Primer, probe, kit and method for detecting swine pathogenic escherichia coli

Abstract

The invention provides a primer, a probe, a kit and a method for detecting swine pathogenic escherichia coli. Specifically, a fluorescent quantitative PCR method is utilized, swine escherichia coli chuS and kpsTII are taken as target genes, conservative primer and probe sequences are designed, a duplex fluorescent quantitative PCR detection technology is established, and swine escherichia coli clinical strains can be distinguished into a virulent strain with double positive chuS and kpsTII, a medium virulent strain with positive chuS and kpsTII and a low virulent strain with positive chuS and kpsTII. The method is beneficial to rapid identification of pathogenic strains and guidance of formulation of clinical prevention and control strategies.

Description

Technical Field

[0001] The invention belongs to the technical field of molecular biological detection, and in particular relates to primers, probes, a kit and a method for detecting pathogenic Escherichia coli of pig origin. Background Art

[0002] Escherichia coli belongs to the phylum Proteobacteria, class Gammaproteobacteria, family Enterobacteriaceae, and genus Enterobacter. It is a Gram-negative bacterium that is widely distributed in the environment and the digestive tract of animals. Most of them are members of the environmental or intestinal commensal flora, but a few Escherichia coli carrying specific virulence factors can invade the animal body and multiply in tissues or blood to cause infection. There are many pathogenic subtypes of Escherichia coli. Enteropathogenic Escherichia coli (EPEC), enterohemorrhagic Escherichia coli (EHEC), enterotoxigenic Escherichia coli (ETEC), enteroaggregative Escherichia coli (EAEC), and enteroinvasive Escherichia coli (EIEC) are the five main subtypes that cause intestinal infections. Among them, ETEC is one of the main pathogens that cause bacterial diarrhea in humans and young animals, especially yellow and white diarrhea in newborn piglets, with high morbidity and mortality.

[0003] Due to the interference of the breeding environment and the presence of E. coli in the healthy intestines of pigs, the rapid identification of highly pathogenic strains of E. coli is restricted, which can easily lead to misjudgment of the treatment window period and affect the clinical prevention and control effect. In addition, with the continuous iteration and update of gene sequencing technology and genomic analysis technology, more and more pathogenic subtypes and hybrid pathogenic strains have been found in pig-derived isolates, further increasing the difficulty of rapid identification of highly pathogenic strains. Signature virulence factors are important targets for distinguishing environmental / symbiotic strains of E. coli from pathogenic strains, but there are many virulence factors of E. coli, and there is currently no clear virulence factor for distinguishing strong and weak strains. Summary of the invention

[0004] In order to solve the problems of the prior art, the present invention provides primers, probes, kits and methods for detecting pathogenic Escherichia coli from pigs. Specifically, the present invention uses a fluorescent quantitative PCR method, takes chuS and kpsTII of pig Escherichia coli as target genes, designs conservative primer and probe sequences, and establishes a double fluorescent quantitative PCR detection technology, which can distinguish clinical strains of pig Escherichia coli from pigs into: strong strains with double positive chuS and kpsTII, medium-virulence strains with positive chuS and negative kpsTII, weak strains with negative chuS and positive kpsTII, and double-negative non-toxic strains, which is conducive to the rapid identification of pathogenic strains and guides the formulation of clinical prevention and control strategies.

[0005] Specifically, the technical solutions of the present invention include but are not limited to the following:

[0006] In one aspect, the present invention provides a fluorescence quantitative PCR primer set and a fluorescence probe for detecting the pathogenicity of Escherichia coli of porcine origin. The fluorescence quantitative PCR primer set and the fluorescence probe comprise forward and reverse primers and a fluorescence probe respectively designed for the chuS gene and the kpsTII gene, wherein the forward and reverse primers and the fluorescence probe designed for the chuS gene specifically amplify and detect a gene fragment as shown in SEQ ID NO:18, and the forward and reverse primers and the fluorescence probe designed for the kpsTII gene specifically amplify and detect a gene fragment as shown in SEQ ID NO:20.

[0007] In one aspect, the 5'-3' sequence of the forward primer designed for the chuS gene provided by the present invention is as shown in SEQ ID NO.1, and the 5'-3' sequence of the reverse primer designed for the chuS gene is as shown in SEQ ID NO.2.

[0008] Optionally, the fluorescence probe sequence designed for the chuS gene is: 5'-TGCTCCTGTTCGCCTTCTGTACGTT-3', the 3' end of the fluorescence probe is labeled with a fluorescence quenching group, and the 5' end is respectively labeled with a fluorescence reporting group.

[0009] In yet another aspect, the 5'-3' sequence of the forward primer designed for the chuS gene provided by the present invention is as shown in SEQ ID NO.1, the 5'-3' sequence of the reverse primer designed for the chuS gene is as shown in SEQ ID NO.2, and the fluorescence probe sequence designed for the chuS gene is: 5'-TGCTCCTGTTCGCCTTCTGTACGTT-3', the 3' end of the fluorescence probe is labeled with a fluorescence quenching group, and the 5' end is respectively labeled with different fluorescence reporting groups.

[0010] In one aspect, the 5'-3' sequence of the forward primer designed for the kpsTII gene provided by the present invention is as shown in SEQ ID NO.4, and the 5'-3' sequence of the reverse primer designed for the kpsTII gene is as shown in SEQ ID NO.5.

[0011] Optionally, the fluorescence probe sequence designed for the kpsTII gene is: 5'-TGATTTACCCGCTCCGTTGCGACCA-3', the 3' end of the fluorescence probe is labeled with a fluorescence quenching group, and the 5' end is labeled with a fluorescence reporting group.

[0012] In yet another aspect, the forward primer 5'-3' sequence designed for the kpsTII gene provided by the present invention is as shown in SEQ ID NO.4, the reverse primer 5'-3' sequence designed for the kpsTII gene is as shown in SEQ ID NO.5, and the fluorescence probe sequence designed for the kpsTII gene is: 5'-TGATTTACCCGCTCCGTTGCGACCA-3'. The 3' end of the fluorescence probe is labeled with a fluorescence quenching group, and the 5' end is labeled with a fluorescence reporting group.

[0013] In yet another aspect, the forward primer 5'-3' sequence designed for the chuS gene provided by the present invention is as shown in SEQ ID NO.1, the reverse primer 5'-3' sequence designed for the chuS gene is as shown in SEQ ID NO.2, and the fluorescence probe sequence designed for the chuS gene is: 5'-TGCTCCTGTTCGCCTTCTGTACGTT-3'; and the forward primer 5'-3' sequence designed for the kpsTII gene is as shown in SEQ ID NO.4, the reverse primer 5'-3' sequence designed for the kpsTII gene is as shown in SEQ ID NO.5, and the fluorescence probe sequence designed for the kpsTII gene is: 5'-TGATTTACCCGCTCCGTTGCGACCA-3'. The 3' end of the fluorescence probe is labeled with a fluorescence quenching group, and the 5' end is labeled with a fluorescence reporting group.

[0014] In one aspect, the 5' end fluorescence reporting group of the fluorescence probe of the present invention is selected from FAM, JOE, ROX, TET, TAMRA, HEX, VIC, CY3, CY5 or Texas Red; the 3' end fluorescence quenching group of the fluorescence probe is selected from BHQ1, TAMRA, Eclipse, Dabcyl, LowaBlackTMRQ or LowaBlackTMFQ.

[0015] In one aspect, the 5' end fluorescence reporting group of the fluorescence probe of the present invention is FAM or VIC, and the 3' end fluorescence quenching group of the fluorescence probe is BHQ1.

[0016] In one aspect, the fluorescence probe 5'-3' sequence designed for the chuS gene of the present invention is as shown in SEQ ID NO.:3.

[0017] In one aspect, the fluorescence probe 5'-3' sequence designed for the kpsTII gene of the present invention is as shown in SEQ ID NO.:6.

[0018] In one aspect, the forward primer 5'-3' sequence designed for the chuS gene provided by the present invention is as shown in SEQ ID NO.1, the reverse primer 5'-3' sequence designed for the chuS gene is as shown in SEQ ID NO.2, and the fluorescent probe 5'-3' sequence designed for the chuS gene is as shown in SEQ ID NO.:3; and the forward primer 5'-3' sequence designed for the kpsTII gene is as shown in SEQ ID NO.4, the reverse primer 5'-3' sequence designed for the kpsTII gene is as shown in SEQ ID NO.5, and the fluorescent probe 5'-3' sequence designed for the kpsTII gene is as shown in SEQ ID NO.:6.

[0019] In another aspect, the present invention also provides a kit for rapidly detecting the pathogenicity of porcine Escherichia coli, which is characterized by comprising the fluorescent quantitative PCR primer set and fluorescent probe of the present invention.

[0020] In one aspect, the kit of the present invention further comprises a positive plasmid standard, and the positive plasmid standard is a recombinant plasmid into which a sequence containing the chuS gene amplification segment of SEQ ID NO:18 and a sequence containing the kpsTII gene amplification segment of SEQ ID NO:20 are introduced.

[0021] In one aspect, the positive plasmid standard of the present invention is a recombinant plasmid into which target fragments containing sequences SEQ ID NO:17 and SEQ ID NO:19 are introduced.

[0022] In one aspect, the positive plasmid standard of the present invention is a recombinant plasmid into which the target fragments of SEQ ID NO:17 and SEQ ID NO:19 are introduced.

[0023] In one aspect, the recombinant plasmid of the present invention is a recombinant pUC57 plasmid.

[0024] In one aspect, the concentration of the positive plasmid standard of the present invention can be as low as 10 copies / μL.

[0025] In one aspect, the present invention provides a method for detecting porcine pathogenic Escherichia coli, and the method comprises the following steps:

[0026] (1) Using the bacterial liquid to be tested or the extracted DNA as a template; and

[0027] (2) Using the fluorescent quantitative PCR primer set and fluorescent probe of the present invention or the kit of the present method to perform dual fluorescent quantitative PCR detection on the template.

[0028] In one aspect, the dual fluorescence quantitative PCR reaction system of the present invention is 20 μL, which includes 6.5 μL of water, 10 μL of 2×Q3Probe qPCR Master Mix (Universal), 0.4 μL each of the forward primer and reverse primer designed for the chuS gene, 0.2 μL of the fluorescence probe designed for the chuS gene, 0.2 μL each of the forward primer and reverse primer designed for the kpsTII gene, 0.1 μL of the fluorescence probe designed for the kpsTII gene, and 2 μL of DNA template.

[0029] In one aspect, in the dual fluorescence quantitative PCR reaction system of the present invention, the final concentration of each primer is 0.2 - 0.1 μM, and the final concentration of the probe is 0.05 - 0.1 μM.

[0030] In one aspect, the dual fluorescence quantitative PCR amplification conditions of the present invention are pre-denaturation at 95°C for 30 s; cyclic reaction at 95°C for 10 s, 60°C for 30 s, for 40 cycles.

[0031] In one aspect, the concentration of the Escherichia coli bacterial solution detected by the present invention can be as low as 10 2 CFU / mL.

[0032] In one aspect, the concentration of the DNA template detected by the present invention can be as low as 10 3 copies / μL. In one aspect, the concentration of the DNA template detected by the present invention can be as low as 10 copies / μL.

[0033] In one aspect, the detection coincidence rate of the present invention for the double positive, double negative of the kpsTII gene and chuS gene, or one being positive and the other being negative is greater than 96%.

[0034] In one aspect, the detection coincidence rate of the present invention for the double positive Escherichia coli of the kpsTII gene and chuS gene can reach 100%.

[0035] The beneficial effects of the present invention are as follows:

[0036] (1) The present invention uses specific primers, probes or a kit composed of them to identify highly virulent strains of porcine pathogenic Escherichia coli by fluorescence quantitative PCR method, with the double positive of the chuS and kpsTII genes as the determination criterion. As a new and beneficial technical means for identifying highly virulent strains of porcine pathogenic Escherichia coli, it has creativity and practicality.

[0037] (2) Specifically, the present invention can simultaneously detect the chuS and kpsTII genes of porcine Escherichia coli in one reaction system, significantly shortening the detection time compared with the conventional PCR method, saving costs while improving the detection efficiency, and having good application prospects.

[0038] (3) The detection primer set of the present invention is designed based on the chuS and kpsTII gene sequences. Intraspecies and interspecies tests were carried out using this primer set, and no positive results were obtained, indicating that the primer set has strong specificity.

[0039] (4) The present invention has high detection sensitivity for the chuS and kpsTII genes, reaching 10 copies / μL.

[0040] (5) The detection methods of the present invention are both stable in inter-group and intra-group repetitions and are suitable for large-scale clinical detection. Description of the Drawings

[0041] Figure 1 Shows the positive and negative screening results of chuA primer probes

[0042] Figure 2 Shows the positive and negative screening results of chuS primer probes

[0043] Figure 3 Shows the positive and negative screening results of kpsMII primer probes

[0044] Figure 4 Shows the positive and negative screening results of kpsTII primer probes

[0045] Figure 5 Shows the amplification curve and standard curve of chuS①

[0046] Figure 6 Shows the amplification curve and standard curve of chuS②

[0047] Figure 7 Shows the amplification curve and standard curve of chuA①

[0048] Figure 8 Shows the amplification curve and standard curve of chuA②

[0049] Figure 9 Shows the amplification curve and standard curve of kpsTII①

[0050] Figure 10 Shows the amplification curve and standard curve of kpsTII②

[0051] Figure 11 Shows the amplification curve and standard curve of the combination of chuS① and kpsTII①

[0052] Figure 12 Shows the amplification curve and standard curve of the combination of chuA① and kpsTII①

[0053] Figure 13 Shows the sensitivity detection results

[0054] Figure 14 Shows the amplification curve results of the intraspecies specificity test

[0055] Figure 15 Shows the amplification curve results of the interspecies specificity test

[0056] Figure 16 Shows the results of the ordinary PCR sensitivity test

[0057] Figure 17 Shows the results of the pathogenicity assessment of the mouse infection model after the clinical strain detection and grouping Detailed implementation manners

[0058] To make the objectives, technical solutions and advantages of the embodiments of the present invention clearer, the technical solutions in the embodiments of the present invention will now be described clearly and completely. Obviously, the described embodiments are some, but not all, of the embodiments of the present invention. All other embodiments obtained by those of ordinary skill in the art based on the embodiments of the present invention without creative efforts shall fall within the protection scope of the present invention.

[0059] The test materials used in the embodiments: The plasmid extraction kit is FastPure Plasmid Mini Kit purchased from Novoprotein Biotechnology Co., Ltd., and the qPCR reaction reagent is 2×Q3Probe qPCR Master Mix (Universal) purchased from Shanghai Tulugang Biotechnology Co., Ltd.

[0060] In the detailed implementation manners, fluorescence quantitative PCR is used to identify strong and weak pathogenic strains of porcine pathogenic Escherichia coli. Using the DNA of the sample to be tested as a template, four key virulence genes of porcine pathogenic Escherichia coli strong strains, namely chuA, chuS, kpsMII, and kpsTII, are selected as target genes. Then, by comparing the target gene sequences, the conserved sequence regions are determined. Fluorescence quantitative PCR amplification primers are designed according to the gene sequences, and probes are designed in the amplified primers. Four sets of combination schemes are designed by combining two by two among the chu gene cluster genes and the capsule synthesis gene cluster genes in the designed primer-probe combination. Through the positive and negative screening of the fluorescence quantitative PCR primers and probes and the optimal screening of single and multiplex standard curves, finally, the combination of chuS and kpsTII is selected as the target gene of the present invention. Thus, the established dual fluorescence quantitative PCR method can identify whether there are strong pathogenic Escherichia coli strains in porcine clinical samples by analyzing the fluorescence quantitative PCR amplification curve and Ct value.

[0061] Example 1: Design and preliminary screening of primers and probes for candidate target genes

[0062] Referring to the genomic sequences of the strains isolated from our laboratory and deposited in GenBank, the virulence genes chuA, chuS, kpsMII, and kpsTII were selected as the target genes for detection. MegAlign was used to perform a conservation analysis on the sequences to determine the candidate regions of the gene sequences to be amplified. Then, quantitative PCR amplification primers were designed based on the determined gene sequences, and probe primers were designed in the middle of the designed amplification primers. The quantitative PCR primers and probes were synthesized by Sangon Biotech Co., Ltd. A total of 4 pairs of upstream and downstream primers and probe combinations were designed for each candidate target gene, resulting in a total of 16 sets of probes and corresponding different primer pairs. The designed primer pairs were screened using positive and negative screening. The results are as Figures 1-4 shown, where Figure 1 A and 1B, Figure 2 A and 2B, Figure 3 A and 3B, Figure 4 A and 4B respectively correspond to the positive and negative screening results of the chuA, chuS, kpsMII, and kpsTII primer-probe combinations. Based on their amplification curves, those with small CT values, high relative fluorescence values, good-looking amplification curves, and normal negative CT values were selected. Two pairs of primer pairs for chuA, chuS, and kpsTII were obtained, and the sequences are shown in Table 1 below:

[0063] Table 1 Primer and probe sequences of candidate target genes

[0064]

[0065] Example 2: Preparation of plasmid standards corresponding to candidate target genes

[0066] (1) Selection of target fragments

[0067] Based on the sequencing results of the selected chuA, chuS, and kpsTII genes, a gene segment containing the amplification segment was selected as the target fragment.

[0068] The sequence of the target fragment containing the amplification segment of the chuA gene is as follows:

[0069] TTGGGCGAACTGAAAATCTGGATGGTATTGTGGCCTGGTCCAGTCGCGAT ① CGG ② GGTGATTTACG CCAGAGCAATGGTGAAACCGCGCCGAATGACGAGTCCATTAATAACAT GCTGGCGAAAGGGACCTGGCAA ③ ATT ④GATTCAGCCCAGTCTCTGAGCGGTTTAGTG CGTTACTACAACAACGACGC(SEQ ID NO:16), where the underlined part is the amplified segment, and the non-underlined parts are the upstream and downstream sequences of the amplified segment. Together, they form the target fragment sequence including the amplified segment mentioned in the text. ②-④ is the ChuAqF1R1 amplified segment, and ①-③ is the ChuAqF2R2 amplified segment

[0070] The target fragment sequence containing the amplified segment of the chuS gene is:

[0071] GCTGAAACCTGGGTAACCCGTAAACCTGCTAGTGACGGTTATGTGACCAG ① TCTG GAAT ② TGTTT GCCCATGATGGTACGCAGATAGCGCAACTTTATGGTCAACGTACAGAAG GCGAACAGGAGCAAGCGCAATGGCGT AAGCAAATTGCTTCGCTGATACCGG ③ A ④ AGG CGTTACTGCATAA(SEQ ID NO:17), where the underlined part is the amplified segment, and the non-underlined parts are the upstream and downstream sequences of the amplified segment. Together, they form the target fragment sequence including the amplified segment mentioned in the text. ②-④ is the ChuSqF1R1 amplified segment( TGTTTGCCCATGATGGTACGCAGATAGCGCAACTTTATGG TCAACGTACAGAAGGCGA ACAGGAGCAAGCGCAATGGCGTAAGCAAATTGCTTCGCTGATACCGGA , SEQ IDNO:18), and ①-③ is the ChuSqF2R2 amplified segment

[0072] The target fragment sequence containing the amplified segment of the kpsTII gene is:

[0073] CGAAGTCCTATCGCACGCCAACGGGTCGACATTATGTCTTTAAGGATTTA ① AACA ② TCGAAATCCC TTCAGGAAAAAGTGTCGCCTTTATTGGTCGCAACGGAGCGGGTAAAT CAACGTTACTGAGAATGATTGGCGGC ③ ATT ④ GACCGCCCCGACAGTGGAAAGATCAT CACTAATAAAACAATATCATGGCC(SEQ ID NO:19), where the underlined part is the amplified segment, and the non-underlined parts are the upstream and downstream sequences of the amplified segment. Together, they form the target fragment sequence including the amplified segment mentioned in the text. ②-③ is the KPSTIIqF1R1 amplified segment( TCGAAATCCCTTCAGGAAAAAGTGTCGCCT TTATTGGTCGCAACGGAGCGGGTAAAT CAACGTTACTGAGAATGATTGGCGGC , SEQ ID NO:20), and ①-④ is the KPSTIIqF2R2 amplified segment

[0074] (2) Synthesis of the target fragment

[0075] The target fragment was introduced into the standard plasmid pUC57 (Thermo Scientific) and sent to a biological company for gene synthesis to obtain the synthetic plasmid.

[0076] (3) Transformation

[0077] The synthetic plasmid was transferred into competent cells (ice bath for 30 min; heat shock at 42 °C for 90 s; ice bath for 2 min). The bacterial solution was transferred to LB medium without resistance and cultured with shaking at 37 °C and 220 rpm for 45 min. 50 μL of the bacterial solution was taken and evenly spread on an LB culture plate containing ampicillin, and cultured overnight at a constant temperature of 37 °C.

[0078] (4) Screening and identification of positive clones

[0079] Single clone colonies on the LB culture plate were picked and added to 5 mL of LB medium with ampicillin resistance, and cultured with shaking at 37 °C and 220 rpm for 12 h. The corresponding primers were used for bacterial liquid PCR verification (amplifying the corresponding target fragment), sequencing, and the plasmid was extracted using a plasmid DNA extraction kit for standby. The identified positive recombinant plasmids were named pUC57-chuA, pUC57-chuS, and pUC57-kpsTII. The plasmid concentrations were measured using a Nano-300 micro-spectrophotometer. The concentrations of the pUC57-chuA, pUC57-chuS, and pUC57-kpsTII recombinant plasmids were 55 ng / μL, 60 ng / μL, and 59 ng / μL respectively. The copy numbers of the recombinant plasmids were calculated to be 1.63×10^10 copies / μL, 1.78×10^10 copies / μL, and 1.75×10^10 copies / μL respectively through formula conversion, and they were used as plasmid standards.

[0080] The formula for calculating the copy number is as follows: Copy number = plasmid concentration × 6.02×10 23 / (660 × total plasmid length).

[0081] Example 3: Screening of candidate target genes and probe primer combinations using a single fluorescence quantitative PCR standard curve

[0082] The sample DNA was roughly extracted, and fluorescence quantitative PCR was performed using 2×Q3Probe qPCR Master Mix (Universal). The reaction system was 20 μL, including 7 μL of water, 10 μL of 2×Q3Probe qPCR Master Mix (Universal), 0.4 μL of each upstream and downstream primer, 0.2 μL of the probe, and 2 μL of template DNA. The fluorescence quantitative PCR reaction program was: 95 °C for 30 s; 95 °C for 10 s, 60 °C for 30 s, for 40 cycles.

[0083] Using the above system, the combinations screened in Example 1 include chuS①: chuSqF1\R1\P, chuS②: chuSqF2\R2\P, chuA①: chuAqF1\R1\P, chuA②: chuAqF1\R1\P, kpsTII①: kpsTIIqF1\R1\P, kpsTII②: kpsTIIqF2\R2\P, a total of six groups of primer-probe combinations for different target genes to be selected. Further evaluation and screening are carried out by plotting standard curves.

[0084] To plot the standard curve for singleplex fluorescence quantitative PCR amplification, the three plasmid standards in Example 3 were serially diluted 10-fold (taking 10 3 、10 4 、10 5 、10 6 、10 7 、10 8 copies / μL, 6 dilution degrees) as templates, and fluorescence quantitative PCR reactions were performed using a QuantStudio6 real-time fluorescence quantitative PCR instrument to obtain amplification curves. Taking the logarithm of the template concentration as the abscissa and the Ct value as the ordinate, a standard curve was made, and its correlation coefficient R 2 were respectively: 0.9949 (chuS①), 0.9958 (chuS②), 0.9986 (chuA①), 0.9986 (chuA②), 0.9971 (kpsTII①), 0.9902 (kpsTII②). The above six combinations all have good linear relationships and meet the requirements of the standard curve (R 2 > 0.99). The established standard curves are as Figures 5-10 shown, where Figure 5 A and 5B, Figure 6 A and 6B, Figure 7 A and 7B, Figure 8 A and 8B, Figure 9 A and 9B, Figure 10 A and 10B respectively correspond to the amplification curves and standard curves of chuS①, chuS②, chuA①, chuA②, kpsTII① and kpsTII②. The above standard curves, that is, the linear equations of the logarithm of the copy number (x) and the Ct value (y) are as follows:

[0085] chuS①: Y = -3.279*X + 41.63, R 2 = 0.9949, eff% = 101.8%

[0086] chuS②: Y = -2.951*X + 37.75, R2 = 0.9958, eff% = 118.2%

[0087] chuA①: Y = -3.553*X + 44.16, R 2 = 0.9986, eff% = 91.2%

[0088] chuA②: Y = -3.041*X + 38.48, R2 = 0.9886, eff% = 113.2%

[0089] kpsTII①: Y = -3.275*X + 44.03, R2 = 0.9971, eff% = 102.0%

[0090] kpsTII②: Y = -3.406*X + 42.60, R2 = 0.9902, eff% = 96.6%

[0091] Based on the primer amplification efficiency (optimal 90%-110%) and the standard curve R 2 (>0.99) and other results, three primer-probe combinations of chuS①, chuA①, and kpsTII① were finally selected and applied in Example 4.

[0092] Example 4: Screening of candidate target genes and probe primer combinations using a dual fluorescence quantitative PCR standard curve

[0093] Perform fluorescence quantitative PCR using 2×Q3Probe qPCR Master Mix (Universal). The reaction system is 20 μL, including 6.5 μL of water, 10 μL of 2×Q3Probe qPCR Master Mix (Universal), 0.4 μL each of chuSqF and chuSqR, 0.2 μL of chuSqP, 0.2 μL each of kpsTIIqF and kpsTIIqR, 0.1 μL of kpsTIIqP, and 2 μL of template. The dual fluorescence quantitative PCR reaction program is: 95°C for 30 s, 95°C for 10 s, 60°C for 30 s, for 40 cycles.

[0094] In Example 3, three sets of candidate target gene primer-probe combinations were screened. According to the combination of chu gene cluster genes and capsular synthesis gene cluster genes, there are two sets of dual fluorescence quantitative PCR probe primer combinations, namely chuS①kpsTII① and chuA①kpsTII①

[0095] To draw the standard curve for dual fluorescence quantitative PCR amplification, the two prepared plasmid standards were diluted in a 10-fold gradient. Take the concentration range of 10 8 -10 3 copies / μL and then perform fluorescence quantitative PCR amplification respectively. Plot the standard curve of fluorescence quantitative PCR with the logarithm of the copy number as the abscissa and the Ct value as the ordinate. The results are as Figure 11 and12 As shown, where Figure 11 A and 11B are the amplification curves and standard curves of the combined chuS①kpsTII① Figure 12 A and 12B are the amplification curves and standard curves of the combined chuA①kpsTII①. The linear equations of the logarithm of the copy number (x) and the Ct value (y) are as follows:

[0096] Combined chuS①kpsTII①

[0097] chuS①: Y = -3.328*X + 42.43, R2 = 0.9958, eff% = 99.7%

[0098] kpsTII①: Y = -3.148*X + 41.38, R2 = 0.9943, eff% = 107.8%

[0099] Combined chuA①kpsTII①

[0100] chuA①: Y = -3.716*X + 44.45, R2 = 0.9990, eff% = 85.8%

[0101] kpsTII①: Y = -3.475*X + 42.70, R2 = 0.9987, eff% = 94.0%

[0102] As can be seen from the above, the amplification efficiency of the standard products constructed by the combined chuS①kpsTII① within the range of 10 8 -10 3 copies / μL is greater than 99% and less than 110%, and the correlation coefficient R 2 is above 0.99, indicating that there is a good linear relationship between the logarithm of the number of standard plasmid templates and the Ct value, and it has a good amplification efficiency. However, the amplification efficiency of the combined chuA①kpsTII① is poor, and the amplification efficiency of chuA① is less than 90%. According to the principle of optimization, the combined chuS①kpsTII① will be used in the subsequent examples.

[0103] Obtained after screening, that is, the primer-probe group of the target gene adopted in the present invention, and its basic information is shown in the following table.

[0104] Table 2 Basic Information of Primer-Probe of Target Gene

[0105]

[0106] The primers and probes used in the subsequent examples are all the primers and probes shown in Table 2.

[0107] Example 5: Sensitivity Test

[0108] The plasmid standard was serially diluted 10-fold and subjected to duplex fluorescence quantitative PCR. The lowest detection limit was 10 copies / μL. This indicates that the duplex fluorescence quantitative PCR constructed with the chuS and kpsTII genes has high sensitivity, and the amplification curves are as shown in Figure 13 shown, where NC is the negative control of deionized water.

[0109] The chuS-positive and kpsTII-positive Escherichia coli cultures were serially diluted 10-fold and subjected to duplex fluorescence quantitative PCR. The lowest detection limits for chuS and kpsTII were both 10 2 CFU / mL.

[0110] Example 6: Specificity test

[0111] Intraspecies specificity: chuS-positive and kpsTII-positive Escherichia coli were used as the positive controls of virulent strains, and three different virulence Escherichia coli strains with chuS-negative and kpsTII-positive, chuS-positive and kpsTII-negative, and chuS-negative and kpsTII-negative were used. Water was used as the negative control. The specific Escherichia coli strains selected are shown in Table 3.

[0112] Table 3 Basic information of selected intraspecies specificity strains

[0113]

[0114] + indicates positive, - indicates negative

[0115] The DNA of the selected strains was extracted and used as the template for fluorescence quantitative PCR. According to the established optimal reaction conditions, fluorescence quantitative PCR amplification was performed. The results are as shown in Figure 14 shown, Figure 14 A shows the detection of chuS, Figure 14 B shows the detection of kpsTII. 1-8 correspond to PE008, PE098, FTEC11, FTEC79, SXE21, U90, K12 in Table 3 and deionized water respectively. From the amplification curves, it can be seen that the virulent strains positive for chuS and kpsTII can both detect their respective corresponding amplification curves, while the strains negative for the corresponding genes and the negative control did not show the corresponding amplification curves. This indicates that this method has good intraspecies specificity.

[0116] Interspecies specificity: chuS-positive and kpsTII-positive Escherichia coli were used as the positive controls of virulent strains, and Salmonella, Pasteurella, Klebsiella pneumoniae, Clostridium perfringens, Streptococcus suis, and deionized water were used as the negative controls. The crudely extracted DNA was used as the template for fluorescence quantitative PCR. According to the established optimal reaction conditions, fluorescence quantitative PCR amplification was performed. The results are as shown in Figure 15As shown, amplification curves corresponding to the chuS and kpsTII genes were detected in Sample 1 representing chuS-positive and kpsTII-positive Escherichia coli, while no amplification curves appeared in other pathogens and the negative control, indicating that this method has good interspecies specificity.

[0117] Example 7: Repeatability test

[0118] The chuS and kpsTII recombinant plasmids were respectively diluted by 10-fold gradients and mixed in equal proportions. Four concentration gradients (final concentrations were 10 6 copies / μL, 10 5 copies / μL, 10 4 copies / μL, 10 3 copies / μL) of the standard plasmid mixture were taken, and deionized water was set as the negative control. The established fluorescence quantitative PCR method was used to repeat the detection 3 times for the within-group repeatability test; the between-group repeatability test was carried out on the same concentration of standards diluted at different time periods 3 times, and the test results were statistically analyzed to evaluate the repeatability of this method. The results are shown in Table 4. It can be seen from Table 4 that the within-group coefficient of variation is less than 2%, and the between-group coefficient of variation is less than 4%, indicating that the multiplex fluorescence quantitative detection method established by the present invention has good repeatability.

[0119] Table 3 Results of repeatability test

[0120]

[0121] Example 8: Comparison of sensitivity with conventional PCR

[0122] Using the bacterial solution of a highly virulent strain of porcine Escherichia coli that is positive for both the chuS and kpsTII genes as a positive control, it was serially diluted to a concentration of 10 8 -10 2 CFU / ml. The chuS and kpsTII genes were detected by the conventional PCR method. As Figure 16 can be seen, the conventional PCR for the chuS and kpsTII genes can detect a minimum of 10 4 CFU / ml. The sensitivity of fluorescence quantitative PCR is about 100 times higher than that of the conventional PCR method.

[0123] Example 9: Detection and virulence assessment of clinically isolated strains

[0124] Using the qPCR detection method described above, 313 strains of porcine Escherichia coli isolated in the laboratory were detected. The results showed (Table 5) that 19 strains were positive for both chuS and kpsTII, accounting for 6.07%; 136 strains were double-negative, accounting for 43.45%; and 158 strains were positive for one of them, accounting for 50.48%.

[0125] Table 4 Results Table of Clinically Isolated Strains

[0126]

[0127] According to the above grouping situation, representative strains of each group were screened for evaluation in a mouse intraperitoneal infection model. Under the challenge dose of 1×10 8 CFU / mouse, the death situation of mice showed ( Figure 17 ), the lethality rate of chuS and kpsTII double-positive strains reached more than 80%; the lethality rate of chuS-positive and kpsTII-negative strains ranged from 20% to 40%; the lethality rate of chuS-negative and kpsTII-positive strains was below 20%; double-negative strains did not cause death of infected mice. The above results indicate that the porcine Escherichia coli can be classified into highly virulent strains, moderately virulent strains, weakly virulent strains and avirulent strains using the qPCR detection method described, which is conducive to the rapid identification of pathogenic strains and guiding the formulation of clinical prevention and control strategies.

[0128] Example 10: Coincidence Rate between Clinical Sample Detection and Isolated Strain Detection

[0129] Using the clinical samples corresponding to the isolated strains in Example 9, nucleic acids were extracted using a Vazyme nucleic acid extractor and used as templates for dual fluorescence quantitative PCR. The detection results were as shown in Table 6 corresponding to those in Example 9.

[0130] Table 5 Results Table of Clinically Isolated Strains

[0131]

[0132] As can be seen from the above table, the coincidence rate of this method is above 96%, indicating that this method can be directly used for the evaluation of the presence of highly pathogenic strains in clinical samples.

[0133] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, rather than to limit them; although the present invention has been described in detail with reference to the foregoing embodiments, those of ordinary skill in the art should understand that they can still modify the technical solutions described in the foregoing embodiments, or perform equivalent replacements on some or all of the technical features; and these modifications or replacements do not make the essence of the corresponding technical solutions deviate from the scope of the technical solutions of the embodiments of the present invention.

Claims

1. A fluorescent quantitative PCR primer set and fluorescent probe for detecting pathogenic Escherichia coli from pigs, characterized in that: The fluorescent quantitative PCR primer set and fluorescent probe include forward and reverse primers and fluorescent probes designed for the chuS gene and the kpsTII gene, respectively, wherein the forward and reverse primers and fluorescent probe designed for the chuS gene specifically amplify and detect the gene fragment as shown in SEQ ID NO:18, and the forward and reverse primers and fluorescent probe designed for the kpsTII gene specifically amplify and detect the target fragment as shown in SEQ ID NO:

20.

2. The fluorescent quantitative PCR primer set and fluorescent probe according to claim 1, characterized in that: The 5'-3' sequence of the forward primer designed for the chuS gene is shown in SEQ ID NO.: 1, and The 5'-3' sequence of the reverse primer designed for the chuS gene is shown in SEQ ID NO.:

2. Alternatively, the sequence of the fluorescent probe designed for the chuS gene is: 5'-TGCTCCTGTTCGCCTTCTGTACGTT-3', the 3' end of the fluorescent probe is labeled with a fluorescent quenching group, and the 5' end is labeled with a fluorescent reporter group.

3. The fluorescent quantitative PCR primer set and fluorescent probe according to claim 1, characterized in that: The 5'-3' sequence of the forward primer designed for the kpsTII gene is shown in SEQ ID NO.: 4, and The 5'-3' sequence of the reverse primer designed for the kpsTII gene is shown in SEQ ID NO.:

5. Alternatively, the sequence of the fluorescent probe designed for the kpsTII gene is: 5'-TGATTTACCCGCTCCGTTGCGACCA-3', the 3' end of the fluorescent probe is labeled with a fluorescent quenching group, and the 5' end is labeled with a fluorescent reporter group.

4. The fluorescent quantitative PCR primer set and fluorescent probe according to claim 2 or 3, characterized in that: The 5'-end fluorescent reporter group of the fluorescent probe is selected from FAM, JOE, ROX, TET, TAMRA, HEX, VIC, CY3, CY5 or TexasRed; the 3'-end fluorescent quencher group of the fluorescent probe is selected from BHQ1, TAMRA, Eclipse, Dabcyl, LowaBlackTMRQ or LowaBlackTMFQ.

5. A kit for detecting pathogenic Escherichia coli from pigs, characterized in that: The method comprises the fluorescent quantitative PCR primer set and the fluorescent probe according to claims 1 to 4.

6. The kit according to claim 5, characterized in that The kit further comprises a positive plasmid standard, which is a recombinant plasmid into which a sequence comprising the amplified segment of the chuS gene of SEQ ID NO: 18 and a sequence comprising the amplified segment of the kpsTII gene of SEQ ID NO: 20 are introduced.

7. A method for detecting pathogenic Escherichia coli from pigs, characterized in that: The method comprises the following steps: (1) extracting DNA from the sample to be tested as a template; and (2) performing dual fluorescence quantitative PCR detection on the template using the fluorescence quantitative PCR primer set and the fluorescence probe according to any one of claims 1 to 4 or the kit according to claims 5 to 6.

Images