in the laboratory.

[0036] 2. Analysis of YTHDF family members in maize

[0037] To investigate whether genes containing the YTH domain in maize are involved in the process of maize resisting high temperature stress, phylogenetic trees were constructed using MEGA7 software for three YTHDF genes in humans, 11 ECT family genes in Arabidopsis thaliana, and 19 genes found in maize.

[0038] Through homology comparison, three closely related members to AtECT2 were found among 19 maize genes containing the YTH domain: Zm00001d04842, Zm00001d027731, and Zm00001d034005. These were named ZmECT1, ZmECT2, and ZmECT3, respectively. Figure 1 PrD domain prediction revealed that all three genes contain both the YTH domain and the PrD domain. Figure 2 );

[0039] By constructing prokaryotic protein expression vectors for ZmECT1, ZmECT2, and ZmECT3 respectively, and performing protein expression and purification, it was found that after concentrating the purified protein to a concentration of 100 μM, only ZmECT3 could undergo liquid-liquid phase separation under a salt concentration of 150 mM. Figure 3 Based on the above findings, further research was conducted on ZmECT3. The nucleotide and amino acid sequences of ZmECT3 are shown in SEQ ID NO.1 and SEQ ID NO.2, respectively.

[0040] 3. Tissue expression and high-temperature induced expression of ZmECT3

[0041] To investigate whether ZmECT3 is involved in high-temperature stress, the expression level of the ZmECT3 gene was first detected at different time points after heat treatment. Uniformly sized B73 seeds were selected for germination and subjected to heat treatment at 45℃ at the three-leaf stage. Leaf samples were taken at 0h, 15min, 30min, 45min, 1h, and 3h. Total RNA was then extracted and reverse transcribed. Using ACT1 as an internal reference gene, RT-qPCR was performed to analyze the expression level of ZmECT3.

[0042] The fluorescent quantitative primers used are as follows:

[0043] SEQ ID NO.3: ACT1-F:TCACCCTGTGCTGCTGACCG;

[0044] SEQ ID NO.4: ACT1-R:GAACCGTTGGCTCACACCA;

[0045] SEQ ID NO.5: ZmECT3-F: CCGTGACACACAAGAGGTTA;

[0046] SEQ ID NO.6: ZmECT3-R: AGTTGCTGATTCGCCCTC;

[0047] The results showed that the expression level of ZmECT3 remained almost unchanged before and after heat treatment, indicating that its expression was not induced by heat stress. Figure 4 A). Based on this, it can be preliminarily inferred that ZmECT3 does not participate in high-temperature stress at the gene transcription level, but rather at the protein level.

[0048] To further investigate the function of ZmECT3 under heat stress, the tissue expression level of ZmECT3 was detected. Roots, stems, and leaves of maize plants at stage V3, and female ears (including silks and husks), male ears, and embryos 30 days after pollination at stage R1 were collected. Total RNA was then extracted and reverse transcribed, and finally RT-qPCR was performed.

[0049] The results showed that ZmECT3 was expressed in all tissues. Figure 4 B).

[0050] 4. Subcellular localization analysis of ZmECT3 protein

[0051] A GFP tag was tandemly attached to ZmECT3, and an RFP tag was tandemly attached to UBP1C (nucleotide sequence shown in SEQ ID NO.15), the core component of stress granules in Arabidopsis thaliana. These were then constructed into vectors for protein expression in tobacco leaves, with UBP1C constructed in the pCAMBIA3301 vector and ZmECT3 constructed in the pCAMBIA2300 vector. The primers used are as follows:

[0052] SEQ ID NO.7:

[0053] UBP1C-F: AAGACGCGTGGATCCTCTAGAATGCAGAATCCGAGACTGAAGCAA;

[0054] SEQ ID NO.8:

[0055] UBP1C-R: CTGGTCACCGAGCTC AAGCTT TTACTGATAGTACATGAGTTGCTG;

[0056] SEQ ID NO.9:

[0057] ZmECT3-F: AAGGGATCCTCTAGAGTCGACATGTCGACAGTTGCTCCTGCCCCT;

[0058] SEQ ID NO.10:

[0059] ZmECT3-R: TAAAGCAGGGCATGC CTGCAG TTAGTTGTCATTTGATATTCCACT;

[0060] The underlined areas are enzyme cleavage sites.

[0061] Two constructed vectors were transformed into Agrobacterium GV3101 for transient co-transformation experiments in tobacco. Under laser confocal microscopy, it was observed that under normal culture conditions, ZmECT3 was localized in the cytoplasm. However, after applying a high-temperature treatment of 45°C for 30 min to tobacco plants, the localization of ZmECT3 changed; it formed granular structures in the cytoplasm and co-localized with the stress granule component UBP1C. Figure 5 A, B).

[0062] 5. Obtaining ZmECT3 gene-deleted maize lines and observing their thermosensitive phenotypes

[0063] To investigate the function of ZmECT3 under heat stress, two EMS-induced mutant seed materials with different mutation sites, EMS4-1db323 and EMS4-17962f, were used. In EMS4-1db323, a single-base substitution CAG→TAG occurred in the exon region of the ZmECT3 gene, resulting in a glutamine (Q) mutation at position 19 becoming a stop codon (Ter). In EMS4-17962f3, a single-base substitution CGA→TGA occurred, causing premature termination of the arginine (R) codon at position 186. Figure 6 A and B). After multiple generations of backcrossing, maize mutant plants were obtained. Genotyping of the obtained maize mutant plants was performed by extracting the genome from maize leaves, using the extracted genome as a template for PCR amplification, sending the PCR products to a biotechnology company for sequencing, and comparing and analyzing the sequencing results returned by the biotechnology company to confirm the acquisition of homozygous mutants.

[0064] The primers used in PCR amplification are as follows:

[0065] SEQ ID NO.11:

[0066] EMS4-1db323-Identification-F: TGGTGTTGGTAGCTGCGG;

[0067] SEQ ID NO.12:

[0068] EMS4-1db323-Identification-R:GCAGCGCTCTGTGCATCT;

[0069] SEQ ID NO.13:

[0070] EMS4-17962f-Identification-F:GCAGACCGTGTATGGAGACA;

[0071] SEQ ID NO.14:

[0072] EMS4-17962f-Identification-R: GGAGAACGAACACCATTGTG;

[0073] Seedlings of homozygous mutants were subjected to heat treatment at 45℃ for 48 hours. After repeated experiments, the heat-sensitive phenotype of the mutants was determined. Results showed that, compared to wild-type B73, the two EMS-induced mutants of ZmECT3 exhibited significantly greater wilting and leaf damage after high-temperature treatment. Figure 6 C). Statistical results show that the leaf damage area of ​​the mutant is approximately 70%–77%, significantly higher than the 20% leaf damage area of ​​the wild type. Figure 6 D). This leads to the conclusion that ZmECT3 is involved in plant resistance to heat stress.

[0074] Further investigation was conducted to determine whether ZmECT3, in addition to its role in regulating heat stress during the seedling stage, also regulates pollen heat tolerance during the reproductive stage. Pollen from the shedding stage of B73 and ZmECT3 EMS-induced mutants grown in a greenhouse was collected and heat-treated, followed by staining with TTC reagent to detect cellular respiration.

[0075] The results showed that the viability of the mutant pollen was the same as that of B73 in the untreated state; however, after a water bath treatment at 45°C for 1 hour, the viability of the mutant pollen was significantly weaker than that of B73. Figure 7 A) After analysis, it was found that the pollen viability was very low, almost all of them died, and they no longer engaged in respiration. Figure 7 B).

[0076] 6. Overexpression of ZmECT3 enhances heat resistance in Arabidopsis thaliana.

[0077] Based on the results in 2.3.2 and 2.3.3, it can be seen that the deletion of the ZmECT3 gene leads to maize being less heat-tolerant. Further investigation is needed to determine whether ZmECT3 plays a promoting role in heat tolerance.

[0078] The 35S promoter, ZmECT3 gene, GFP tag and Flag tag were sequentially linked to the multiple cloning site of the pCAMBIA2300 vector to construct the p35S::ZmECT3-GFP-Flag overexpression vector. This plasmid was transformed into Agrobacterium and then into Arabidopsis wild-type through inflorescence infection.

[0079] The prepared kanamycin stock solution was added to a slightly cooled solid culture medium at a ratio of 1 / 1000 to obtain a resistance medium. The harvested seeds were placed in the resistance medium for screening. Arabidopsis seedlings with true leaves and long root systems were selected as positive seedlings. Leaf samples were taken from the positive seedlings, and the protein content in the positive seedlings was detected by Western blotting. Two ZmECT3 overexpressing lines were identified, and then T3 generation ZmECT3 overexpressing homozygous lines 35S:ZmECT3 16# and 35S:ZmECT3 72# were obtained.

[0080] The protein expression levels of the T3 generation ZmECT3 overexpression homozygous lines were re-identified using Western blot experiments. Figure 8 A). Observations were made on Arabidopsis thaliana plants overexpressing ZmECT3 and wild-type plants. It was found that the overexpression of ZmECT3 did not affect the normal growth and development of Arabidopsis thaliana. Compared with the wild type, there were no differences in leaf development and flowering period. Figure 8 B, C).

[0081] HSFB2b has been reported to play a negative regulatory role in the response to high-temperature stress, and its mutants exhibit a heat-resistant phenotype. Therefore, hsfb2b(salk_045982c) was used as a positive control. Transgenic plants, wild-type plants, and hsfb2b(salk_045982c) were treated with a 45°C, 15-min water bath. It was found that after heat treatment, compared to the wild-type, the transgenic plants were less sensitive to high temperatures. Figure 8 D), statistical analysis revealed that the survival rate of plants overexpressing ZmECT3 after heat treatment was approximately 55%, which was higher than the wild-type survival rate of approximately 30%. Figure 8 E). Based on the above experimental results, it can be concluded that overexpression of ZmECT3 can enhance the heat resistance of Arabidopsis thaliana.

[0082] The embodiments described above are merely examples of several implementations of the present invention, and while the descriptions are relatively specific and detailed, they should not be construed as limiting the scope of the present invention. It should be noted that those skilled in the art can make various modifications and improvements without departing from the concept of the present invention, and these modifications and improvements all fall within the scope of protection of the present invention.

Claims

1. Zea mays ZmECT3 gene characterized in that, The nucleotide sequence of the gene is shown as SEQ ID NO.

1.

2. The maize plant of claim 1 ZmECT3 use of the gene in modulating heat tolerance in plants, characterized in that, The ZmECT3 Overexpression of the gene in plants, such as maize or Arabidopsis, can enhance the heat tolerance of the plants.

3. The corn plant of claim 1, wherein the plant further comprises a recombinant DNA construct comprising a nucleic acid sequence encoding a protein having the amino acid sequence of SEQ ID NO:

2. ZmECT3 the encoded protein, characterized in that, The amino acid sequence of the encoded protein is shown as SEQ ID NO.

2.

4. A method for obtaining a heat-tolerant Arabidopsis variety, characterized in that, The method comprises the following steps: (1) The corn plant as claimed in claim 1 ZmECT3 gene as a target gene, and constructing it into a plant overexpression vector to obtain ZmECT3 overexpression vector; (2) The ZmECT3 The overexpression vector was transformed into Agrobacterium GV3101, and was transformed into wild-type Arabidopsis thaliana by inflorescence infection method to obtain ZmECT3 overexpression materials; (3) from ZmECT3 positive overexpression strains were identified from the overexpression materials ZmECT3 positive overexpression strains, and the offspring of the positive overexpression strains were screened for homozygotes to obtain ZmECT3 overexpression homozygous strains.

5. The method of obtaining a heat-tolerant Arabidopsis variety according to claim 4, characterized in that, In the step (1), the corn ZmECT3 The method for obtaining the gene is as follows: taking the corn ZmECT3 The nucleotide sequence of the gene as a template to design specific amplification primers, extracting RNA from corn material and reverse transcribing into cDNA, obtaining the corn ZmECT3 Gene by PCR amplification technology.

Images