Nicotinamide ribose phosphate transferase mutant, genetically engineered bacterium and application thereof

Abstract

The invention relates to a nicotinamide ribose phosphate transferase mutant, a genetically engineered bacterium and application of the nicotinamide ribose phosphate transferase mutant and the genetically engineered bacterium. Compared with a wild enzyme strain NMN, the production capacity of a mutant enzyme strain is greatly improved. The saccharomyces cerevisiae genetically engineered bacterium capable of stably inheriting and efficiently synthesizing the NMN is obtained, and safe, efficient and green synthesis of the NMN is achieved.

Description

Technical Field

[0001] The present invention belongs to the field of biotechnology, and particularly relates to a nicotinamide phosphoribosyltransferase mutant, a genetically engineered bacterium and their applications. Background Art

[0002] Nicotinamide mononucleotide is a naturally occurring bioactive nucleotide, which consists of three parts: ribose, nicotinamide group and phosphate group. It has two isomers, α and β, and the β isomer is the active form of NMN (hereinafter, β-NMN is abbreviated as NMN), with a molecular weight of 334.221 g / mol. NMN naturally exists in a variety of vegetables, fruits, meats, and shrimps in daily diet.

[0003] It is reported that NMN can improve various symptoms, and it mainly exerts its function by mediating the biosynthesis of NAD + , mainly including regulating cell metabolism and energy production, reducing apoptosis, and maintaining the redox state. Recent studies have shown that supplementing NMN has good therapeutic effects on chronic inflammation, retinal damage, cardiovascular diseases, inhibiting the production of melanin by senescent melanocytes, etc. Therefore, as a promising nutritional supplement, NMN is receiving extensive attention.

[0004] The earliest synthesis of NMN used chemical synthesis methods. Due to the pollution of the environment caused by various chemical reagents used, the difficulty of product separation, and the problems of chiral isomers, etc., the large-scale production of NMN is restricted. With the development of biocatalysis and enzyme engineering technologies, the biosynthesis of NMN has gradually become a hot topic. There are mainly two routes for the biosynthesis of NMN. The first is the nicotinamide substrate route, that is, NAM + PRPP is catalyzed by Nampt (rate-limiting enzyme) to generate NMN; the second is the nicotinamide riboside substrate route, that is, NR is catalyzed by NRK (present in most eukaryotes, including humans and yeast) to generate NMN. In this route, NR is relatively expensive as a precursor, and this reaction also requires ATP, with a high cost. In contrast, using the first synthesis path, that is, using the substrates NAM and glucose to indirectly supply the precursor PRPP has great potential. The method of directly using enzymes for in vitro catalysis to produce NMN is prone to problems such as enzyme inactivation, low conversion efficiency, and high costs. Therefore, more and more researchers are starting to combine the advantages of in vitro enzyme catalysis and in vivo fermentation. Currently, the most commonly used chassis strain for producing NMN is Escherichia coli. Although its growth cycle is short and large-scale high-yield production has been achieved, the endotoxins it produces limit the application scope of NMN in the fields of medicine, cosmetics, and food.

[0005] Nicotinamide phosphoribosyltransferase Nampt is a key enzyme in the NMN biosynthesis pathway. However, due to the limited catalytic efficiency of the natural enzyme, the large-scale production of NMN is restricted. To improve the NMN yield, many researchers have attempted to modify the enzyme molecular structure through semi-rational design to enhance the enzyme's catalytic activity. Summary of the Invention

[0006] The technical problem to be solved by the present invention is to provide a nicotinamide phosphoribosyltransferase mutant, a genetically engineered bacterium and their applications, particularly a recombinant Saccharomyces cerevisiae genetically engineered strain for the efficient production of nicotinamide mononucleotide NMN (β-NMN is abbreviated as NMN). The present invention proposes a Nampt mutant enzyme based on semi-rational design, combined with Saccharomyces cerevisiae codon optimization technology and metabolic engineering, to achieve the safe, efficient and green synthesis of nicotinamide mononucleotide NMN.

[0007] The present invention provides a nicotinamide phosphoribosyltransferase mutant, which is based on the amino acid sequence shown in SEQ NO.2 and includes amino acid mutations at positions 207 and / or 229.

[0008] Preferably, the aspartic acid Asp (D) at position 207 is mutated to glutamic acid Glu (E), and the isoleucine Ile (I) at position 229 is mutated to valine Val (V). The amino acid residue sequence of the nicotinamide phosphoribosyltransferase mutant is as shown in SEQ NO.1.

[0009] The present invention provides a nucleotide sequence encoding the nicotinamide phosphoribosyltransferase mutant, as shown in SEQ NO.3.

[0010] The present invention provides an expression vector containing the encoding gene.

[0011] The present invention provides a recombinant host bacterium containing the nicotinamide phosphoribosyltransferase mutant, the encoding gene or the expression vector, characterized in that the host bacterium includes one or more of Escherichia coli and Saccharomyces cerevisiae.

[0012] The present invention provides a genetically engineered bacterium, which includes a recombinant host bacterium of the encoding gene of the nicotinamide phosphoribosyltransferase mutant.

[0013] The host bacterium includes a wild-type host bacterium or a defective host bacterium;

[0014] The wild-type host bacteria include one or more of Escherichia coli and Saccharomyces cerevisiae, and Saccharomyces cerevisiae S.cerevisiae BY4741 (MATa his3Δ1 leu2Δ0 ura3Δ0 met15Δ0) is further preferred; the defective host bacteria include the wild-type host bacteria with the genes NMA1 and / or POF1 knocked out.

[0015] Knocking out the genes NMA1 and / or POF1 in the wild-type host bacteria means that the wild-type host bacteria knock out NMA1 and / or POF1 through the Cre-LoxP gene knockout method; the wild-type host bacteria include one or more of Escherichia coli and Saccharomyces cerevisiae, and Saccharomyces cerevisiae S.cerevisiae BY4741 (MATa his3Δ1 leu2Δ0 ura3Δ0 met15Δ0) is preferred.

[0016] Furthermore, the genetically engineered bacterium is Δ2-18S-NG D207E / I229V 。

[0017] The present invention provides a construction of a genetically engineered bacterium, which includes knocking out the genes NMA1 and / or POF1 in the host bacterium and integrating the mutant enzyme CpNampt described in claim 1 D207E / I229V into the multi-copy site of 18S rDNA of the host bacterium for induced expression.

[0018] Furthermore, it includes knocking out the genes NMA1 and / or POF1 related to the NMN downstream metabolic pathway in the host bacterium based on homologous recombination technology and molecular biology means, and integrating the mutant enzyme CpNampt D207E / I229V into the multi-copy site of 18S rDNA of the host bacterium for induced expression.

[0019] The present invention provides an application of the nicotinamide phosphoribosyltransferase mutant, the recombinant host bacterium or any of the genetically engineered bacteria in the production of NMN.

[0020] The present invention provides a preparation method of NMN, which includes: using any of the genetically engineered bacteria, and producing NMN by galactose-induced fermentation with raw materials containing glucose and nicotinamide.

[0021] Furthermore, the preparation method of NMN includes: culturing the genetically engineered bacterium to obtain a seed solution, then inoculating it into the YPD liquid medium at an inoculation amount of 1-2%, culturing it on a shaker at 28-32 °C for about 24-64 h, then washing it, and then resuspending the bacterial cells with a new YPG (galactose) medium and adding 3-5% of the nicotinamide substrate, and culturing it on a shaker at 28-32 °C for 12-24 h.

[0022] The culture of the seed solution includes: inoculating the genetically engineered bacterium from the solid plate into SD or SD-URA3- In the liquid medium, after culturing to the logarithmic growth phase, the strain culture solution is then inoculated into a new SD liquid medium to ensure that the initial OD of the bacterial solution 600 is 0.1 for all, and continue culturing for 8 - 16 h to obtain the seed solution.

[0023] Furthermore, every 100 mL of YPG medium contains: 2 g of tryptone, 1 g of yeast extract, 2 g of galactose, add water to 100 mL to dissolve, autoclave at 121 °C for 20 min;

[0024] Every 100 mL of YPD medium includes: 2 g of tryptone, 1 g of yeast extract, 2 g of glucose, add water to 100 mL to dissolve, autoclave at 121 °C for 20 min.

[0025] Every 100 mL of the SD liquid medium: 0.67 g of YNB, 0.124 g of DO Supplement (amino acid mixture), 2 g of glucose, add water to 100 mL, autoclave at 121 °C for 20 min.

[0026] For the Cre-LoxP gene knockout method of the present invention, the vectors used include pUG6 and pSH65, and the vector information is as Figures 1-2 shown.

[0027] Furthermore, the above pUG6 plasmid contains Kan r and the loxP-KanMX-loxP recombination cassette, which is mainly used for the amplification of gene knockout components. pSH65 contains Zeocin r , the Cre recombinase synthesis gene, which is mainly used for the excision of resistance genes to avoid gene contamination caused by residual resistance genes.

[0028] The exogenous gene expression vector includes pESC-URA. There is a GAL1 / 10 bidirectional inducible promoter on this plasmid, and galactose is needed to induce and activate gene expression.

[0029] For increasing the copy number of the exogenous gene, the present invention constructs an integrative vector pUC19-18S-U3, and the vector information is as Figure 4 shown. There is Saccharomyces cerevisiae 18S rDNA and URA3 yeast selection marker on this plasmid.

[0030] Furthermore, the acquisition of the gene includes chemical synthesis method and gene cloning method. The seamless cloning technology is used for the ligation of the gene and the vector, and the competent Escherichia coli DH5a is used for the transformation and screening of the recombinant vector.

[0031] For the construction of the key enzyme mutant, AutoDockVina was used to predict the binding site between the enzyme and the substrate, and reasonable mutations were made to the binding site. The prediction results are as Figures 6-7 shown.

[0032] In the present invention, on the premise of weakening the NMN downstream metabolic pathway, the copy number of the key enzyme Nampt was increased by using the Saccharomyces cerevisiae 18S rDNA sequence. The galactose-inducible promoter was used to more efficiently initiate the expression of foreign genes, and the catalytic pocket (the region for substrate binding and reaction) of the key enzyme was rationally semi-rationally designed and modified. Combining Saccharomyces cerevisiae codon optimization and metabolic engineering, NMN was fermented and produced from cheap raw materials such as glucose and nicotinamide, achieving the goal of green, efficient, safe and low-cost production of NMN.

[0033] Beneficial effects

[0034] The present invention combines homologous recombination and molecular docking techniques, and through molecular biological means, constructs the S.cerevisiaeΔ2-18S-NG D207E / I229V mutant strain, realizing the efficient and stable expression of the key enzyme Nampt, and the NMN yield of the mutant enzyme strain is 2 times that before mutation, which is about 7.93 times higher than that of the wild-type strain, further expanding the application prospect of Nampt enzyme in the efficient catalysis of NAM synthesis of NMN in Saccharomyces cerevisiae.

[0035] The present invention overcomes the problems in the prior art such as low catalytic activity of the key enzyme Nampt for NMN synthesis, low copy number of expression in the bacterial cells, genetic stability of the recombinant strain, and expensive and highly toxic raw materials for NMN production. Brief Description of the Drawings

[0036] Figure 1 It is the plasmid map of pUG6 for gene knockout in Example 1;

[0037] Figure 2 It is the plasmid map of pSH65 for resistance gene excision in Example 1;

[0038] Figure 3 It is the plasmid map of Nampt expression plasmid pESC-NG in Example 2;

[0039] Figure 4 It is the integrative plasmid pUC19-18S-U3 constructed by the present invention in Example 2;

[0040] Figure 5 It is the Nampt integrative plasmid pUC19-18S-NG constructed by the present invention in Example 2;

[0041] Figure 6Binding energy results of ligand small molecules with 9 different conformations obtained from molecular docking analysis in Example 3;

[0042] Figure 7 Pymol visualization of the docking result of the receptor protein and ligand in Example 3;

[0043] Figure 8 NMN standard curve in Example 4;

[0044] Figure 9 NMN production graph of the genetically engineered bacteria constructed in the present invention. Detailed implementation manners

[0045] The present invention will be further described below in conjunction with specific embodiments. It should be understood that these embodiments are only used to illustrate the present invention and not to limit the scope of the present invention. In addition, it should be understood that after reading the content taught by the present invention, those skilled in the art can make various changes or modifications to the present invention, and these equivalent forms also fall within the scope defined by the appended claims of this application.

[0046] Example 1

[0047] Weakening the NMN downstream metabolic pathway in Saccharomyces cerevisiae (control strain 1)

[0048] (1) Selection of genes to be knocked out

[0049] In Saccharomyces cerevisiae, NMN is synthesized into NAD under the action of nicotinamide mononucleotide adenylyltransferase (NMNAT), and the encoding genes of NMNAT include NMA1, NMA2, and POF1. NAD + , as an important coenzyme, its synthesis pathway cannot be completely knocked out, and the double deletion of NAM1 and NMA2 will cause the bacteria to die. Therefore, in order to weaken the further metabolism of the product NMN, this study selected to use the Cre-LoxP gene knockout system to knock out NMA1 and POF1. +

[0050] (2) Amplification of NMA1 and POF1 gene knockout components

[0051] When designing primers, directly select 50bp homologous arms upstream and downstream of the NMA1 gene and add them to both ends of the LoxP-KanMX-LoxP sequence on the pUG6 plasmid, and then directly amplify the gene knockout component using the pUG6 plasmid as a template. After purification and recovery, it is transformed into Saccharomyces cerevisiae BY4741 by the lithium acetate transformation method. After transformants grow on the resistance plate containing KanMX, pick several larger transformants for colony PCR verification, and the obtained strain is named Δ1. The knockout of the POF1 gene on the basis of Δ1 is the same, and the obtained strain is named Δ2. Among them, Δ1 (ΔNMA1); Δ2 (ΔNAM1:ΔPOF1).

[0052] The primer design is as follows:

[0053]

[0054] (3) Removal of KanMX resistance gene

[0055] During the experiment, multiple different genes need to be introduced. Therefore, before introducing the next gene after modifying one strain, the resistance marker needs to be deleted. In this experiment, the Cre-LoxP recombination system is used to achieve the knockout of the resistance gene. The LoxP sequence was discovered in bacteriophage P1. It consists of three components, namely two 13bp inverted repeat sequences and an 8bp spacer sequence in the middle. The direction of the LoxP site is determined by the 8bp sequence in the middle. The Cre recombinase can delete the gene fragment between the LoxP sites by binding to the LoxP site, thus achieving the inactivation of specific genes at specific times or in specific tissues.

[0056] The specific operation steps are as follows:

[0057] Transform the pSH65 plasmid into yeast cells containing the KanMX resistance gene by the lithium acetate method, coat it on a YPD solid plate containing 100 μg / mL Zeocin in the dark, and incubate it upside down at 30 °C in the dark for 2 - 3 days. Pick the larger colonies on the plate for colony PCR verification;

[0058] Inoculate the verified positive transformants into 5 mL of YPG liquid medium and culture for more than 12 h to allow sufficient time for Cre enzyme induced by galactose to excise the resistance gene;

[0059] Dilute the above YPG culture solution by 10 3 Then take 100 μL and coat it on a YPD plate, incubate it upside down at 30 °C for about 30 h. After the bacteria grow, pick a single colony and streak it on a YPD plate. After the bacteria grow again, streak it on a YPD plate containing G418. Incubate it upside down at 30 °C for about 24 h. The strain that cannot grow on the G418 plate but can grow on the YPD plate is the strain with the successful excision of the KanMX resistance gene, and perform colony PCR on it to further verify its correctness;

[0060] Inoculate the strain verified in the previous step into YPAD liquid medium and culture for 1 day to lose the plasmid pSH65. Then dilute the YPAD culture solution by 10 3Take 100 μL later and coat it on the YPD plate. Incubate it upside down at 30 °C for about 48 h. Pick a single colony and streak it on the YPD medium, and then streak it separately on the YPD solid plate containing Zeocin. The strain that does not grow on the Zeocin-resistant plate but can grow on the YPD plate without resistance is the strain with the loss of the pSH65 plasmid, and colony PCR is performed on it to further verify its correctness.

[0061] (4) According to the method of Example 4, the Δ1 / Δ2 strain obtained in step (3) was fermented and cultured, and samples were taken at 12 h / 24 h respectively to detect the intracellular NMN production. The results showed that the NMN content reached the peak at 24 h. Δ1 was about 14.46 mg / L, which was about 18.9% higher than that of the wild type (WT), and Δ2 was about 16.11 mg / L, which was 11.4% higher than that of Δ1.

[0062] Example 2

[0063] Introduction of the exogenous gene Nampt pathway (control bacterium 2)

[0064] (1) Selection of the Nampt gene

[0065] The researchers compared the expression of NAMPT from 10 mammalian and bacterial sources in Escherichia coli and found that the activity of NAMPT was related to its expression level. Among them, the NAMPT from Chitinophaga pinensis (abbreviated as CpNampt) had the highest expression level and the highest conversion efficiency of the substrate nicotinamide. CpNampt is also one of the most studied proteins for NMN synthesis, so it was subsequently integrated into the exogenous expression of the Saccharomyces cerevisiae genome to increase NMN production.

[0066] (2) Optimization of the CpNampt gene codons

[0067] The protein sequence of Nampt[Chitinophaga pinensis](NCBI Reference Sequence: WP_012788281.1) was found in the NCBI database, and then it was handed over to General Biology (Anhui) Co., Ltd. for yeast-preferred codon optimization and gene synthesis, and then directly constructed onto the pESC-URA expression plasmid. This plasmid was named pESC-NG. The gene coding sequence of the unmodified wild enzyme CpNampt protein (SEQ NO.2) was optimized according to the yeast codon usage preference, and the optimized nucleic acid sequence was SEQ NO.3.

[0068] (3) Construction of the CpNampt gene-integrated expression vector

[0069] First, according to the 18S rRNA sequence of S. cerevisiae (NCBI Accession: 6SNT—2) found in the NCBI database and the pUC19 plasmid sequence, the 1000bp 18S rDNA (as shown in SEQ NO.23) homologous arms were ligated to the linearized pUC19 vector (double digested with Hind III and EcoR I) using seamless cloning technology to construct the pUC19-18S recombinant plasmid. The primer design is as follows:

[0070] Primer name Primer sequence (5'-3') Length (bp) 18S-F gaccatgattacgccaagcttGGTTGATCCTGCCAGTAGTCAT 43 SEQ NO.9 18S-R aaaacgacggccagtgaattcAGACTACGACGGTATCTGATCATCTT 47 SEQ NO.10

[0071] The above constructed pUC19-18S plasmid was linearized, and the URA3 selection marker was inserted into the middle of the 18S rDNA sequence using seamless cloning technology to construct pUC19-18S-U3. The primer design is as follows,

[0072] Primer name Primer sequence (5'-3') Length (bp) 18S-FX-F AATGGGCCCTGTATCGTTAT 20 SEQ NO.11 18S-FX-R CGGGTCTTGTAATTGGAATG 20 SEQ NO.12 URA3-F ATAACGATACAGGGCCCATTgcaccataccac 32 SEQ NO.13 URA3-R CATTCCAATTACAAGACCCGttagttttgctggccgc 37 SEQ NO.14

[0073] Using the above constructed plasmid pUC19-18S-U3 as a template and 18S-U3-FX-F / R as primers to linearize the plasmid, and using pESC-NG as a template and NG-F / R as primers, the P Gal10 -Nampt fragment was amplified. After amplification, the PCR product was subjected to agarose gel electrophoresis, and the target band at the correct position was excised and recovered. Finally, the fragment was ligated to the linearized vector using seamless cloning technology to obtain the CpNampt gene-integrated expression plasmid (pUC19-18S-NG). The primer sequences are as follows

[0074] Primer name Primer sequence (5'-3') Length (bp) 18S-U3-FX-F tttggttagttttgctggcc 20 SEQ NO.15 18S-U3-FX-R CGGGTCTTGTAATTGGAATG 20 SEQ NO.16 NG-F ccagcaaaactaaccaaacggggttttttctccttgacgt 40 SEQ NO.17 NG-R ATTCCAATTACAAGACCCGgaattggagcgacctcatgct 40 SEQ NO.18

[0075] (4) Construction of the heterologous expression CpNampt gene engineering strain

[0076] Using the above constructed pUC19-18S-NG plasmid as a template, the 18S-URA3-P Gal10 -Nampt fragment was amplified and transformed into yeast (Δ2(ΔNAM1:ΔPOF1)) by the lithium acetate method to make it homologous recombine to the 18S rDNA locus (locus number rDNA-18S-FX-F / 18S-FX-R). The transformation steps are as follows:

[0077] The yeast strain was activated overnight in YPD medium; pre-chilled sterile water; take 5 mL of fresh medium and inoculate the activated yeast cells into it; adjust the shaker to 30 °C and 160 rpm and culture for 4 h to make its OD 600The value is approximately equal to 0.5. Centrifuge at 8000 rpm for 2 min at 4°C to collect the bacterial cells; wash the bacterial cells with 1 mL of sterile water, centrifuge at 8000 rpm for 2 min at 4°C to collect the Saccharomyces cerevisiae cells (this step needs to be repeated once); resuspend the cells with 1 mL of 0.1 M LiAc, place at room temperature for 3 min, then place on ice for 2 min, centrifuge at 6000 rpm for 3 min at 4°C, and discard the supernatant; sequentially add 60 μL of 50% PEG3350 solution, 9 μL of 1 M LiAc solution, 5 μL of ssDNA solution, and 7 μL of the DNA fragment to be transformed, and mix well; adjust the incubator to 30°C, place the above mixture in it and incubate for 30 min, shaking once every 10 min; add 7 μL of DMSO and mix well, heat shock in a 42°C water bath for 13 - 15 min; centrifuge at 6000 rpm for 3 min, discard the supernatant; wash once with 1 mL of sterile water; add 1 mL of YPD liquid medium, and culture with shaking at 30°C and 160 rpm for 1.5 h; centrifuge at 6000 rpm for 3 min, discard the excess medium, and wash once with sterile water; add 50 μL of sterile water and mix evenly, then spread on the URA3 - deficient medium SD - URA3 - and incubate it upside down in a 30°C constant - temperature incubator for 2 - 3 days.

[0078] Pick the single colonies grown on the screening plate for colony PCR verification. If the verification is positive, the final genetically engineered strain S.cerevisiaeΔ2 - 18S - NG can be obtained.

[0079] According to the method of Example 4, ferment and culture the Δ2 - 18S - NG strain obtained in the above step (4), and sample and detect the intracellular NMN production at 12 h / 24 h respectively. CpNampt was introduced into the Δ2 - 18S - NG strain based on the Δ2 strain. Comparing the highest concentrations reached by these two strains after 24 h of fermentation, Δ2 - 18S - NG is about 52.97 mg / L, with a 229% increase in production compared to the control strain 1 (Δ2), which is 3.29 times that of the control strain 1 (Δ2) and also 4.36 times that of the wild - type yeast strain (WT).

[0080] Example 3

[0081] Design and construction of the key enzyme molecule Nampt mutant

[0082] In order to further enhance the binding ability of Nampt to the substrate NAM, it was decided to modify the NMN synthase Nampt by semi - rational design.

[0083] Use AutoDockVina to predict the binding site of the enzyme and the substrate. The specific operation steps are as follows:

[0084] (1) Prepare the structure files of the receptor (enzyme) and ligand (substrate).

[0085] Receptor (enzyme) preparation: Search for the amino acid sequence of the CpNampt protein (accession number A0A5C6M000) in the UniProt database (https: / / www.uniprot.org), predict the tertiary structure of the protein using Alphafold3 (https: / / alphafoldserver.com / ), and download the prediction results. The predicted protein tertiary structure on this website is in cif format. Then continue to use the Open Babel GUI software to convert its format to pdb format for subsequent docking. Then open the pdb file of the protein in AutoDock Vina, perform dehydration and hydrogenation operations on the receptor protein molecule, select it as the receptor protein for docking, and finally save it in pdbqt file format.

[0086] Ligand (substrate) preparation: Download the 3D structure (sdf format) of the substrate NAM from the PubChem database (https: / / pubchem.ncbi.nlm.nih.gov), convert it to mol2 format using the Open Babel GUI software, then open the mol2 format file in AutoDock Vina, perform hydrogenation operations on it, select it as the ligand, detect the torsion centers and torsion bonds, and save it as a pdbqt file.

[0087] (2) Set the docking parameters: Open the pdbqt files of the receptor protein and ligand (substrate) saved in step (1) in AutoDock Vina, set the size of the Gird Box so that the box encloses the entire protein molecule, and drag out the ligand. After setting the docking parameters, save them.

[0088] (3) Configure and run AutoDock Vina.

[0089] Create a configuration file, open Dcoking-Vina Config, and obtain Config.txt.

[0090] In AutoDock Vina, click Run - Run AutoDock Vina, import the Config.txt obtained in the previous step, and click Launch to perform the docking run.

[0091] (4) Analyze the docking results: Binding affinity evaluation: Nine different molecular conformations can be obtained from step (3). Sort the binding energies from low to high (unit: kcal / mol, the lower the negative value, the stronger the binding), as Figure 6As shown, the results are output in pdbqt format. (5) Output the small molecule (ligand) with the lowest binding energy conformation

[0092] Open AutoDock Vina, Analyze - Dcokings - Open AutoDock Vina result, open the pdbqt file obtained in step (4). The interface shows the molecular conformation with the lowest binding energy. Click File - Save - Write PDB to obtain the pdb file of the molecular conformation with the lowest binding energy.

[0093] (6) Output of the receptor protein and ligand small molecule complex: Open the pdb files of the receptor protein and the ligand small molecule obtained in step (5) simultaneously with Pymol, and output them as the pdb file of the receptor protein and ligand small molecule complex, saved as complex.pdb.

[0094] (7) Visualize the binding site with Pymol: Open complex.pdb generated in step (6) in Pymol. Select the small molecule, right - click, Action - find - polar contacts - to other atoms in object to display the hydrogen bonds. Select the protein, show - sticks to display all amino acid residues of the protein. Then select all amino acid residues connected to the hydrogen bonds and label them, and hide the sticks of other amino acid residues. Then display the hydrogen bond length and the names of the amino acid residues connected to the hydrogen bonds.

[0095] Through the above steps, AutoDock Vina can efficiently perform semi - flexible docking on the receptor protein and ligand (substrate), and accurately predict the binding site between the enzyme and the substrate. According to the docking results Figure 7 it can be seen that there are 3 active sites for the enzyme CpNampt to act with the substrate NAM, namely ASN - 179, ASP - 207, and ILE - 229.

[0096] Combined with literature review and software analysis, in order to further expand the interaction range between the enzyme and the substrate and reduce the influence of steric hindrance on substrate binding, it was decided to mutate Asp (D) at position 207 of CpNampt to Glu (E), and Ile (I) at position 229 to Val (V), and construct CpNampt D207E / I229V mutant enzyme (the amino acid sequence refers to SEQ NO.1, and the gene coding sequence refers to SEQ NO.3). The construction method of the related genetically engineered bacterium (Δ2 - 18S - NG D207E / I229V ) is as follows:

[0097] The pUC19-18S-NG plasmid constructed in Example 2 was mutated using site-directed mutagenesis technology. First, using the pUC19-18S-NG plasmid as a template and D207E-F / R as primers, the aspartic acid Asp (D) at position 207 on CPNampt was mutated to glutamic acid Glu (E) to obtain pUC19-18S-NG D207E ; then, using pUC19-18S-NG D207E plasmid as a template and I229V-F / R as primers, the isoleucine Ile (I) at position 229 on CPNampt was mutated to valine Val (V) to obtain pUC19-18S-NG D207E / I229V . The primer sequences used for mutagenesis are as follows:

[0098]

[0099] Using the pUC19-18S-NG D207E / I229V plasmid obtained above as a template, the 18S-URA3-P Gal10 -Nampt D207E / I229V fragment was amplified and transformed into Δ2(ΔNAM1:ΔPOF1) by the lithium acetate method to allow it to homologously recombine to the 18S rDNA locus (locus number rDNA-18S-FX-F / 18S-FX-R). The strain with positive colony PCR verification was named Δ2-18S-NG D207E / I229V .

[0100] The mutant strain was fermented and cultured according to the method of Example 4, and the intracellular NMN production was detected. The results showed that the NMN production of the strain with the mutant enzyme (Δ2-18S-NG D207E / I229V ) was as high as 108.66 mg / L, which was 105% higher than that of the control strain 2 (Δ2-18S-NG), 2.05 times that of the strain expressing the wild enzyme (Δ2-18S-NG), and also 8.9 times that of the wild-type strain (WT).

[0101] Example 4

[0102] Fermentation production of NMN by recombinant genetic engineering strains

[0103] (1) Fermentation method of yeast strains

[0104] Each wild-type and modified strain was inoculated from the solid plate into 5 mL of SD liquid medium (Note: Strains introduced with the URA3 selection marker should be cultured in SD-URA3 - medium). After culturing for about 12 h to reach the logarithmic growth phase, the culture solutions of each strain were then inoculated into fresh SD liquid medium to ensure that the initial OD of each bacterial solution 600All are 0.1. Continue culturing for 12 h to obtain the seed culture. Then inoculate it into a 250 mL conical flask containing 50 mL of YPD liquid medium at an inoculation amount of 1%, and culture it on a shaker at 30 °C for about 48 h. Then wash the cells twice with sterile water to ensure thorough washing of the YPD medium. After that, resuspend the cells with a new YPG (galactose) medium of the same volume, and additionally add 5% nicotinamide substrate, and culture it on a shaker at 30 °C for 12 - 24 h. Among them, the seed cultures of the three strains WT, Δ1 (ΔNMA1), and Δ2 (ΔNMA1:ΔPOF1) are cultured in SD liquid medium; the seed cultures of the two strains Δ2-18S-NG and ΔΔ2-18S-NGD207E / I229V are cultured in SD-Ura - liquid medium.

[0105] Among them, SD liquid medium (100 mL): 0.67 g of YNB, 0.124 g of DO Supplement (amino acid mixture), 2 g of glucose, add water to 100 mL, and sterilize at 121 °C for 20 min by high-temperature high-pressure sterilization.

[0106] SD-URA3 - SD-Ura liquid medium (100 mL): 0.67 g of YNB, 0.124 g of DO Supplement-Ura (amino acid mixture without Ura), 2 g of glucose, add water to 100 mL, and sterilize at 121 °C for 20 min by high-temperature high-pressure sterilization.

[0107] (2) Extraction of metabolite NMN in the fermentation broth

[0108] Take the fermentation broth from the above step (1), centrifuge to obtain the cells. Pre-cool all the items required for liquid nitrogen grinding with liquid nitrogen in advance. Transfer the cells to a mortar, add liquid nitrogen, grind vigorously with the mortar, and then add liquid nitrogen again for grinding until it becomes powdery. Then transfer the yeast powder to a centrifuge tube and dissolve it with an appropriate amount of ultrapure water for NMN content determination.

[0109] (3) Detection of the concentration of nicotinamide mononucleotide NMN by fluorescence method

[0110] Mix 25 μL of the sample, 10 μL of DMSO solution containing 20% acetophenone, and 10 μL of 2 M KOH. Incubate on ice for 2 min, then add 45 μL of 88% formic acid, and incubate at 37 °C for 10 min. Transfer the sample to a black 96-well plate, and centrifuge briefly at 4 °C in a centrifuge to remove air bubbles. Measure the fluorescence intensity using a microplate reader at an excitation wavelength of 382 nm and an emission wavelength of 445 nm. The method for preparing the standard curve for the detection of nicotinamide mononucleotide concentration is as follows:

[0111] Take 0.8 mg of NMN standard and dissolve it in 10 mL of deionized water to obtain an NMN standard sample with a concentration of 80 mg / L. Respectively take 125 μL, 250 μL, 375 μL, 500 μL, 625 μL, 750 μL, and 875 μL of this sample, and then sequentially add 875 μL, 750 μL, 625 μL, 500 μL, 375 μL, 250 μL, and 125 μL of deionized water for dilution to obtain NMN standard samples with concentrations of 10 mg / L, 20 mg / L, 30 mg / L, 40 mg / L, 50 mg / L, 60 mg / L, and 70 mg / L. Then take 25 μL of the standard sample and measure the fluorescence value of the sample according to the above detection method and record the data.

[0112] As Figure 8 shown, for the standard curve of NMN, with the fluorescence value of the sample as the ordinate and the NMN concentration (unit: mg / L) as the abscissa, the linear regression equation y = 6184705x – 5970304 (R 2 = 0.9833) can be obtained, indicating that the linear relationship of NMN concentration is good in the range of 10 - 80 mg / L.

Claims

1. A nicotinamide phosphoribosyltransferase mutant, characterized in that: The mutant is based on the amino acid sequence shown in SEQ NO.2, including amino acid mutations at position 207 and / or position 229.

2. The nicotinamide phosphoribosyltransferase mutant according to claim 1, characterized in that: The aspartic acid Asp at position 207 is mutated to glutamic acid Glu, and the isoleucine Ile at position 229 is mutated to valine Val.

3. A nucleotide sequence encoding the nicotinamide phosphoribosyltransferase mutant according to claim 1, as shown in SEQ NO.

3.

4. An expression vector containing the encoding nucleotide sequence of claim 3.

5. A recombinant host bacteria containing the nicotinamide phosphoribosyltransferase mutant according to claim 1, the encoding nucleic acid according to claim 3 or the expression vector according to claim 4, characterized in that: The host bacteria include one or more of Escherichia coli and Saccharomyces cerevisiae.

6. A genetically engineered bacterium, characterized in that: The genetically engineered bacteria include a recombinant host bacteria containing the gene encoding the nicotinamide phosphoribosyltransferase mutant according to claim 1.

7. The genetically engineered bacteria according to claim 6, characterized in that: The host bacteria include wild-type host bacteria or defective host bacteria; The wild-type host bacteria include one or more of Escherichia coli and Saccharomyces cerevisiae; and the defective host bacteria include a wild-type host bacteria with knocked-out genes NMA1 and / or POF1.

8. The genetically engineered bacteria according to claim 7, characterized in that: The wild-type host bacteria knock out genes NMA1 and / or POF1 by using the Cre-LoxP gene knockout method to knock out NMA1 and / or POF1; wherein the wild-type host bacteria include one or more of Escherichia coli and Saccharomyces cerevisiae.

9. Construction of a genetically engineered bacterium, comprising: The gene NMA1 and / or POF1 in the host bacteria is knocked out, and the mutant enzyme CpNampt D207E / I229V Integrate into the host bacteria 18S rDNA multi-copy site to induce expression.

10. Use of the nicotinamide phosphoribosyltransferase mutant according to any one of claims 1-2, the recombinant host bacteria according to claim 5, or the genetically engineered bacteria according to any one of claims 6-8 in producing NMN.

11. A method for preparing NMN, comprising: The genetically engineered bacteria according to any one of claims 6 to 8 are used to produce NMN by galactose-induced fermentation using raw materials containing glucose and nicotinamide.

Images