Procambarus clarkii anti-disease gene PcL-Lec and SNP haplotype KASP marker and application thereof

Abstract

The invention belongs to the technical field of molecular markers of aquatic animals, and particularly relates to a procambarus clarkia disease-resistant gene PcL-Lec and an SNP haplotype KASP marker and application thereof. The SNP genotype of PcL-Lec is detected through a KASP method, the distribution situation of the SNP genotype in the three types of subgroups is calculated, and SNP haplotypes which are distributed less in susceptible subgroups and more in high-disease-resistance subgroups are found. The invention aims to screen out a disease-resistant gene associated with antibacterial or antiviral characters, explore SNPs, identify haplotype disease resistance of the SNPs, and verify that the PcL-Lec gene regulates and controls downstream immune gene expression through a C-type lectin receptor signal channel, a PI3K / Akt channel and the like through an RNA interference experiment. The KASP marker can efficiently screen disease-resistant dominant haplotypes, and provides technical support for procambarus clarkia disease-resistant molecular breeding.

Description

Technical Field

[0001] The present invention relates to the technical field of molecular marker technology for aquaculture, and specifically relates to a disease-resistant gene PcL-Lec of Procambarus clarkii, its SNP haplotype KASP marker, and applications. The present invention is applicable to molecular-assisted breeding of disease-resistant varieties of Procambarus clarkii. Background Art

[0002] Procambarus clarkii (scientific name: Procambarus clarkii), is an arthropod of the genus Procambarus in the family Cambaridae, commonly known as crayfish or freshwater lobster, and is one of the important freshwater aquaculture varieties in China. According to the Report on the Development of the Chinese Crayfish Industry (2024), in 2023, the aquaculture area of Chinese crayfish reached 29.5 million mu, with a total output of 3.161 million tons, ranking fourth among freshwater aquaculture varieties in China. The crayfish industry has developed rapidly, and the aquaculture density has increased. Its intensive aquaculture will lead to frequent diseases, and diseases caused by viruses and bacteria in Procambarus clarkii seriously hinder the development of the crayfish aquaculture industry. At present, many researchers have carried out research on the pathogens causing diseases in Procambarus clarkii. In terms of viral pathogens, WSSV is the virus that causes the most serious disease conditions in crustaceans, with characteristics such as acute onset, rapid death rate, and high mortality. WSSV is widely distributed in various organs of crayfish, such as hemolymph, hepatopancreas, heart, gills, muscles, appendages, etc. When the water temperature is 20-28°C, it can replicate rapidly and in large quantities in the shrimp body, and will cause large-scale death of Procambarus clarkii when conditions are suitable; while in the early stage of bacterial diseases, death generally occurs less frequently and is not easily detected, but in the late stage of infection, the pathogen spreads extremely fast, causing serious losses to the production of Procambarus clarkii. Commonly isolated bacteria from crayfish usually include Vibrio parahaemolyticus, Aeromonas hydrophila, etc. At present, Vibrio parahaemolyticus has been isolated and identified from the hepatopancreas of diseased shrimp.

[0003] Like other crustaceans, Procambarus clarkii lacks mature T lymphocytes and mature B lymphocytes in its body and is unable to exert the function of the acquired immune system. It mainly relies on the innate immune system to fight against pathogen invasion. When a pathogen breaks through the physical barrier, pathogen-associated molecular patterns (PAMPs) specifically bind to pattern recognition receptors (PRRs) in the host body. The invading pathogen is recognized by immune cells in the host body, and then the signal cascade inside the immune cells responds rapidly, ultimately activating the host's humoral immune response and cellular immune response. Humoral immunity is jointly mediated by various non-specific enzymes, lectins, hemolysins and other immunologically active immune factors in hemolymph. Among them, the immune responses involving the prophenoloxidase system, complement system proteins, lectins and antimicrobial peptides play important roles. In recent years, research on PRRs in Procambarus clarkii has mainly focused on the functions of Toll-like receptors (TLRs), C-type lectins (CTLs), lipopolysaccharide-binding proteins (LGBPs), etc. in antibacterial immunity. Currently, a C-type lectin, PcLectin, has been identified to be up-regulated in expression after infection with different pathogens. After knocking it down and stimulating Procambarus clarkii with Vibrio parahaemolyticus, the expression of some antimicrobial peptides was inhibited, and its recombinantly expressed protein has binding activity to several Gram-positive bacteria, Gram-negative bacteria and polysaccharides (Han Keke 2019). When PRRs interact with PAMPs and DAMPs, the receptor conformation changes, activating downstream immune-related signaling pathways. Research on the immune signaling pathways in Procambarus clarkii mainly focuses on the NF-κB signaling pathway and the JAK / STAT signaling pathway. The former includes the IMD signaling pathway and the Toll signaling pathway.

[0004] Single nucleotide polymorphisms (SNPs) are base substitutions, insertions or deletions occurring at a single position in the genome of an organism. Most SNPs are biallelic genotypes with an occurrence frequency of at least 1% in the population. They are the most widely distributed and abundant genetic variations in the genome, suitable for automated genotyping, and have become the main marker type in genetic research. Previous research by the research group identified a new gene R with VP resistance and two immune genes, ALF and crustin2, in Procambarus clarkii through transcriptome analysis. Based on sequencing and pathogen challenge experiments, their SNPs were identified, and a series of molecular markers were developed to identify SNPs. ALF1, R1 and Cru1 were determined to be the best disease-resistant haplotypes of the above three genes. Finally, a breeding strategy of hybridizing by screening parental combinations of different gene dominant haplotypes was proposed to enhance the disease resistance of Procambarus clarkii, thereby increasing its yield. Summary of the Invention

[0005] The present invention first discovered and cloned the PcL-Lec gene of Procambarus clarkii (as shown in SEQ ID NO: 1), and found that its encoded protein contains a C-type lectin domain (CLECT). Through challenge experiments (VP, WSSV) combined with KASP genotyping technology, disease-resistant dominant haplotypes L-Lec1-1 (WSSV resistance) and L-Lec2-1 (VP resistance) were screened out. RNA interference experiments confirmed that PcL-Lec is involved in the immune pathway by regulating downstream genes such as ERK and AKT. The KASP markers of the present invention can efficiently identify disease-resistant genotypes and accelerate the breeding of disease-resistant strains.

[0006] The PcL-Lec gene was identified by transcriptome analysis. It was found that its amino acid sequence has the highest homology with Cherax quadricarinatus and has a certain homology with the published lectin sequences of Procambarus clarkii, and its upregulation was observed under VP and WSSV stimulation. Analysis of single nucleotide polymorphisms (SNPs) of the PcL-Lec gene showed haplotypes related to disease resistance, especially L-Lec2-1 with VP resistance and L-Lec1-1 with WSSV resistance.

[0007] Compared with the prior art, the beneficial effects of the present invention are as follows:

[0008] The results of this study suggest that focusing on the PcL-Lec gene of Procambarus clarkii, an association analysis was conducted on the SNPs generated by base mutations in its open reading frame (Open Reading Frame, ORF) and disease resistance; by constructing 6 challenged populations, there were 3 replicate populations for each of the VP challenge and the WSSV challenge, and according to their survival time after challenge, they were divided into 3 subpopulations: susceptible to disease (susceptible), disease-resistant (resistant), and highly disease-resistant (highly resistant). Subsequently, the SNPs genotypes of PcL-Lec were detected by the KASP method, and their distribution in the 3 subpopulations was calculated to find SNPs haplotypes that were less distributed in the susceptible subpopulation and more distributed in the highly disease-resistant subpopulation. Disease-resistant genes associated with antibacterial or antiviral traits were screened out, SNPs were discovered, and the strength of their haplotype disease resistance was identified. Further, by detecting the expression of PcL-Lec and its downstream genes after RNA interference, the functional role of this gene in the immune response was clarified: specific SNP haplotypes of the PcL-Lec gene can be used as molecular markers for screening disease-resistant dominant individuals of Procambarus clarkii. In addition, RNA interference experiments further confirmed the function of the PcL-Lec gene in the immune response, and it participates in immune regulation through multiple signal pathways. Description of the Drawings

[0009] Figure 1: ORF sequence and homology analysis of the PcL-Lec gene; wherein Figure 1A: ORF sequence of gene PcL-Lec and its translated amino acid sequence, where the SNPs sites are indicated in red font, and the amino acid variation sites are indicated in gray background and blue font; Figure 1B : Blast analysis results of PcL-Lec gene; Figure 1C : Phylogenetic tree of PcL-Lec, and the results of homologous alignment of amino acid sequences of different species; The red triangle indicates the gene identified in this study;

[0010] Figure 2: Expression analysis of PcL-Lec gene; where Figure 2A : Expression analysis of PcL-Lec after challenge with VP and WSSV of different genders; Figure 2B : Expression levels of PcL-Lec in different tissues of Procambarus clarkii; Figure 2C : Expression level of PcL-Lec in peripheral hemolymph after challenge with VP; Figure 2D : Expression level of PcL-Lec in hepatopancreas after challenge with VP; Figure 2E : Expression level of PcL-Lec in peripheral hemolymph after challenge with WSSV; Figure 2F : Expression level of PcL-Lec in hepatopancreas after challenge with WSSV; Note: "****" indicates that the difference in relative expression levels between the two periods is very significant, P<0.001;

[0011] Figure 3: Survival curves of Procambarus clarkii after infection with VP and WSSV; where, Figure 3A : Survival curve of Procambarus clarkii after challenge with VP; Figure 3B : Survival curve of Procambarus clarkii after challenge with WSSV;

[0012] Figure 4: Haplotype identification and protein structure prediction of PcL-Lec gene; where, Figure 4A : Identification of CLECT domain of PcL-Lec; Figure 4B : Identification of CLECT haplotype of PcL-Lec; Figure 4C : Prediction of protein structure differences; Figure 4D : Genotyping effects of SNP292 and SNP504; Note: UTR represents the non-coding region of mRNA; CDS represents the coding DNA sequence; ATG represents the start codon; TAA represents the stop codon; CLECT represents c-type lectin / c-type lectin-like domain;

[0013] Figure 5: Distribution of disease-resistant haplotypes in pathogen-infected populations; where, Figure 5A : Distribution of L-Lec2-1, L-Lec2-2 and L-Lec2-3 subgroups after challenge with VP; Figure 5B : Distribution of L-Lec1-1, L-Lec1-2 and L-Lec1-3 subgroups after challenge with WSSV;

[0014] Figure 6: Changes in the expression of PcL-Lec and its downstream genes after RNA interference; among them, Figure 6A : Relative expression level of PcL-Lec in Procambarus clarkii after RNAi; Figure 6B : Changes in the relative expression levels of downstream genes in the immune-related pathway after RNAi-PcL-Lec in Procambarus clarkii; Figure 6C : Part of the C-type lectin receptor pathway in mammals, which is information on part of the C-type lectin receptor pathway in mammals; Figure 6D : Part of the B-cell receptor pathway in mammals; Note: "***" indicates that there is a highly significant difference in the relative expression levels between the two, P < 0.001; the green label in the figure indicates the CLR on the mammalian cell membrane, the red label indicates the genes detected to be downregulated in Procambarus clarkii, and the blue label indicates the genes detected to be upregulated. Detailed implementation methods

[0015] Example 1: Cloning and expression analysis of PcL-Lec gene

[0016] 1. Extract RNA from the hemolymph of Procambarus clarkii and reverse transcribe it into cDNA;

[0017] Collect tissues (hepatopancreas, intestine, gill, muscle, and stomach) from healthy Procambarus clarkii, immediately freeze them in liquid nitrogen, and store them in a -80°C ultra-low temperature refrigerator. Collect hemolymphocytes from healthy Procambarus clarkii and Procambarus clarkii after challenge treatment, and add them to an equal volume of ACD anticoagulant buffer (4.8 g citric acid, 13.2 g sodium citrate, 14.7 g glucose dissolved in ddH2O and made up to 1 L, filtered and sterilized with a 0.40 μm filter, stored at 4°C). According to the manufacturer's instructions, use reagent (Invitrogen, California, USA) to extract total RNA from these tissues of Procambarus clarkii. Evaluate the purity and quality of total RNA using 1% agarose gel. Evaluate the RNA integrity using the Agilent 2100 bioanalyzer system (the total RNA OD A260 / A280 of all samples is within the range of 1.8 - 2.0, and its concentration is standardized to 200 ng / μL with RNase free ddH2O). Use the Ⅱ1 st Strand cDNA Synthesis (+gDNAwiper) kit (Vazyme, Nanjing, China) for reverse transcription, and store the obtained cDNA samples in a -20°C refrigerator.

[0018] 2. Design primers (SEQ ID NO: 9 - 10) to amplify the PcL-Lec ORF sequence and verify by sequencing;

[0019] 3. qRT-PCR detection showed that the expression of PcL-Lec was upregulated after VP and WSSV infection (Figure 2).

[0020] Example 2: SNP locus detection and KASP marker development

[0021] 1. Procambarus clarkii sample collection

[0022] All Procambarus clarkii samples were collected from the Baishazhou Market in Wuhan, Hubei Province. To avoid the lack of persuasiveness of experimental results due to the single genotype structure of a single challenged group, in this study, green-shelled Procambarus clarkii with a body weight of 15 - 20 grams, similar body shape, complete appendages, and strong vitality were randomly collected in six batches over three and a half months, and were temporarily raised in a breeding tank for three days before being used for the construction of the subsequent challenged groups.

[0023] 2. Immune challenge experiment

[0024] A VP and WSSV infection experiment was conducted on Procambarus clarkii, and the death time was recorded and grouped (susceptible S, resistant R, strongly resistant SR). The specific experimental steps are as follows:

[0025] In this example, 192 temporarily raised Procambarus clarkii collected in step 1 were randomly divided into 8 groups, with 24 in each group, and a total of 8 challenged groups were constructed. In this study, a total of 3 VP challenged replicate groups were obtained: injected with 100 μL VP (Beijing NaChuangLian Biotechnology Co., Ltd.), 3 WSSV challenged replicate groups: injected with 100 μL WSSV (the research group of Gong Yi from Nanchang University), and 2 control groups: injected with 100 μL PBS. The injection site was the slightly soft area under the fifth pair of walking legs. When injecting, the needle was inserted along the central axis direction, injected slowly, and the needle was slowly withdrawn after injection. If there was a jet of liquid flowing out from the injection site, re-injection was required. The survival curves of each group showed that compared with the control group, the survival rate of the groups decreased rapidly after VP and WSSV challenge. The survival rate of the group after VP challenge was less than 20% after 72 hours, while more than 80% of the individuals in the group died after 156 hours of WSSV challenge (Figure 3).

[0026] According to the death order of the experimental shrimp and the difference in disease resistance of different groups, the groups were divided into 3 sub-groups: the first 12% - 28% of the individuals were susceptible to disease (susceptible); the middle 44% - 76% of the individuals were disease-resistant (resistant); the last 12% - 28% of the individuals were strongly disease-resistant (strongly resistant). According to the data in Table 1, the average proportion of susceptible (susceptible) in the three VP challenged replicate groups was 18.35%, the average proportion of disease-resistant (resistant) was 63.30%, and the average proportion of strongly disease-resistant (strongly resistant) was 18.35%; the average proportion of susceptible (susceptible) in the three WSSV challenged replicate groups was 23.57%, the average proportion of disease-resistant (resistant) was 53.10%, and the average proportion of strongly disease-resistant (strongly resistant) was 23.32%.

[0027] 3. Seven SNP sites in the ORF region of the PcL-Lec gene were detected, and SNP292 (AA genotype) and SNP504 (AA genotype) were screened out to be significantly associated with disease resistance.

[0028] In this study, seven SNP sites were detected in the ORF of the PcL-Lec gene using 20 Procambarus clarkii samples, and all of them were located in the CLECT domain. Six haplotypes were identified and named L-Lec1-1, L-Lec1-2, L-Lec1-3, L-Lec2-1, L-Lec2-2, and L-Lec2-3 ( Figure 4A ). Among them, LD existed among SNP292, SNP349, SNP408, SNP410, SNP433, and SNP435 ( Figure 4B ). Based on the ORF sequence prediction, these SNP mutations were predicted to cause four amino acid variations, and the tertiary structures of two proteins corresponding to L-Lec1-1 and L-Lec1-2 were predicted respectively, and two significant differences in their conformations were found ( Figure 4C ).

[0029] 4. For the above detected SNP sites, corresponding KASP molecular markers (sequences are shown in SEQ ID NO: 3-8) were developed for genotyping: the genotypes of the six SNP sites with LD were represented by the genotyping results of the KASP marker of SNP292. The amplification effects of the two markers showed that the three types of fluorescence signals were relatively concentrated and clearly partitioned, and the genotyping effect was good, which could be applied to the SNP genotyping of the challenged population ( Figure 4D ).

[0030] Example 3: Verification of disease-resistant haplotypes

[0031] In the VP-infected population, the proportion of SR individuals with the L-Lec2-1 haplotype (SNP504-AA) was 56% ( Figure 5A ); in the WSSV-infected population, the proportion of SR individuals with the L-Lec1-1 haplotype (SNP292-AA) was 60% ( Figure 5B ).

[0032] Example 4: RNA interference and pathway analysis

[0033] Injecting siRNA to interfere with the PcL-Lec gene, the expression level decreased by 98.8% after 48 hours ( Figure 6A );

[0034] Detecting the expression of downstream genes, it was confirmed that PcL-Lec regulated genes such as ERK and AKT through the C-type lectin receptor pathway ( Figure 6B ).

[0035] SEQ ID NO:1: ORF sequence of PcL-Lec gene (510bp).

[0036] ATGACGTGCTTGGTGCTCTTCGCCTTGCTTGTGCTGGGGATAGAGGCTGAAAACTTGCATCCTTCCTCTGGCTGCGTGGTCAACCAGATATTGTGCCCTCAATATCCCAATGGAGGAGGAGGAGGAGAAGCACCGTGCCTATACCCGTATAAGAGGGCGGGCGATGTGTGCCTCTACCTGAGCAAGTCCAGCAGGACGTGGAGCGGCGCACGACGGCACTGTCAGGGGCTTGGTGGCGACCTGGCCACCAGCAGGAGGATCTACCTTCTGCAGACCTTCATCATCGAGGGTAAACTCACGGCAGAAGTCTGGGTCGGTGGGAAGGAATCACCTGATGGGAAAACCTGGCAGTGGATCGACAACGGTGAGGAGATCGACCCCCAGGTGTGGCACCCGACCCTTCCCGGGGCTCGCGCAGGAGACAACGACTGCGCCTACTTGAGTGATGTATCTCACCCGCCTCTCGCCAATTACCCTTGTGGAAGAGTTTTCAATTTCTTGTGTCAGCAACATTAG

[0037] SEQ ID NO:2: Encoded protein sequence of PcL-Lec (169 amino acids).

[0038] >XP_069189275.1 macrophage mannose receptor 1 isoform X4

[0039] [Procambarusclarkii]

[0040] Met Thr Cys Leu Val Leu Phe Ala Leu Leu Val Leu Gly Ile Glu Ala Glu Asn Leu His Pro Ser Ser Gly Cys Val Val Asn Gln Ile Leu Cys Pro Gln Tyr Pro Asn Gly Gly Gly Gly Gly Glu Ala Pro Cys Leu Tyr Pro Tyr Lys Arg Ala Gly Asp Val Cys Leu Tyr Leu Ser Lys Ser Ser Arg Thr Trp Ser Gly Ala Arg Arg His Cys Gln Gly Leu Gly Gly Asp Leu Ala Thr Ser Arg Arg Ile Tyr Leu Leu Gln Thr Phe Ile Ile Glu Gly Lys Leu Thr Ala Glu Val Trp Val Gly Gly Lys Glu Ser Pro Asp Gly Lys Thr Trp Gln Trp Ile Asp Asn Gly Glu Glu Ile Asp Pro Gln Val Trp His Pro Thr Leu Pro Gly Ala Arg Ala Gly Asp Asn Asp Cys Ala Tyr Leu Ser Asp Val Ser His Pro Pro Leu Ala Asn Tyr Pro Cys Gly Arg Val Phe Asn Phe Leu Cys Gln Gln His

[0041] SEQ ID NO: 3 - 8: KASP marker primer sequences

[0042]

[0043] SEQ ID NO: 9 - 10: ORF amplification primer sequences

[0044]

Claims

1. A crayfish disease resistance gene PcL-Lec, characterized in that: The nucleotide sequence of the disease-resistant gene PcL-Lec of Procambarus clarkii is shown as SEQ ID NO:1, and the amino acid sequence encoded by the disease-resistant gene PcL-Lec of Procambarus clarkii is shown as SEQ ID NO:

2.

2. A SNP site for screening disease-resistant dominant individuals of Procambarus clarkii, located in the CLECT domain of the disease-resistant gene PcL-Lec of Procambarus clarkii, characterized in that: The SNP site information is: SNP292, located at position 292 of the ORF sequence, allele A>G; SNP504, located at position 504 in the ORF sequence, allele A>G.

3. A disease-resistant dominant SNP haplotype of Procambarus clarkii, characterized in that: The haplotype is L-Lec1-1 associated with WSSV resistance, namely, SNP292 genotype AA.

4. A disease-resistant dominant SNP haplotype of Procambarus clarkii, characterized in that: The haplotype is L-Lec2-1 associated with VP resistance, namely SNP504 genotype AA.

5. A disease-resistant dominant SNP genotype combination of Procambarus clarkii, characterized in that: The genotype combination is a double homozygous type of SNP292 genotype AA and SNP504 genotype AA of the PcL-Lec gene.

6. A KASP molecular marker combination for screening disease-resistant individuals of Procambarus clarkii, characterized in that: The molecular marker combination includes the following primers:

Images