Structural variation molecular marker related to body surface black plaques of Cyprinus carpio var. Color, specific primer and application thereof

Abstract

The invention belongs to the technical field of molecular marker-assisted breeding, and particularly discloses a structural variation molecular marker related to body surface black plaques of Cyprinus carpio var. Color carpio, a specific primer and application of the molecular marker in genetic breeding of Cyprinus carpio var. Color carpio. The structural variation molecular marker is located in the fourth intron region (the specific position is the 305bp position of the downstream of the fourth exon) of the Rptp gene of the color cyprinus carpio var.color homozygous black spot strain, and 357bp sequence deletion exists in DNA double chains at the position. Compared with the heterozygous black-spot strain, the heterozygous black-spot strain has one chain 357bp deletion, and the black-spot-free strain Cyprinus carpio var. Color carp does not have 357bp sequence deletion in the region. The specific primer is used for detecting the structural variation molecular marker of the Rptp gene in a black spot line color carp sample to be detected. According to the molecular marker and the specific primer, the black heterozygotes of the Cyprinus carpio var. Color can be efficiently and accurately removed, breed conservation and breeding of the black spot line Cyprinus carpio var. Color at low cost and high accuracy can be realized, and the molecular marker and the specific primer have remarkable application value.

Description

Technical Field

[0001] The present invention belongs to the technical field of molecular marker-assisted breeding, and relates to a structural variation molecular marker related to the black patches on the body surface of Oujiang color carp, specific primers and their applications. Specifically, this molecular marker and primers are used to identify whether the individuals of the black-spotted strain of Oujiang color carp are in a genetically homozygous state or a heterozygous state. Background Art

[0002] Oujiang color carp, as a characteristic cultured fish with a long history in the Oujiang River Basin of Zhejiang Province, is not only favored by the ornamental fish market for its diverse body colors, but also enjoys a high reputation locally for its high-quality edible value. Since 1999, Shanghai Ocean University has cooperated with the Longquan Water Conservancy Bureau of Zhejiang Province. Based on the theoretical basis of crossbreeding system selection, five crossbreeding selected lines, namely "All Red" (the whole body surface is red), "Big Flower" (the red body surface is inlaid with large black patches), "Twisted Flower" (the red body surface is inlaid with small black spots), "Pink Jade" (the whole body surface is white), and "Pink Flower" (the white body surface is inlaid with large black patches), have been successfully cultivated for multiple key traits such as body color, growth, and morphology. These selected lines have shown significant genetic improvement effects in terms of body color purity, growth performance, and morphological optimization.

[0003] In production practice and scientific research, the black-spotted strain of Oujiang color carp shows better growth potential and stress resistance compared to the pure color. However, the black patch trait of Oujiang color carp shows an obvious dominant genetic characteristic over the non-black patch trait. Specifically, when pure black-spotted Oujiang color carp is crossbred with non-black-spotted Oujiang color carp, the traits of the first-generation offspring are all black body colors, but from a genetic perspective, these individuals are all heterozygotes. Further, when these heterozygotes self-breed to the F2 generation, trait segregation will occur in their offspring, specifically showing a ratio of 3:1 of black-spotted individuals to non-black-spotted individuals. In order to ensure the genetic stability and breeding efficiency of the black-spotted strain, breeders urgently need to screen germplasm resources from genetically homozygous black-spotted individuals for subsequent germplasm conservation and breeding work. Because once heterozygous black-spotted individuals are included in the breeding system, they will cause trait segregation in the offspring, resulting in the appearance of non-black-spotted individuals, thus seriously interfering with the genetic purity and breeding process of the black-spotted strain.

[0004] Therefore, the present invention aims to develop an efficient and accurate body color-specific molecular marker technology for rapid detection of the genetic purity of the black-spotted strain of Oujiang color carp. The successful application of this technology will greatly improve the breeding efficiency of the black-spotted strain of Oujiang color carp, effectively shorten the breeding cycle, and lay a solid genetic foundation for the continuous improvement and industrial development of Oujiang color carp varieties. Summary of the Invention

[0005] To quickly detect the genetic purity of the black-spotted strain of Oujiang color carp, one of the objectives of the present invention is to provide a structural variation molecular marker related to the black patches on the body surface of Oujiang color carp. This marker is located at the 4th intron of the Rptp gene in the homozygous black-spotted strain of Oujiang color carp, and it shows a 357bp sequence deletion in both DNA strands (named SV-del-357); in contrast, in the heterozygous black-spotted strain of Oujiang color carp, one DNA strand has this 357bp sequence; the 357bp deleted sequence is shown in SEQ ID NO:1. That is, the homozygous black strain of Oujiang color carp shows a (double-strand) deletion of the structural variation molecular marker, and the heterozygous black strain of Oujiang color carp shows a (single-strand) insertion of the structural variation molecular marker.

[0006] Another objective of the present invention is to provide a specific primer designed for the above-mentioned structural variation molecular marker to identify whether the genetic state of the black strain of Oujiang color carp is homozygous. This primer includes a forward primer and a reverse primer, where:

[0007] The forward primer sequence is 5'-ACAGACCATCTCAGTTCAGTCTG-3' (SEQ ID NO:2);

[0008] The reverse primer sequence is 5'-CCACTCTCTCTGCCAGCTTTA-3' (SEQ ID NO:3).

[0009] A third objective of the present invention is to provide a method for identifying whether the genetic state of the black-spotted strain of Oujiang color carp is homozygous. Using the specific primer, amplify a partial sequence of the 4th intron region of the Rptp gene in the sample of the black-spotted strain of Oujiang color carp to be tested (i.e., the fragment of the region where the structural variation molecular marker is located) by PCR, and then analyze the amplification product by agarose gel electrophoresis. According to the band size in the electrophoresis pattern, it can be determined whether the black-spotted strain of Oujiang color carp to be tested is in a homozygous or heterozygous state. This method specifically includes the following steps:

[0010] (1) Collect the tail fin tissue sample of the individual of the black-spotted strain of Oujiang color carp to be tested, and extract genomic DNA;

[0011] (2) Use the specific primer pair with the sequences shown in SEQ ID NO:2-3 to perform PCR amplification on the genomic DNA of the sample to be tested in step (1);

[0012] (3) Perform agarose gel electrophoresis detection on the PCR amplification product in step (2), and determine whether the sample to be tested is homozygous or heterozygous according to the size of the electrophoresis band in the electrophoresis pattern.

[0013] Further, in step (2), the PCR amplification reaction system is as follows: 2.5 μL of forward primer F (10 μM), 2.5 μL of reverse primer R (10 μM), 25 μL of 2×PCR Taq mix, 15 μL of ddH2O, 5 μL of template DNA, and the total reaction volume is 50 μL.

[0014] Further, in step (2), the PCR amplification conditions are as follows: pre-denaturation at 95°C for 5 min; denaturation at 95°C for 30 s, annealing at 58°C for 30 s, extension at 72°C for 1 min 10 s, for 34 cycles; final extension at 72°C for 10 min, and preservation at 4°C.

[0015] Further, in step (3), the agarose gel electrophoresis uses a 1.5% agarose gel; the electrophoresis conditions are running at a voltage of 150 v for 20 minutes first, and then running at a voltage of 200 v for 20 minutes.

[0016] Further, in step (3), the method for determining the genetic purity according to the band situation of the electrophoresis pattern is as follows: after the electrophoresis is completed, use a gel imaging system to take pictures of the agarose gel and analyze the results: if there is only a sequence band of 684 bp (SEQ ID NO: 4) in the electrophoresis pattern, then the individual of the black-spotted strain of Oujiang color carp to be tested is homozygous; if there are two bands of 684 bp (SEQ ID NO: 4) and 1041 bp (SEQ ID NO: 5) at the same time, then the individual of the black-spotted strain of Oujiang color carp to be tested is heterozygous.

[0017] The present invention has developed a new molecular marker detection system based on the specific structural variation of the black-spotted trait of Oujiang color carp, and can efficiently discriminate the genetic homozygosity of black-spotted individuals through self-designed primer pairs. Specifically, the PCR amplification products are visually typed by agarose gel electrophoresis, and its technical advantages are reflected in (1) non-invasive sampling: DNA extraction can be completed using fin rays or trace blood samples, and the detection process is non-invasive to the fish body; (2) strong universality: breaking through the limitations of traditional morphological identification, applicable to the whole-year detection of individuals at different developmental stages (juvenile fish to adult fish) and various physiological states; (3) high cost performance: establishing a standardized "PCR-electrophoresis" detection process, with a short detection cycle and high accuracy. Description of the Drawings

[0018] Figure 1 It is a sequence alignment diagram of the structural variation regions of homozygous black-spotted strain and non-black-spotted strain individuals.

[0019] Figure 2 It is a gel electrophoresis diagram of the SV-del-357 structural variation amplification of 24 black-spotted strains and 24 non-black-spotted strains of Oujiang color carp, where the first lane is the Marker.

[0020] Figure 3Gel electrophoresis pattern of the SV-del-357 structural variation amplification of black-spotted individuals of Oujiang color carp, where the first lane is the Marker. Among them, black-spotted individuals numbered 1, 3, 4, 6, 7, 9, 10, 11, 13, 14, 16, 17, and 18 are heterozygous.

[0021] Figure 4 Schematic diagram of the structural variation pattern of the 4th intron region of the Rptp gene in Oujiang color carp. Specific implementation manners

[0022] The present invention will be further described below in conjunction with the accompanying drawings and specific embodiments.

[0023] Example 1 Detection of the structural variation SV-del-357 of black-spotted and non-black-spotted Oujiang color carp

[0024] 1. Primer design

[0025] Primers were designed according to the intron region sequence of the Rptp gene in Oujiang color carp. The forward primer sequence is 5'-ACAGACCATCTCAGTTCAGTCTG-3' (SEQ ID NO:2), and the reverse primer sequence is 5'-CCACTCTCTCTGCCAGCTTTA-3' (SEQ ID NO:3).

[0026] 2. Extraction of sample DNA

[0027] Homozygous "big flower", "pink flower", "full red", and "pink jade" individuals of Oujiang color carp were taken, fin ray tissues were collected, and genomic DNA was extracted using the conventional phenol-chloroform extraction method.

[0028] 3. PCR amplification of the target sequence

[0029] The primers in step 1 above were used to perform PCR amplification on the Oujiang color carp DNA sample in step 2 above. The reaction system for PCR is: 25 μl of 2×PCR Taq mix, 2.5 μl of each upstream and downstream primer (10 μM), 5 μl of 500 ng DNA, and made up to 50 μl with ultrapure water. The reaction program for PCR is: first pre-denature at 95°C for 5 min, then perform 34 cycles (denature at 95°C for 30 s, anneal at 58°C for 30 s, extend at 72°C for 1 min 10 s), and finally extend at 72°C for 10 min.

[0030] 4. Determination of the SV-del-357 genotype

[0031] After the PCR amplification was completed, the PCR products were detected by 1.5% agarose gel electrophoresis. The electrophoresis conditions were to run at 150 v for 20 minutes first, and then at 200 v for 20 minutes. Only a single band of 684 bp was amplified in the black-spotted strain Oujiang color carp samples, and the genotype was SV-del-357- / - Only a single band of 1041 bp was amplified from the sample of Oujiang carp without black spots, and the genotype was defined as SV-del-357. + / + ( Figure 2 ).

[0032] 5. Sequence Alignment

[0033] The PCR products were sent to a biological company for sequencing. After obtaining the PCR amplification sequences of homozygous black spots and those without black spots, the sequences were compared using Clustal W software, which showed that the black spot individuals had a sequence deletion of 357 bp compared to the non-black spot individuals ( Figure 1 ), the deletion sequence is shown in SEQ ID NO:1.

[0034] Nucleotide sequence (357 bp) SEQ ID NO: 1

[0035] CGATGAAGAAATGAGGTTCATTCATATTATAGAAGTGAACATGACCCC

[0036] TGGTCTTATTGTGCATGATTCATCATTGCACGTCATAAGCATTTTTATTGG

[0037] GGGGTTAGACAAATGTGCAAAGTGCAAAATGACAGTTTTTACTTCCAG

[0038] AGGTGATAACTGACAGCTAATGTAAAGTGGGCATGTGCATTTACATTT

[0039] ACATGTCATTATTTAGCAGATGCTTTTATTAAAAGAAAAGTCATTCATC

[0040] TCAACAGCTGGCATTGGTTATCTTTGCATGACATATAGCTTTACATTTA

[0041] GTGTTTGCAAAACAGTAAATAGTGTATATTCCACCATATGCAGTAAGCT

[0042] AGTATTCCATTCCAC

[0043] Example 2 Detection of SV-del-357 Molecular Markers in Black Spotted Individuals in the F2 Progeny of the “Fenhua” and “Fenyu” Oujiang Carp Pedigrees

[0044] Randomly collect 18 black-spotted individuals from the F2 generation of the "Pink Flower" and "Pink Jade" families. After collecting fin ray tissues, extract genomic DNA, and then, according to the method of Example 1, perform PCR amplification and electrophoresis pattern detection on 18 individuals. If the electrophoresis pattern shows only one band of 684 bp, the detected black-spotted Oujiang color carp individuals are genetically homozygous at this time. If the electrophoresis pattern shows two bands of 1041 bp and 684 bp, the detected black-spotted Oujiang color carp individuals are genetically heterozygous at this time.

[0045] Among the randomly selected 18 Oujiang color carp individuals, 5 samples amplified only one specific band of 684 bp, indicating that these samples are genetically homozygous. Two bands were amplified from the DNA samples of 13 samples, with lengths of 684 bp and 1041 bp respectively, proving that these samples are genetically heterozygous ( Figure 3 ). The sequences of 684 bp and 1041 bp are shown in SEQ ID NO:4-5.

[0046] Nucleotide sequence (684 bp) SEQ ID NO:4

[0047] TGATTTACACTTGATTTCCTCTCCCCTCTTCTCTCGTTTAGGTTATTTTTG

[0048] AGGCTGTGTCTGTACAAGGGCATCCTGGGTTCATCGCAGTGGATGAGA

[0049] TGCACGTTTTGGCCCACCCTTGCCGTGAGTAAACACATACACACACACG

[0050] GCGCCGGCTTACTTTCACAGTCTTGGCTACGCTGTAGGAGTTCAGTCTG

[0051] TCAACTACTGTGAAAAGCACTTCATGTGGATCGAGGGTTGAACAGAGA

[0052] TGGAAAAGGCCAGCAAACAAGCAGGTCTGTGCTGAGGATGAGAGATA

[0053] GAGGGAGACAGATTGCAGAGCTGAGTGCTCAGACTTCAGGCCCTGTTC

[0054] ATCATTTTTTGTTGTGACAGGAGAACTTTAGCCTTTGACTTCCATTGTCT

[0055] TAGATCTTTCTGTGTCACTAATGTAAAGCCAGCAGCACATAACCAGAAT

[0056] TTTCAATAAAAATGTAATAAGAACCGAGTTGAAGGAACACAAGTATAG

[0057] ATCATGGAAGAATCTTATCTTGACTCTGTTTTTTATTTTTTTACTTGCCA

[0058] TAATAATAATAGTGGATCATTTTAAGATTCCTTCATTAAATTTGAACGC

[0059] TTTCCACGTTATAGCAAAGATACTTAAAAAAGAAATCTATATTCTCAGT

[0060] GACTTTAATTATAAAAGATTGATATTGCTTTTGTGCAGAAATGCATGCA Nucleotide sequence (1041bp) SEQ ID NO:5

[0061] TGATTTACACTTGATTTCCTCTCCCCTCTTCTCTCGTTTAGGTTATTTTTG

[0062] AGGCTGTGTCTGTACAAGGGCATCCTGGGTTCATCGCAGTGGATGAGA

[0063] TGCACGTTTTGGCCCACCCTTGCCGTGAGTAAACACATACACACACACG

[0064] GCGCCCGCTTACTTTCACAGTCTTGGCTACGCTGTAGGAGTTCAGTCTG

[0065] TCAACTACTGTGAAAAGCACTTCATGTGGATCGAGGGTTGAACAGAGA

[0066] TGGAAAAGGCCAGCAAACAAGCAGGTCTGTGCTAAGGATGAGAGATA

[0067] GAGGGAGACAGATTGCAGAGCTGAGTGCTCAGACTTCAGGCCCTGTTC

[0068] ATCATTTTTTGTTGGGACAGGAGAACTTTAGCCTTTGACTTCCATTGTCT

[0069] TAGATCTTTCTGTGTCACTAATGTAAAGCCAGCAGCACCGATGAAGAA

[0070] ATGAGGTTCATTCATATTATAGAAGTGAACATGACCCCTGGTCTTATTG

[0071] TGCATGATTCATCATTGCACGTCATAAGCATTTTATTGGGGGGTTAGAC

[0072] AAATGTGCAAAGTGCAAAATGACAGTTTTTACTTCCAGAGGTGATAAC

[0073] TGACAGCTAATGTAAAGTGGGCATGTGCCATTTACATTTACATGTCATT

[0074] ATTTAGCAGATGCTTTTATTAAAAGAAAAGTCATTCATCTCAACAGCTG

[0075] GCATTGGTTATCTTTGCATGACATATAGCTTTACATTTAGTGTTTGCAA

[0076] AACAGTAAATAGTGTATATTCCACCATATGCAGTAAGCTAGTATTCCAT

[0077] TCCACATAACCAGAATTTTCAATAAAAATGTAATAAGAACCGAGTTGA

[0078] AGGAACACAAGTATAGATCATGGAAGAATCTTATCTTGACTCTGTTTTT

[0079] TATTTTTTTACTTGCCATAATAATAATAGTCGATCATTTTAAGATTCCTT

[0080] CATTAAATTTGAACGCTTTCCACGTTATAGCAAAGATACTTAAAAAAG

[0081] AAATCTATATTCTCAGTGACTTTAATTATAAAAGATTGATATTGCTTTT

[0082] GTGCAGAAATGCATGCA

[0083] Combined with the above examples, this marker has a 357-bp sequence deletion in the 4th intron of the Rptp gene of the homozygous black-spotted strain of Oujiang color carp. There is this 357-bp sequence in one DNA strand of the heterozygous black-spotted strain of Oujiang color carp, while the homozygous non-black-spotted strain has no deletion( Figure 4 ).

[0084] This specific implementation manner is only an interpretation of the present invention and not a limitation thereof. Any changes made by those skilled in the art after reading the specification of the present invention will be protected by the patent law as long as they are within the scope of the claims of the present invention.

Claims

1. A molecular marker for structural variation associated with black patches on the body surface of Oujiang carp, characterized in that: The structural variation molecular marker is a 357 bp DNA fragment inserted or deleted at 305 bp downstream of the fourth exon in the fourth intron region of the Rptp gene of Oujiang carp. The sequence of the DNA fragment is shown in SEQ ID NO:

1.

2. The structural variation molecular marker associated with the body color of Oujiang colored carp according to claim 1, characterized in that: The homozygous black strain of Oujiang carp showed a deletion of the structural variation molecular marker, while the heterozygous black strain of Oujiang carp showed an insertion of the structural variation molecular marker.

3. A specific primer for detecting the structural variation molecular marker according to claim 1, characterized in that: The primers include a forward primer and a reverse primer, and the sequences are shown in SEQ ID NO: 2-3.

4. Use of the structural variation molecular marker described in any one of claims 1-2 or the specific primer described in claim 3 in identifying the genetic purity of black strain Oujiang colored carp.

5. The use according to claim 4, characterized in that The application method comprises the following steps: (1) Collect tail fin tissue samples of individual Oujiang carp of the black-spotted strain to be tested and extract genomic DNA; (2) using a specific primer pair with a sequence as shown in SEQ ID NO: 2-3, to perform PCR amplification on the genomic DNA of the sample to be tested in step (1); (3) The PCR amplification product of step (2) is subjected to agarose gel electrophoresis, and the sample to be tested is determined to be homozygous or heterozygous based on the electrophoretic bands in the electrophoretic pattern.

6. The use according to claim 5, characterized in that: In step (2), the PCR amplification reaction system is: forward primer F 2.5 μL, reverse primer R 2.5 μL, 2×PCR Taq mix 25 μL, ddH2O 15 μL, template DNA 5 μL, and the total reaction volume is 50 μL system; the concentrations of the forward primer F and reverse primer R are 10 μM.

7. The use according to claim 5, characterized in that: In step (2), the PCR amplification reaction conditions are: pre-denaturation at 95°C for 5 min; denaturation at 95°C for 30 s, annealing at 58°C for 30 s, extension at 72°C for 1 min 10 s, 34 cycles; final extension at 72°C for 10 min, and storage at 4°C.

8. The use according to claim 5, characterized in that: In step (3), the agarose gel electrophoresis uses 1.5% agarose gel; the electrophoresis conditions are first running at a voltage of 150V for 20 minutes, and then running at a voltage of 200V for 20 minutes.

9. The use according to claim 5, characterized in that: In step (3), the method for determining genetic purity according to the electrophoresis band situation is as follows: after the electrophoresis is completed, the agarose gel is photographed using a gel imaging system and the results are analyzed: if the electrophoresis pattern only has a sequence band of 684 bp, the black-spotted strain Oujiang carp individual to be tested is homozygous; if both the 684 bp and 1041 bp bands are present, the black-spotted strain Oujiang carp individual to be tested is heterozygous; the 684 bp sequence is as shown in SEQ ID NO:4, and the 1041 bp sequence is as shown in SEQ ID NO:5.

Images