A bull sperm motility-related SNP molecular marker based on the HSPB9 gene, a detection product, and its application

Abstract

This invention discloses a SNP molecular marker, detection product, and application related to bull sperm motility based on the HSPB9 gene. These findings pertain to molecular biology technology. The SNP molecular marker is located at position 42255643 in the bovine genome, Chr19:42255643, and is polymorphic to either C or T. Research has found that the SNP genotype combination associated with high bull sperm motility is TT. By detecting the polymorphism at this SNP locus, bull sperm motility can be assessed, thereby assisting breeding efforts and providing reliable support for the production of high-quality offspring. This method offers advantages such as high reliability, high efficiency, and low cost.

Description

Technical Field

[0001] The present invention relates to the technical field of molecular biology, and in particular to a bull sperm motility-related SNP molecular marker based on the HSPB9 gene, a detection product and an application thereof. Background Art

[0002] The quality of bull semen directly impacts the effectiveness of artificial insemination and embryo transfer, making it a key factor restricting the promotion of reproductive technology. As an internationally accepted semen evaluation standard, sperm motility has become a key research area due to its high correlation with reproductive efficiency.

[0003] Specifically, the bull semen quality assessment system includes multi-dimensional parameters: in addition to basic physical indicators such as semen collection volume and sperm density, it also covers key data reflecting the functional state of germ cells, such as fresh semen vitality and post-freezing vitality, as well as structural quality parameters such as sperm deformity rate and acrosome integrity rate. These indicators not only determine the success rate of cow conception, but also have a significant correlation with the growth and development characteristics and production performance of the offspring. Therefore, the selection of high-quality bulls plays a very important role in the genetic improvement system of dairy cows.

[0004] Heat shock protein B9 (HSPB9), a member of the heat shock protein family, plays an important role in cellular stress response, protein homeostasis, and apoptosis regulation. In the male testes, HSPB9 is also closely linked to spermatogenesis and spermatogenic cell apoptosis. However, research on the bull HSPB9 gene is relatively limited, limiting its development and application.

[0005] In view of this, the present invention is proposed. Summary of the Invention

[0006] The purpose of the present invention is to provide a bull sperm motility-related SNP molecular marker based on the HSPB9 gene, a detection product and an application.

[0007] The technical solution of the present invention is described in detail as follows:

[0008] In a first aspect, the present invention provides a bull sperm motility-related SNP molecular marker based on the HSPB9 gene, wherein the SNP molecular marker is located at position Chr19:42255643 of the bovine genome, and the polymorphism is C or T.

[0009] In the promoter region of the HSPB9 gene in bulls, a single nucleotide polymorphism (SNP) at position -602 was identified. The polymorphism at this SNP was significantly associated with sperm motility. The SNP was calculated using the ATG start codon of the HSPB9 gene as +1.

[0010] Optionally or preferably, the SNP molecular marker nucleotide sequence is as shown in SEQ ID NO: 1, and the 154th base polymorphism is C or T.

[0011] In a second aspect, the present invention provides the use of the above-mentioned SNP molecular marker in evaluating the motility of bull sperm.

[0012] In a third aspect, the present invention provides a product for detecting the above-mentioned SNP molecular marker, wherein the product comprises a primer pair, and the nucleotide sequence is shown in SEQ ID NO: 2-3.

[0013] In a fourth aspect, the present invention provides a product for detecting the above-mentioned SNP molecular markers, wherein the product is a detection kit comprising a primer pair, the nucleotide sequence of the primer pair being shown in SEQ ID NO: 2-3.

[0014] In a fifth aspect, the present invention provides the use of a product for detecting the above-mentioned SNP molecular markers in evaluating the motility of bull sperm.

[0015] Optionally or preferably, in the above application, the method for evaluating bull sperm motility comprises the following steps:

[0016] (1) Extract genomic DNA from the blood or semen of the bull to be tested;

[0017] (2) Using genomic DNA as a template and the nucleotide sequences shown in SEQ ID NOs: 2-3 as primers, a PCR reaction was performed to obtain the amplified product sequence;

[0018] (3) Sequencing was used to determine the SNP molecular marker genotype in the amplified product sequence. Bulls with the SNP genotype combination of TT had high sperm motility.

[0019] Compared with the prior art, the present invention has the following beneficial effects:

[0020] The present invention discovered and identified a new SNP site related to sperm motility in the HSPB9 gene. By detecting the polymorphism of this SNP site, the sperm motility of bulls can be evaluated, thereby assisting breeding and providing reliable support for breeding high-quality next generations. It has the advantages of high reliability, high efficiency, and low cost. BRIEF DESCRIPTION OF THE DRAWINGS

[0021] Figure 1 This is the peak diagram of the SNP molecular marker position in the promoter region of the HSPB9 gene. DETAILED DESCRIPTION

[0022] In order to enable those skilled in the art to better understand the present application, the present application will be clearly and completely described below in conjunction with the embodiments and drawings. Obviously, the embodiments described are only embodiments of a part of the present application, rather than all embodiments. Based on the embodiments in this application, all other embodiments obtained by those of ordinary skill in the art without making creative work should fall within the scope of protection of this application. The instruments and reagents used in the embodiments are all derived from commercial channels unless otherwise specified.

[0023] Example 1

[0024] A total of 247 bulls were selected for the experiment, originating from the Beijing Dairy Center, Shanghai Guangming Holstein Farming Co., Ltd., and Shandong Aokes Bull Station. Semen was collected from the bulls, and genomic DNA was extracted using conventional methods and diluted to 50 ng / μL for later use. Semen collection volume, sperm density, sperm motility, sperm deformity rate, post-freezing sperm motility, and final motility were also measured and recorded for each bull.

[0025] Amplification primers were designed based on the HSPB9 gene sequence (Ensembl reference sequence ENSBTAT00000034833.4), and PCR amplification was performed using genomic DNA of the bull as a template.

[0026] Upstream primer: ACTGAGCGTCAGAGTAATGGC, SEQ ID NO: 2,

[0027] Downstream primer: AAAAGGGTGAGAGGACCCCAT, SEQ ID NO: 3.

[0028] PCR amplification system (20 μL): 1 μL of template (50 ng / μL), 1 μL of 10 μmol / L upstream and downstream primers, 12.5 μL of 2× Taq PCR Master Mix, and 4.5 μL of ddH2O.

[0029] PCR reaction conditions: denaturation at 94°C for 5 min, denaturation at 94°C for 30 s, annealing at 60°C for 30 s, extension at 72°C for 30 s, 35 cycles; extension at 72°C for 10 min, and storage at 4°C.

[0030] The obtained PCR products were sent to Beijing BGI for sequencing. The sequencing results of different samples were compared using SnapGene software. Combined with the sequencing peak graph, the SNP site in the target fragment was determined to be g.-602C>T. Figure 1 shown.

[0031] Gene frequencies, genotype frequencies, and allele frequencies were calculated using Excel software, and association analysis of the HSPB9 gene SNP polymorphism was performed using SPSS 26.0 software. The results are presented as "mean ± standard error." P < 0.01 indicates a highly significant difference, and P < 0.05 indicates a significant difference. (See Table 1 below.)

[0032] Table 1 Results of association analysis between SNP sites in the promoter region of HSPB9 gene and semen quality

[0033]

[0034] Note: Different letters in the same column indicate significant differences (P < 0.05); the same letters or no letters in the same column indicate no significant differences (P > 0.05).

[0035] As shown in Table 1, when the SNP locus genotype combination is TT, the post-thaw motility and final motility of the frozen sperm are superior, and it can be used as a molecular marker to screen individuals with high sperm motility.

[0036] Example 2

[0037] Primers were designed for the sequence SEQ ID NO: 1 containing the g.-602C>T SNP molecular marker. The primer sequences are shown below:

[0038] Upstream primer: ACTGAGCGTCAGAGTAATGGC, SEQ ID NO: 2,

[0039] Downstream primer: AAAAGGGTGAGAGGACCCCAT, SEQ ID NO: 3.

[0040] The specific sequence of SEQ ID NO:1 containing the SNP molecular marker is as follows:

[0041] ACTGAGCGTCAGAGTAATGGCCAGGGTCAGGAAAAAGGCTCCTGAGGCGGGGATGAGGGACTATGGGACCTGCTATCCACCCACACAGTGGGCACCTCCCATTCAGGGCCCACGTCTTCATCTTTGTGGTTCCAGAGCCCAGCTCTGATCCTG C

[0042] The semen of the experimental bulls was collected, and the total DNA was extracted as a template, and PCR amplification was performed using SEQ ID NO: 2-3 as primers.

[0043] PCR amplification system (20 μL): 1 μL of template (50 ng / μL), 1 μL of 10 μmol / L upstream and downstream primers, 12.5 μL of 2× Taq PCR Master Mix, and 4.5 μL of ddH2O.

[0044] PCR reaction conditions: denaturation at 94°C for 5 min, denaturation at 94°C for 30 s, annealing at 60°C for 30 s, extension at 72°C for 30 s, 35 cycles; extension at 72°C for 10 min.

[0045] The amplified products were sequenced to identify the polymorphism of the SNP loci. The semen quality of the experimental bulls was also tested, and the results are shown in Table 2.

[0046] Table 2 Semen quality test results of bull samples with different genotypes at SNP loci

[0047]

[0048] The results showed that the SNP genotype combination corresponded to the sperm motility trait, that is, the bull sperm motility was higher when the TT genotype combination was higher than that of the CC and CT genotype combinations.

[0049] This document uses specific examples to illustrate the inventive concept in detail. The above embodiments are only intended to help understand the core concept of the present invention. It should be noted that any obvious modifications, equivalent substitutions, or other improvements made by a person skilled in the art without departing from the inventive concept should be included within the scope of protection of the present invention.

Claims

1. Use of a reagent for detecting SNP molecular markers related to bull sperm motility based on the HSPB9 gene in the preparation of a product for evaluating bull sperm motility, characterized in that: The SNP molecular marker nucleotide sequence is shown in SEQ ID NO: 1, and the 154th base polymorphism is C or T.

2. The use according to claim 1, characterized in that The reagents include a primer pair, and the nucleotide sequence of the primer pair is shown in SEQ ID NO: 2-3.

3. The use according to claim 1, characterized in that The product is a detection kit, which includes a primer pair, and the nucleotide sequence of the primer pair is shown in SEQ ID NO: 2~3.

Images