Application of HDAC (histone deacetylase) inhibitor in treatment of liver cancer

Abstract

The invention belongs to the field of biological medicine, and relates to application of an HDAC (histone deacetylase) inhibitor in treatment of liver cancer, in particular to application of the HDAC inhibitor in preparation of medicines for treating liver cancer, slowing down liver cancer progress and / or preventing liver cancer recurrence, a medicine composition for treating liver cancer, slowing down liver cancer progress and / or preventing liver cancer recurrence and a treatment method.

Description

Technical Field

[0001] The present disclosure belongs to the field of biomedicine, and relates to the use of HDAC inhibitors in the treatment of liver cancer. More specifically, it relates to the use of HDAC inhibitors in the preparation of drugs for treating liver cancer, slowing down the progression of liver cancer and / or preventing the recurrence of liver cancer, drug combinations for treating liver cancer, slowing down the progression of liver cancer and / or preventing the recurrence of liver cancer, and treatment methods. Background Art

[0002] Differentiation is the process by which cells acquire different morphologies and functions. In most cases, differentiation is anti-proliferative and constitutes an obstacle to tumor formation. Increasing evidence indicates that unlocking normally restricted phenotypic plasticity allows cells to escape or evade terminal differentiation, which is a favorable feature for cancer. Defects in tumor differentiation may manifest as impaired differentiation of stem / progenitor cells or even dedifferentiation of mature cells into a progenitor-like state. Poorly differentiated tumors tend to be more aggressive, metastatic, and drug-resistant. Mechanistically, defects in cancer cell differentiation may be due to disruption of the programs for normal cell homeostasis, repair, and regeneration. Transcription factors (TFs) play a key role in regulating the gene expression programs related to cell fate and differentiation. For example, hepatocyte nuclear factor 4α (HNF4A) is involved in regulating many liver-specific genes, which are essential for liver development. Reduced HNF4A expression leads to hepatocyte dedifferentiation and is associated with the occurrence and development of hepatocellular carcinoma (HCC).

[0003] Specific transcriptional programs related to differentiation are also determined by chromatin structure, mainly regulated through epigenetic modifications. For example, histone acetylation, especially at regulatory regions such as promoters and enhancers, can promote chromatin accessibility and facilitate the binding of TFs and other regulatory proteins to initiate the transcription of lineage-specific genes. In cancer, genetic mutations involved in regulating and maintaining epigenetic modifications may lead to abnormal chromatin structure. However, the existence of "non-mutational epigenetic reprogramming" was observed as early as a decade ago and has gradually been recognized as a major pro-tumorigenic feature. Although the mechanisms of non-mutational epigenetic reprogramming are being gradually uncovered, there are still many key issues that need to be clarified. The mutual regulation of TFs and chromatin-modifying enzymes may play a pro-tumorigenic role. Targeting the dysregulated epigenetic regulatory machinery and abnormally active TFs in cancer is expected to restore normal differentiation programs and may improve cancer treatment regimens.

[0004] Hepatocellular carcinoma (HCC) is the most common type of liver cancer, and the treatment methods for advanced HCC are very limited. Phenotypic and molecular heterogeneity, including differences in the level of differentiation, is one of the obstacles to treatment effectiveness. Keratin 19 (KRT19) is expressed in the bile ducts and progenitor cells of the normal liver, and it is considered a marker of cancer stem cells in HCC. KRT19 is expressed in 10% - 30% of HCCs, and these HCCs are prone to metastasis and recurrence and have a worse prognosis. KRT19-expressing HCC often exhibits the morphological characteristics of HCC and intrahepatic cholangiocarcinoma (ICC), which may be the result of dedifferentiation or transdifferentiation. Although KRT19 has prognostic value as a biomarker, whether it plays a tumor-promoting role in vivo and its underlying mechanism of action remain unclear. In addition, HNF4A and KRT19 respectively mark liver differentiation and stem cells, but the mechanistic relationship between these two factors is not clear. KRT19-positive HCC is a chemotherapy-resistant subtype without a specific treatment regimen. Although lenvatinib, a multi-kinase inhibitor, is approved for first-line treatment of advanced HCC. However, the median progression-free survival of lenvatinib is only 7.3 months, and there is still a need to develop drugs with better efficacy for treating liver cancer, especially HCC cases.

[0005] Both non-mutational epigenetic reprogramming and escape from terminal differentiation are important factors promoting cancer. However, the current mechanistic understanding of these two processes is incomplete. Therefore, there is still a need to study and confirm the molecular mechanisms of cancer, especially liver cancer, and develop therapeutic drugs and treatment strategies therefrom for earlier and more timely targeted treatment, so as to effectively treat liver cancer, relieve the progression of liver cancer, and prevent the recurrence of liver cancer. Similarly, there is still a need to develop new targeted therapeutic drugs and targeted therapies for liver cancer.

[0006] Furthermore, one of the most challenging aspects of current HDAC inhibitors as therapeutic agents is their lack of specificity for cancer and their wide range of side effects. Therefore, it is important to discover the important functions of tumor-specific complexes rather than targeting HDAC or the general REST corepressor (CoREST) complex, which is of great significance for developing more selective tumor treatment strategies. SUMMARY OF THE INVENTION

[0007] In view of the above-mentioned needs in the art, the inventor team of the present disclosure surprisingly found that histone deacetylation leads to tumor epigenetic reprogramming and dedifferentiation, and HADC inhibitors significantly inhibit human liver cancer and liver cancer in non-human mammals. Specifically, HDAC inhibitors alone or in combination with other drugs significantly inhibit the development of human liver cancer and liver cancer in non-human mammals.

[0008] An object of the present disclosure is to provide the use of an HDAC inhibitor in the preparation of a medicament for treating liver cancer, slowing down the progression of liver cancer and / or preventing the recurrence of liver cancer.

[0009] Preferably, the HDAC inhibitor is an HDAC1 / 2 inhibitor.

[0010] Preferably, the HDAC1 / 2 inhibitor includes vorinostat, panobinostat, valproic acid, entinostat, romidepsin, chidamide, TNG260, tacedinaline, cis-BG47, Santacruzamate A or HDAC-IN-53; more preferably, the HDAC1 / 2 inhibitor is romidepsin.

[0011] Preferably, the liver cancer includes hepatocellular carcinoma, intrahepatic cholangiocarcinoma or hepatoblastoma; more preferably, the hepatocellular carcinoma is selected from the HCC pathological type with ICC pathological features or HCC-ICC combined pathological features, or any one of the HCC pathological types characterized by intratumoral pseudoglandular proliferation or intratumoral pseudoglands filled with bile

[0012] Another object of the present disclosure is to provide a pharmaceutical combination for treating liver cancer, slowing down the progression of liver cancer and / or preventing the recurrence of liver cancer, which at least includes: a first pharmaceutical preparation that does not contain an HDAC inhibitor as an active ingredient; and a second pharmaceutical preparation, and the second pharmaceutical preparation contains an HDAC inhibitor as an active ingredient.

[0013] Preferably, the first pharmaceutical preparation is any one selected from the following drugs: proteasome inhibitors, such as bortezomib, carfilzomib or disulfiram; mTOR pathway inhibitors, such as sirolimus, rapamycin or everolimus; PI3K inhibitors, such as perifosine, CAL101, PX-866, IPI-145 or BAY 80-6946; B-raf inhibitors, such as vemurafenib or sorafenib; JAK2 inhibitors, such as tofacitinib or pacritinib; tyrosine kinase inhibitors (TKIs), such as erlotinib, imatinib, sunitinib, lapatinib, gefitinib, sorafenib, nilotinib, toceranib, bosutinib, neratinib, vatalanib, regorafenib or cabozantinib; multi-target receptor tyrosine kinases (TKIs), such as lenvatinib or donafenib; other protein kinase inhibitors, such as crizotinib or regorafenib; serine / threonine kinase inhibitors, such as Ras / Raf signal inhibitors, such as farnesyltransferase inhibitors; serine protease inhibitors, such as matriptase, hepsin or urokinase inhibitors; intracellular signal transduction inhibitors, such as tipifarnib or perifosine; preparations that inhibit cell signal transduction through MEK and / or AKT kinases; aurora kinase inhibitors, such as AZD1152, PH739358, VX-680, MLN8054, R763, MP235, MP529, VX-528 or AX39459; cyclin-dependent kinase inhibitors, such as CDK2 and / or CDK4 inhibitors; survival signal protein inhibitors, such as ABT-737; HSP90 inhibitors; therapeutic monoclonal antibodies, PD-1 antibodies, such as tislelizumab; anti-EGFR monoclonal antibodies, such as cetuximab, panitumumab or nimotuzumab; anti-ERBB2 monoclonal antibodies, such as trastuzumab or pertuzumab; anti-CD20 monoclonal antibodies, such as rituximab, ofatumumab or veltuzumab; monoclonal antibodies targeting other tumor antigens, such as alemtuzumab, ramucirumab, adecatumumab, orgetinib or obinutuzumab; TRAIL pathway agonists, such as dulanermin (soluble rhTRAIL), apomab, mapatumumab, lexatumumab, conatumumab or tigatuzumab; antibody fragments, bispecific antibodies or bispecific T cell engagers (BiTEs), such as catumaxomab or blinatumomab;Antibody-drug conjugates (ADCs) and other immunoconjugates, such as ibritumomab triuxetan, tositumomab, brentuximab vedotin, gemtuzumab ozogamicin, clivatuzumab tetraxetan, pemtumomab or trastuzumab emtansine.;

[0014] Preferably, the first pharmaceutical preparation is selected from any one of lenvatinib, regorafenib, donafenib or tislelizumab.

[0015] Preferably, the HDAC inhibitor in the pharmaceutical combination is an HDAC1 / 2 inhibitor.

[0016] Preferably, in the pharmaceutical combination, the HDAC1 / 2 inhibitor includes vorinostat, panobinostat, valproic acid, entinostat, romidepsin, chidamide, TNG260, tacedinaline, cis-BG47, santacruzamate A or HDAC-IN-53; more preferably, the HDAC1 / 2 inhibitor is romidepsin.

[0017] Preferably, in the pharmaceutical combination, the pharmaceutical combination is used to treat patients with chemotherapy-resistant liver cancer; more preferably, the chemotherapy resistance is doxorubicin, mitomycin, 5-fluorouracil or cisplatin resistance.

[0018] Preferably, the liver cancer patient is a recurrent liver cancer patient (for example, a recurrent liver cancer patient with bone and lung metastases).

[0019] Preferably, the liver cancer patient is hepatocellular carcinoma.

[0020] Preferably, the pharmaceutical combination is used to treat FOXP4 and / or KRT19-positive liver cancer.

[0021] Preferably, the liver cancer patient is a mammal, including a human or a non-human mammal.

[0022] Preferably, the FOXP4 and / or KRT19-positive liver cancer includes any one of ICC pathological type liver cancer, HCC-ICC combined pathological type liver cancer, or HCC pathological type liver cancer characterized by intratumoral pseudoglandular proliferation or intratumoral pseudoglands filled with bile.

[0023] Preferably, the HDAC inhibitor is used in combination with any one selected from lenvatinib, regorafenib, donafenib or tislelizumab.

[0024] Preferably, the administration mode of the pharmaceutical combination includes systemic or local administration; more preferably, the administration is carried out through a route selected from parenteral, intraperitoneal, intradermal, intracavitary, intrasynovial, intrathecal, intramuscular injection, intravenous injection, intra-arterial injection, oral, buccal, sublingual, transdermal, rectal, subcutaneous and / or topical administration routes.

[0025] Preferably, the HDAC inhibitor is any one selected from fatty acids (such as valproic acid), hydroxamic acids (such as SAHA (vorinostat), belinostat (PXD101), panobinostat (LBH589, Panobinosta), givinostat (ITF-2357), resminostat (4SC-201, Resminostat), abexinostat (PCI 2478I (abexinostat))), benzamides (such as Tubacin, entinostat (MS-275, entinostat), MGCD0103 (mocetinostat), tacedinaline (CI-994, Tacedinaline), romidepsin (FK 228) or apicidin, KD 5170);

[0026] Optionally, the HDAC inhibitor is selected from any one of carboxylates (short-chain fatty acids), hydroxamic acids, epoxy derivatives, electrophilic ketones (thioredoxin), cyclic peptides, benzamides or hybrid compounds.

[0027] Optionally, the HDAC inhibitor is selected from any one of butyrate, desferrioxamine, phenylbutyrate, valproate, trichostatin, suberoylanilide hydroxamic acid (SAHA), azelaic acid dihydroxamic acid (ABHA), scriptaid, pyroxamide, chlamydocin, apicidin, depudecin, MS-275, MGCD0103, PXD101, Daceca, Savisol, LBH589, PCI-24781 or ITF2357.

[0028] Another object of the present disclosure is to provide a method for treating liver cancer, slowing down the progression of liver cancer and / or preventing the recurrence of liver cancer, which at least includes: administering a pharmaceutically effective amount of a pharmaceutical preparation containing an HDAC inhibitor as an active component to a mammalian liver cancer patient in need thereof.

[0029] Preferably, the liver cancer includes hepatocellular carcinoma, intrahepatic cholangiocarcinoma, and hepatoblastoma.

[0030] Preferably, the hepatocellular carcinoma includes any one of ICC pathological type liver cancer, HCC-ICC combined pathological type liver cancer, or HCC pathological type liver cancer characterized by intratumoral pseudoglandular proliferation or intratumoral pseudoglands filled with bile.

[0031] Preferably, the HDAC inhibitor is an HDAC1 / 2 inhibitor.

[0032] Preferably, the HDAC1 / 2 inhibitor includes vorinostat, panobinostat, valproic acid, entinostat, romidepsin, chidamide, TNG260, tacedinaline, cis-BG47, Santacruzamate A, or HDAC-IN-53; more preferably, the HDAC1 / 2 inhibitor is romidepsin.

[0033] Preferably, the method includes separately administering a pharmaceutically effective amount of a first pharmaceutical preparation and a second pharmaceutical preparation to a mammalian liver cancer patient in need, wherein the first pharmaceutical preparation does not contain an HDAC inhibitor as an active ingredient; the second pharmaceutical preparation contains an HDAC inhibitor as an active ingredient.

[0034] Preferably, in the method, the first pharmaceutical preparation is any one selected from the following drugs: proteasome inhibitors, such as bortezomib, carfilzomib or disulfiram; mTOR pathway inhibitors, such as sirolimus, rapamycin or everolimus; PI3K inhibitors, such as perifosine, CAL101, PX-866, IPI-145 or BAY 80-6946; B-raf inhibitors, such as vemurafenib, sorafenib; JAK2 inhibitors, such as tofacitinib or pacritinib; tyrosine kinase inhibitors (TKIs), such as erlotinib, imatinib, sunitinib, lapatinib, gefitinib, sorafenib, nilotinib, toceranib, bosutinib, neratinib, vandetanib, regorafenib or cabozantinib; multi-target receptor tyrosine kinases (TKIs), such as lenvatinib or donafenib; other protein kinase inhibitors, such as crizotinib or regorafenib; serine / threonine kinase inhibitors, such as Ras / Raf signal inhibitors, such as farnesyltransferase inhibitors; serine protease inhibitors, such as matriptase, hepsin or urokinase inhibitors; intracellular signal transduction inhibitors, such as tipifarnib or perifosine; preparations that inhibit cell signal transduction through MEK and / or AKT kinases; aurora kinase inhibitors, such as AZD1152, PH739358, VX-680, MLN8054, R763, MP235, MP529, VX-528 or AX39459; cyclin-dependent kinase inhibitors, such as CDK2 and / or CDK4 inhibitors; survival signal protein inhibitors, such as ABT-737; HSP90 inhibitors; therapeutic monoclonal antibodies, PD-1 antibodies, such as tislelizumab; anti-EGFR monoclonal antibodies, such as cetuximab, panitumumab or nimotuzumab; anti-ERBB2 monoclonal antibodies, such as trastuzumab or pertuzumab; anti-CD20 monoclonal antibodies, such as rituximab, ofatumumab or veltuzumab; monoclonal antibodies targeting other tumor antigens, such as alemtuzumab, labetuzumab, adecatumumab, oregovomab or obinutuzumab; TRAIL pathway agonists, such as dulanermin (soluble rhTRAIL), apomab, mapatumumab, lexatumumab, conatumumab or tigatuzumab; antibody fragments, bispecific antibodies or bispecific T cell engagers (BiTEs), such as catumaxomab or blinatumomab;Antibody-drug conjugates (ADCs) or other immunoconjugates, such as ibritumomab triuxetan, tositumomab, brentuximab vedotin, gemtuzumab ozogamicin, clivatuzumab tetraxetan, pemtumomab or trastuzumab emtansine.;

[0035] Preferably, the first pharmaceutical preparation is any one selected from lenvatinib, regorafenib, donafenib or tislelizumab.

[0036] Preferably, the second pharmaceutical preparation is an HDAC inhibitor, and more preferably, an HDAC1 / 2 inhibitor.

[0037] Preferably, the HDAC1 / 2 inhibitors in the method include vorinostat, panobinostat, valproic acid, entinostat, romidepsin, chidamide, TNG260, tacedinaline, cis-BG47, Santacruzamate A or HDAC-IN-53;

[0038] More preferably, the HDAC1 / 2 inhibitor is romidepsin.

[0039] Preferably, the HDAC inhibitor is used in combination with any one selected from lenvatinib, regorafenib, donafenib or tislelizumab.

[0040] Optionally, the administration includes systemic or local administration; more preferably, it is administered through a route selected from parenteral, intraperitoneal, intradermal, intracavitary, intrasynovial, intrathecal, intramuscular injection, intravenous injection, intraarterial injection, oral, buccal, sublingual, transdermal, rectal, subcutaneous and / or topical administration routes.

[0041] Optionally, the HDAC inhibitor is any one selected from fatty acids (such as valproic acid), hydroxamic acids (such as SAHA (vorinostat), belinostat (PXD101), panobinostat (LBH589), givinostat (ITF-2357), resminostat (4SC-201), abexinostat (PCI 2478I), benzamides (such as Tubacin, entinostat (MS-275), mocetinostat (MGCD0103), tacedinaline (CI-994), romidepsin (FK 228), apicidin or KD 5170).

[0042] Optionally, the HDAC inhibitor is any one selected from carboxylates (short-chain fatty acids), hydroxamic acids, epoxy derivatives, electrophilic ketones (thioredoxin), cyclic peptides, benzamides or hybrid compounds.

[0043] Optionally, the HDAC inhibitor is any one selected from butyrate, desferrioxamine, phenylbutyrate, valproate, trichostatin, suberoylanilide hydroxamic acid (SAHA), azelaic acid bis-hydroxamic acid (ABHA), scriptaid, pyroxamide, chlamydocin, apicidin, depudecin, MS-275, MGCD0103, PXD101, Daceca, Savisol, LBH589, PCI-24781 or ITF2357.

[0044] Beneficial effects achieved by the present disclosure:

[0045] The inventors of the present disclosure found that HDAC1 and KRT19 bind to the promoter and / or enhancer regions of liver differentiation genes (HNF4A, PPARA, RXRA). Inhibiting HDAC1 can enhance the expression of liver differentiation genes, and HDAC inhibitors significantly inhibit human liver cancer and liver cancer in non-human mammals. Therefore, the present disclosure provides the use of HDAC inhibitors in the preparation of drugs for treating liver cancer, slowing down the progression of liver cancer, and / or preventing the recurrence of liver cancer. On this basis, the present disclosure also provides the combined use of HDAC inhibitors and other components for treating liver cancer, slowing down the progression of liver cancer, and / or preventing the recurrence of liver cancer. In particular, the inventors of the present disclosure found that patients with characteristics of poorly differentiated liver cancer often have high expression of FOXP4 and KRT19, and KRT19 exerts its function by binding to and activating HDAC1. Therefore, the combination of HDAC inhibitors and common first-line drugs for liver cancer can significantly inhibit the development of human liver cancer and liver cancer in non-human mammals, such as the combination of lenvatinib and romidepsin. BRIEF DESCRIPTION OF THE DRAWINGS

[0046] Figure 1 In Example 1, the binding positions of KRT19-HDAC1 on the genome in liver cancer cells were studied;

[0047] Figure 2 In Example 1, the investigation results of genes related to liver differentiation among the downstream target genes of KRT19-HDAC1;

[0048] Figure 3 In Example 1, the schematic diagram of the construction of different recombinant plasmids and the experimental results of the effects on the expression of different target genes;

[0049] Figure 4 Shows the inhibitory effect of the combination of lenvatinib and romidepsin on liver cancer in mice in Example 2;

[0050] Figure 5 In Example 2, the treatment effect of the combination of lenvatinib and romidepsin on the PDX mouse liver cancer model;

[0051] Figure 6 In Example 2, the experimental results of verifying the treatment effect of the combination of lenvatinib and romidepsin on liver cancer through the expression of genes HNF4A, CYP7A1, FABP1, APOC3, and HepPar1. DETAILED DESCRIPTION OF THE EMBODIMENTS

[0052] In the present disclosure, unless otherwise specified, scientific and technical terms used herein have the meanings commonly understood by those skilled in the art. In addition, the protein and nucleic acid chemistry, molecular biology, cell and tissue culture, microbiology, immunology-related terms and laboratory procedures used herein are terms and conventional procedures widely used in the respective fields. At the same time, to better understand the present disclosure, definitions and explanations of relevant terms are provided below.

[0053] I. Definitions

[0054] As used herein, the term "about" or "approximate" as applied to one or more target values refers to a value similar to the reference value. In certain embodiments, unless otherwise specified or otherwise apparent from the context, the term "approximate" or "about" refers to a range of values that fall within 20%, 19%, 18%, 17%, 16%, 15%, 14%, 13%, 12%, 11%, 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1% or less of the reference value in either direction (greater than or less than) (unless such a number would exceed 100% of the possible value).

[0055] As used herein, the term "histone deacetylase (HDAC)" or "HDAC" refers to a class of proteases that play an important role in the structural modification of chromosomes and the regulation of gene expression. In general, the acetylation of histones is conducive to the dissociation of DNA from the histone octamer, and the nucleosome structure is relaxed, so that various transcription factors and co-transcription factors can bind specifically to the DNA binding site and activate gene transcription; while the deacetylation of histones plays the opposite role. In the cell nucleus, histone acetylation and histone deacetylation processes are in dynamic equilibrium and are co-regulated by histone acetyltransferase (HAT) and histone deacetylase (HDAC). HAT transfers the acetyl group of acetyl-CoA to a specific lysine residue at the amino terminus of histones, and HDAC deacetylates histones, tightly binds to negatively charged DNA, chromatin is densely curled, and gene transcription is inhibited. In cancer cells, overexpression of HDAC leads to enhanced deacetylation, which restores the positive charge of histones and increases the attraction between DNA and histones, making the relaxed nucleosomes very tight, which is not conducive to the expression of specific genes, including some tumor suppressor genes. Histone deacetylase inhibitors (HDACi) or HDAC inhibitors can regulate the expression and stability of apoptosis and differentiation-related proteins by increasing histone acetylation in specific regions of chromatin, inducing apoptosis and differentiation, and becoming a new class of anti-tumor drugs. HDAC inhibitors not only have good therapeutic effects on a variety of hematological tumors and solid tumors, but also have the advantages of relatively high selectivity for tumor cells and low toxicity.

[0056] As used herein, the term "keratin 19", "KRT19 protein" or "Krt19" refers to a member of the keratin family, encoded by the Keratin19 gene, which is an intermediate filament protein responsible for the structural integrity of epithelial cells and can be subdivided into cytokeratins and hair keratins. Type I cytokeratins are composed of acidic proteins arranged in pairs of heterotypic keratin chains. Unlike its related family members, this smallest known acidic cytokeratin does not pair with basic cytokeratins in epithelial cells. It is specifically expressed in the periderm, which is a transient surface layer that wraps around the developing epidermis. Type I cytokeratins are clustered in the region of chromosome 17q12-q21.

[0057] As used herein, the term "FOXP4" or "Foxp4" or "Forkhead box P4 gene" refers to a gene belonging to the P subfamily of the Forkhead box (FOX) transcription factor family, and the protein encoded by this gene is Forkhead box Protein P4. Forkhead box transcription factors (FTFs) constitute a highly conserved protein family, and all proteins in this family have a Forkhead domain that can bind to specific genomic DNA. By mediating the activation and inhibition of transcription and interacting with a variety of cofactors, FTFs are involved in a variety of cellular processes, including cell differentiation, metabolism, cell cycle progression, apoptosis and autophagy, as well as protection against cellular stress. During development, FTFs regulate tissue formation and homeostasis through multiple mechanisms. Therefore, the expression of specific FTFs can guide irreversible cell fate decisions. FTFs play important roles in mammalian development and diseases, and also play important roles in the regulation of tissue- and cell-type-specific gene transcription during development and adulthood. Many members of the Forkhead box gene family, including members of the P subfamily, play roles in mammalian tumorigenesis. This gene may play a role in the development of kidney and laryngeal tumors. Alternative splicing of this gene generates multiple transcript variants, some of which encode different isoforms.

[0058] As used herein, the term "REST corepressor (CoREST) complex" refers to the RE-1 silencing transcription factor complex, which includes two members, histone deacetylase 1 (HDAC1) and REST corepressor 1 (RCOR1). Specifically, the neuron-restrictive silencer factor (NRSF), an important zinc finger protein transcriptional negative regulator, binds to the corresponding neuron-restrictive silencer element (NRSE), also known as RE-1 (repressor element 1), in certain genes, thereby repressing the expression of many genes related to neuron development and function. REST corepressor (CoREST) is a neuron phenotype regulator. CoREST binds to the C-terminal domain of REST (containing a C2H2-type zinc finger structure) to form a repressor complex and exert transcriptional inhibitory effects.

[0059] As used herein, the term "hepatocyte nuclear factor 4 alpha (HNF4A)" belongs to the members of the nuclear receptor superfamily and is highly expressed in differentiated and mature hepatocytes. HNF4α regulates the expression of liver-specific genes at the transcriptional level, promotes the development and differentiation of hepatocytes, participates in the establishment and maintenance of hepatocyte polarity, and enhances the synthetic, metabolic, and detoxification functions of the liver. HNF4α can participate in the occurrence and progression of diseases such as liver fibrosis, cirrhosis, and hepatocellular carcinoma through mechanisms such as inhibiting the activation of hepatic stellate cells, reversing epithelial-mesenchymal cell transformation, and inhibiting the proliferation, invasion, and metastasis of hepatocellular carcinoma cells. The protein encoded by this gene is a nuclear transcription factor that binds to DNA in the form of a homodimer. The encoded protein controls the expression of multiple genes, including hepatocyte nuclear factor 1 alpha, which is a transcription factor that regulates the expression of multiple liver genes. This gene may play a role in the development of the liver, kidney, and intestine. Mutations in this gene are associated with monogenic autosomal dominant non-insulin-dependent type I diabetes. Alternative splicing of this gene results in multiple transcript variants encoding several different subtypes.

[0060] As used herein, the term "hepatocellular carcinoma (HCC)" refers to a primary liver cancer with a high mortality rate. It is the most common malignant tumor globally, especially in Asia, Africa, and southern Europe. In hepatocellular carcinoma, cancer cells are arranged in solid masses, surrounded by dilated blood sinuses. The cancer cells have unclear boundaries, are relatively uniform in size, and have wide cytoplasm. The nucleus is single, round, and the atypia is not obvious. Mitotic figures are rare. Hepatocellular carcinoma (HCC) is the main histological subtype of liver cancer, accounting for 90% of primary liver cancer and being the third most common cause of cancer-related mortality worldwide. Genetics, epigenetic alterations, chronic hepatitis B, hepatitis C virus infection, aflatoxin exposure, smoking, obesity, and diabetes are the main risk factors for liver cancer. The poor prognosis of liver cancer is due to high recurrence and metastasis rates. Transplantation is the most effective treatment for liver cancer, but during the transplantation process, the tumor recurrence and metastasis rates are relatively high.

[0061] As used herein, the term "intrahepatic cholangiocarcinoma" or intrahepatic cholangiocellular carcinoma (ICC) refers to adenocarcinoma originating from the epithelium of secondary bile ducts and their branches. ICC accounts for approximately 10%-15% of primary malignant tumors of the liver. ICC is the second most common primary malignant tumor of the liver after hepatocellular carcinoma, and its incidence has been on the rise in recent years. ICC has no obvious clinical symptoms in the early stage, and most patients have missed the opportunity for surgery when they are diagnosed, so higher requirements are put forward for the early diagnosis and timely treatment of ICC.

[0062] The gross morphology of ICC is divided into three types: mass type, periductal infiltration type, and intraductal growth type. The most common is the mass type, accounting for 60% - 80% of ICC; the periductal infiltration type accounts for 15% - 35%, and can diffusely infiltrate along the biliary tract system and the portal vein system, resulting in biliary stricture and dilation of the surrounding bile ducts; the intraductal growth type accounts for 8% - 29%, mostly showing papillary, polypoid or granular growth, and spreading superficially along the bile duct. The histological and pathological types of ICC include adenocarcinoma, adenosquamous carcinoma, squamous cell carcinoma, mucinous carcinoma, signet ring cell carcinoma and other types. Most ICCs are adenocarcinomas with different degrees of differentiation, which can be divided into high, medium and low differentiation. When occurring in larger bile ducts, papillary structures can be formed. The tumor often has a rich stromal reaction and even local calcification. A varying amount of mucus can be seen in most tumors. Cancer cells often invade the portal area, portal area blood vessels or nerves, and can form intrahepatic metastases or metastasize to local lymph nodes along the lymphatic drainage pathway. The immunohistochemistry of ICC shows that the tumor is positively expressed for CK7 / CK19, mucin, and partially expressed for membrane epithelial antigen, CEA, CK20, while CDX-2, TTF-1, ER, PR, BRST-2, PSA, etc. are all negative.

[0063] As used herein, the term "hepatoblastoma" refers to a malignant embryonal tumor with multiple differentiation patterns. It is composed of fetal epithelial hepatocytes, embryonic cells, and differentiated mesenchymal components. The child has abdominal distension, weight loss, and loss of appetite. Occasionally, there may be nausea, vomiting, and abdominal pain. Jaundice can be seen in a few cases. In rare cases, the tumor cells secrete HCG, leading to precocious puberty, appearance of pubic hair, enlargement of the genitalia, and deepening of the voice, mostly occurring in boys.

[0064] As used herein, the term "RNAi" refers to a phenomenon that is highly conserved during evolution, induced by double-stranded RNA (dsRNA), and results in highly specific degradation of homologous mRNA.

[0065] Characteristics of RNAi: (1) RNAi is a post-transcriptional gene silencing mechanism; (2) RNAi has high specificity and only degrades the mRNA of a single endogenous gene corresponding to its sequence; (3) RNAi has high efficiency in inhibiting gene expression, and the phenotype can reach the level of the deletion mutant phenotype. Moreover, a relatively small amount of dsRNA molecules (the quantity is far less than the quantity of endogenous mRNA) can completely inhibit the expression of the corresponding gene, which is carried out in a catalytic amplification manner; (4) The effect of RNAi in inhibiting gene expression can cross cell boundaries, transmit and maintain signals over long distances between different cells, and even spread throughout the whole organism and be heritable, etc.; (5) dsRNA shall not be shorter than 21 bases, and long-chain dsRNA is also cleaved into siRNA of about 21 bp by Dicer enzyme in the cell, and mRNA cleavage is mediated by siRNA. Moreover, dsRNA larger than 30 bp cannot induce specific RNA interference in mammals, but non-specific and global gene expression is inhibited and apoptosis occurs in cells; (6) ATP dependence: The RNA interference phenomenon decreases or disappears in the sample without ATP, indicating that RNA interference is an ATP-dependent process. It may be that the enzymatic cleavage reactions of Dicer and RISC must be energized by ATP.

[0066] Biological characteristics of RNAi include: (1) Evidence from two aspects of RNAi inhibiting transposon activity suggests that the inhibition of transposon activity is related to siRNA; (2) RNAi defending against virus infection. When studying gene silencing caused by transgenes in Arabidopsis thaliana, it was found that Arabidopsis thaliana with sgs2 / sde1 gene mutations is highly sensitive to virus infection; (3) RNAi participating in the formation and maintenance of heterochromatin; (4) RNAi participating in the developmental regulation and physiological metabolism of the organism. RNAi only inhibits post-transcriptional genes, so RNAi has advantages in the research of organismal developmental biology.

[0067] When exogenous genes such as viral genes, artificially introduced genes, and transposons randomly integrate into the host cell genome and are transcribed using the host cell, some double-stranded RNA (dsRNA) is often produced. The host cell immediately responds to these dsRNAs. The endonuclease Dicer in its cytoplasm cleaves the dsRNA into multiple small fragment RNAs with specific lengths and structures (about 21 - 23 bp), namely siRNAs. The siRNAs are unwound into sense and antisense strands under the action of intracellular RNA helicases. Subsequently, the antisense siRNAs bind to some enzymes in the body (including endonucleases, exonucleases, helicases, etc.) to form an RNA-induced silencing complex (RISC). RISC specifically binds to the homologous region of the mRNA expressed by the exogenous gene. RISC has the function of a nuclease and cleaves the mRNA at the binding site, and the cleavage site is the two ends that complementarily bind to the antisense strand in the siRNA. The cleaved and fragmented mRNA is then degraded immediately, thereby inducing the degradation reaction of the host cell against these mRNAs. siRNAs can not only guide RISC to cleave homologous single-stranded mRNAs, but also serve as primers to bind to the target RNA and synthesize more new dsRNAs under the action of RNA-dependent RNA polymerase (RdRP). The newly synthesized dsRNAs are then cleaved by Dicer to generate a large number of secondary siRNAs, thus further amplifying the effect of RNAi and ultimately completely degrading the target mRNA.

[0068] As used herein, the term "short hairpin RNA (shRNA)" contains a loop structure that can be processed into siRNA and can also specifically degrade target mRNA by complementary binding to the target mRNA sequence. It includes two short inverted repeat sequences separated by a stem-loop sequence, forming a hairpin structure, which is controlled by a polⅢ promoter. Subsequently, 5 - 6 Ts are added as the transcription terminator for RNA polymerase Ⅲ.

[0069] One method of delivering "small interfering RNA" (siRNA) in vivo is to clone the siRNA sequence into a plasmid vector as a "short hairpin". When introduced into an animal, the hairpin sequence is expressed to form a "double-stranded RNA" (dsRNA) and is processed by the RNAi pathway.

[0070] As used herein, the terms "small interference RNA (siRNA)", "short interfering RNA", or "silencing RNA" refer to a double-stranded RNA that is 20 to 25 nucleotides in length and has many different biological uses. siRNA is generated by the cleavage of double-stranded RNA (dsRNA) in cells by RNase III (such as Dicer) into double-stranded RNAs of 21-25 bp in size. The dsRNA can be exogenous, such as viral RNA replication intermediates or artificially introduced dsRNA; or it can be endogenous, such as dsRNA formed by single-stranded RNA in cells under the action of RNA-dependent RNA polymerase. It is known that siRNA is mainly involved in the RNA interference (RNAi) phenomenon and regulates gene expression in a specific manner. In addition, it is also involved in some reaction pathways related to RNAi, such as antiviral mechanisms or chromatin structure changes, and specifically degrades mRNA by complementary binding to the target mRNA. Similar to miRNA and operating within the RNA interference (RNAi) pathway, it interferes with the post-transcriptional degradation of mRNA of a specific gene with a complementary nucleotide sequence, thus preventing translation.

[0071] As used herein, the term "antibody (Ab)" refers to an immunoglobulin molecule that specifically binds to a target antigen or has immunoreactivity, including polyclonal, monoclonal, genetically engineered, and other modified forms of antibodies (including but not limited to chimeric antibodies, humanized antibodies, fully human antibodies, heteroconjugate antibodies (such as bispecific, trispecific, and tetra-specific antibodies, diabodies, tribodies, and tetrabodies), antibody conjugates), and antigen-binding fragments of antibodies (including, for example, Fab’, F(ab’)2, Fab, Fv, rIgG, and scFv fragments). In addition, unless otherwise specified, the term "monoclonal antibody" (mAb) refers to both a complete antibody molecule capable of specifically binding to a target protein and an incomplete antibody fragment (such as Fab and F(ab’)2 fragments, which lack the Fc fragment of the complete antibody (and are cleared more rapidly from the animal circulation), and thus lack Fc-mediated effector functions).

[0072] As used herein, a "full-length antibody" is an antibody having two full-length heavy chains (such as VH-CH1-CH2-CH3 or VH-CH1-CH2-CH3-CH4) and two full-length light chains (VL-CL) and a hinge region, such as an antibody naturally produced by antibody-secreting B cells and a synthetic antibody having the same domains.

[0073] As used herein, the term "antigen-binding fragment" refers to one or more antibody fragments that retain the ability to specifically bind to a target antigen. The antigen-binding function of an antibody can be performed by fragments of a full-length antibody. Antibody fragments can be Fab, F(ab’)2, scFv, SMIP, diabody, triabody, affibody, nanobody, aptamer, or domain antibody. Examples of binding fragments that encompass the "antigen-binding fragment" of an antibody include, but are not limited to: (i) Fab fragment, a monovalent fragment consisting of VL, VH, CL, and CH domains; (ii) F(ab’)2 fragment, a bivalent fragment comprising two Fab fragments linked by a disulfide bond in the hinge region; (iii) Fab fragment consisting of VH and CH domains; (iv) Fv fragment consisting of the VL and VH domains of a single arm of an antibody; (V) dAb containing VH and VL domains; (vi) dAb fragment consisting of a VH domain; (vii) dAb consisting of a VH or VL domain; (viii) isolated complementarity-determining region (CDR); and (ix) a combination of two or more isolated CDRs, which may optionally be linked by a synthetic linker. In addition, although the two domains VL and VH of the Fv fragment are encoded by separate genes, these two domains can be joined using recombinant methods by a linker that enables them to be made into a single protein chain in which the VL and VH regions pair to form a monovalent molecule (referred to as single-chain Fv (scFv). These antibody fragments can be obtained using conventional techniques known to those skilled in the art, and these fragments are screened for use in the same manner as full antibodies. Antigen-binding fragments can be produced by recombinant DNA techniques, enzymatic or chemical cleavage of intact immunoglobulins, or in some embodiments by chemical peptide synthesis procedures known in the art.

[0074] As used herein, the term "treatment" refers to surgical or therapeutic treatment that is intended to prevent, slow down (reduce) an undesired physiological change or disorder in a subject, such as the progression of a cell proliferative disorder (such as cancer or an infectious disease). Beneficial or desired clinical outcomes include, but are not limited to, alleviation of symptoms, diminishment of the extent of the disease, stabilization of the disease state (i.e., not getting worse), delay or slowing of disease progression, improvement or palliation of the disease state, and remission (whether partial or complete), whether detectable or not. Subjects in need of treatment include subjects who already have a disorder or disease as well as subjects who are predisposed to having a disorder or disease or who intend to prevent a disorder or disease. When referring to terms such as slow down, alleviate, diminish, palliate, remit, etc., their meanings also include situations such as elimination, disappearance, non-occurrence, etc.

[0075] As used herein, "therapeutic effect" refers to the effect resulting from the treatment of an individual, which modifies, generally ameliorates or improves the symptoms of a disease or medical condition, or cures the disease or medical condition.

[0076] As used herein, "therapeutically effective amount" or "therapeutically effective dose" refers to the amount of a substance, compound, material or composition comprising a compound that, when administered to a subject, is at least sufficient to produce a therapeutic effect. Thus, it is the amount necessary to prevent, cure, ameliorate, arrest or partially arrest the symptoms of a disease or disorder.

[0077] As used herein, "prophylactically effective amount" or "prophylactically effective dose" refers to the amount of a substance, compound, material or composition comprising a compound that, when administered to a subject, will have the desired prophylactic effect, e.g., preventing or delaying the onset or recurrence of a disease or symptoms, reducing the likelihood of the occurrence or recurrence of a disease or symptoms. A fully prophylactically effective dose need not occur by administration of a single dose and may occur only after administration of a series of doses. Thus, a prophylactically effective amount may be administered in one or more administrations.

[0078] As used herein, the terms "subject", "subject" and "patient" refer to an organism that is receiving treatment for a particular disease or disorder as described herein (such as cancer or an infectious disease). Examples of subjects and patients include mammals such as humans, primates, pigs, goats, rabbits, hamsters, cats, dogs, guinea pigs, members of the bovine family (such as domestic cattle, bison, water buffalo, elk and yaks, etc.), cows, sheep, horses and bison, etc. that are receiving treatment for a disease or disorder (such as a cell proliferative disorder such as cancer or an infectious disease).

[0079] II. Embodiments

[0080] In a first aspect, the present disclosure provides the use of an HDAC inhibitor in the preparation of a medicament for treating liver cancer, slowing the progression of liver cancer and / or preventing the recurrence of liver cancer.

[0081] Preferably, the HDAC inhibitor is an HDAC1 / 2 inhibitor.

[0082] Preferably, the HDAC1 / 2 inhibitor includes vorinostat, panobinostat, valproic acid, entinostat, romidepsin, chidamide, TNG260, tacedinaline, cis-BG47, Santacruzamate A or HDAC-IN-53; more preferably, the HDAC1 / 2 inhibitor is romidepsin.

[0083] Preferably, the liver cancer includes hepatocellular carcinoma, intrahepatic cholangiocarcinoma or hepatoblastoma; more preferably, the hepatocellular carcinoma is selected from the HCC pathological type with ICC pathological features or HCC-ICC combined pathological features, or any one of the HCC pathological types characterized by intratumoral pseudoglandular proliferation or intratumoral pseudoglands filled with bile

[0084] In a second aspect, the present disclosure provides a drug combination for treating liver cancer, slowing down the progression of liver cancer and / or preventing the recurrence of liver cancer, which at least includes: a first pharmaceutical preparation that does not contain an HDAC inhibitor as an active ingredient; and a second pharmaceutical preparation, wherein the second pharmaceutical preparation contains an HDAC inhibitor as an active ingredient.

[0085] Preferably, the first pharmaceutical preparation is any one selected from the following drugs: proteasome inhibitors, such as bortezomib, carfilzomib or disulfiram; mTOR pathway inhibitors, such as sirolimus, rapamycin or everolimus; PI3K inhibitors, such as perifosine, CAL101, PX-866, IPI-145 or BAY 80-6946; B-raf inhibitors, such as vemurafenib or sorafenib; JAK2 inhibitors, such as tofacitinib or pacritinib; tyrosine kinase inhibitors (TKIs), such as erlotinib, imatinib, sunitinib, lapatinib, gefitinib, sorafenib, nilotinib, toceranib, bosutinib, neratinib, vandetanib, regorafenib or cabozantinib; multi-target receptor tyrosine kinases (TKIs), such as lenvatinib, donafenib; other protein kinase inhibitors, such as crizotinib or regorafenib; serine / threonine kinase inhibitors, such as Ras / Raf signal inhibitors, such as farnesyl transferase inhibitors; serine protease inhibitors, such as matriptase, hepsin or urokinase inhibitors; intracellular signal transduction inhibitors, such as tipifarnib or perifosine; preparations that inhibit cell signal transduction through MEK and / or AKT kinases; aurora kinase inhibitors, such as AZD1152, PH739358, VX-680, MLN8054, R763, MP235, MP529, VX-528 or AX39459; cyclin-dependent kinase inhibitors, such as CDK2 and / or CDK4 inhibitors; survival signal protein inhibitors, such as ABT-737; HSP90 inhibitors; therapeutic monoclonal antibodies, PD-1 antibodies, such as tislelizumab; anti-EGFR monoclonal antibodies, such as cetuximab, panitumumab or nimotuzumab; anti-ERBB2 monoclonal antibodies, such as trastuzumab or pertuzumab; anti-CD20 monoclonal antibodies, such as rituximab, ofatumumab or veltuzumab; monoclonal antibodies targeting other tumor antigens, such as alemtuzumab, ramucirumab, adecatumumab, oregovomab or ocrelizumab; TRAIL pathway agonists, such as dulanermin (soluble rhTRAIL), apomab, mapatumumab, lexatumumab, conatumumab or tigatuzumab; antibody fragments, bispecific antibodies or bispecific T cell engagers (BiTEs), such as catumaxomab or blinatumomab;Antibody-drug conjugates (ADCs) and other immunoconjugates, such as ibritumomab triuxetan, tositumomab, brentuximab vedotin, gemtuzumab ozogamicin, clivatuzumab tetraxetan, pemtumomab, or trastuzumab emtansine.;

[0086] Preferably, the first pharmaceutical preparation is selected from any one of lenvatinib, regorafenib, donafenib, or tislelizumab.

[0087] Preferably, the HDAC inhibitor in the pharmaceutical combination is an HDAC1 / 2 inhibitor.

[0088] Preferably, in the pharmaceutical combination, the HDAC1 / 2 inhibitor includes vorinostat, panobinostat, valproic acid, entinostat, romidepsin, chidamide, TNG260, tacedinaline, cis-BG47, santacruzamate A, or HDAC-IN-53; more preferably, the HDAC1 / 2 inhibitor is romidepsin.

[0089] Preferably, in the pharmaceutical combination, the pharmaceutical combination is used to treat patients with chemotherapy-resistant liver cancer; more preferably, the chemotherapy resistance is doxorubicin, mitomycin, 5-fluorouracil, or cisplatin resistance.

[0090] Preferably, the liver cancer patient is a recurrent liver cancer patient (for example, a recurrent liver cancer patient with bone and lung metastases).

[0091] Preferably, the liver cancer patient is hepatocellular carcinoma.

[0092] Preferably, the pharmaceutical combination is used to treat FOXP4 and / or KRT19-positive liver cancer.

[0093] Preferably, the liver cancer patient is a mammal, including a human or a non-human mammal.

[0094] Preferably, the FOXP4 and / or KRT19-positive liver cancer includes any one of ICC pathological type liver cancer, HCC-ICC combined pathological type liver cancer, or HCC pathological type liver cancer characterized by intratumoral pseudoglandular proliferation or intratumoral pseudoglands filled with bile.

[0095] Preferably, the HDAC inhibitor is used in combination with any one selected from Lenvatinib, Regorafenib, Donafenib, or Tislelizumab.

[0096] Preferably, the administration mode of the drug combination includes systemic or local administration; more preferably, it is administered through a route selected from parenteral, intraperitoneal, intradermal, intracavitary, intrasynovial, intrathecal, intramuscular injection, intravenous injection, intraarterial injection, oral, buccal, sublingual, transdermal, rectal, subcutaneous, and / or local administration routes.

[0097] Preferably, the HDAC inhibitor is any one selected from fatty acids (such as valproic acid), hydroxamic acids (such as SAHA (vorinostat), Belinostat (PXD101), Panobinostat (LBH589), Givinostat (ITF-2357), Resminostat (4SC-201), Abexinostat (PCI 2478I), benzamides (such as Tubacin, Entinostat (MS-275), Mocetinostat (MGCD0103), Tacedinaline (CI-994), Romidepsin (FK 228), or Apicidin, KD 5170));

[0098] Optionally, the HDAC inhibitor is selected from any one of carboxylates (short-chain fatty acids), hydroxamic acids, epoxy derivatives, electrophilic ketones (thioredoxin), cyclic peptides, benzamides, or hybrid compounds.

[0099] Optionally, the HDAC inhibitor is selected from any one of butyrate, desferrioxamine, phenylbutyrate, valproate, trichostatin, suberoylanilide hydroxamic acid (SAHA), azelaic acid bis-hydroxamic acid (ABHA), scriptaid, pyroxamide, chlamydocin, apicidin, depudecin, MS-275, MGCD0103, PXD101, Daceca, Savisol, LBH589, PCI-24781, or ITF2357.

[0100] In a third aspect, the present disclosure provides a method for treating liver cancer, slowing down the progression of liver cancer, and / or preventing the recurrence of liver cancer, which at least includes: administering a pharmaceutically effective amount of a pharmaceutical preparation containing an HDAC inhibitor as an active component to a mammalian liver cancer patient in need.

[0101] Preferably, the liver cancer includes hepatocellular carcinoma, intrahepatic cholangiocarcinoma, and hepatoblastoma.

[0102] Preferably, the hepatocellular carcinoma includes any one of ICC pathological type liver cancer, HCC-ICC combined pathological type liver cancer, or HCC pathological type liver cancer characterized by intratumoral pseudoglandular proliferation or intratumoral pseudoglands filled with bile.

[0103] Preferably, the HDAC inhibitor is an HDAC1 / 2 inhibitor.

[0104] Preferably, the HDAC1 / 2 inhibitor includes vorinostat, panobinostat, valproic acid, entinostat, romidepsin, chidamide, TNG260, tacedinaline, cis-BG47, Santacruzamate A, or HDAC-IN-53;

[0105] More preferably, the HDAC1 / 2 inhibitor is romidepsin.

[0106] Preferably, the method includes separately administering a pharmaceutically effective amount of a first pharmaceutical preparation and a second pharmaceutical preparation to a mammalian liver cancer patient in need, wherein the first pharmaceutical preparation does not contain an HDAC inhibitor as an active ingredient; the second pharmaceutical preparation contains an HDAC inhibitor as an active ingredient.

[0107] Preferably, in the method, the first pharmaceutical preparation is any one of the following drugs: proteasome inhibitors, such as bortezomib, carfilzomib or disulfiram; mTOR pathway inhibitors, such as sirolimus, rapamycin or everolimus; PI3K inhibitors, such as perifosine, CAL101, PX-866, IPI-145 or BAY 80-6946; B-raf inhibitors, such as vemurafenib, sorafenib; JAK2 inhibitors, such as tofacitinib or pacritinib; tyrosine kinase inhibitors (TKIs), such as erlotinib, imatinib, sunitinib, lapatinib, gefitinib, sorafenib, nilotinib, toceranib, bosutinib, neratinib, vatalanib, regorafenib or cabozantinib; multi-target receptor tyrosine kinases (TKIs), such as lenvatinib, donafenib; other protein kinase inhibitors, such as crizotinib or regorafenib; serine / threonine kinase inhibitors, such as Ras / Raf signal inhibitors, such as farnesyltransferase inhibitors; serine protease inhibitors, such as matriptase, hepsin or urokinase inhibitors; intracellular signal transduction inhibitors, such as tipifarnib or perifosine; preparations that inhibit cell signal transduction through MEK and / or AKT kinases; aurora kinase inhibitors, such as AZD1152, PH739358, VX-680, MLN8054, R763, MP235, MP529, VX-528 or AX39459; cyclin-dependent kinase inhibitors, such as CDK2 and / or CDK4 inhibitors; survival signal protein inhibitors, such as ABT-737; HSP90 inhibitors; therapeutic monoclonal antibodies, PD-1 antibodies, such as tislelizumab; anti-EGFR monoclonal antibodies, such as cetuximab, panitumumab or nimotuzumab; anti-ERBB2 monoclonal antibodies, such as trastuzumab or pertuzumab; anti-CD20 monoclonal antibodies, such as rituximab, ofatumumab or veltuzumab; monoclonal antibodies targeting other tumor antigens, such as alemtuzumab, labetuzumab, adecatumumab, orregobind or obinutuzumab; TRAIL pathway agonists, such as dulanermin (soluble rhTRAIL), apomab, mapatumumab, lexatumumab, conatumumab or tigatuzumab; antibody fragments, bispecific antibodies or bispecific T cell engagers (BiTEs), such as catumaxomab or blinatumomab;Antibody-drug conjugates (ADCs) or other immunoconjugates, such as ibritumomab triuxetan, tositumomab, brentuximab vedotin, gemtuzumab ozogamicin, clivatuzumab tetraxetan, pemtumomab or trastuzumab emtansine.;

[0108] Preferably, the first pharmaceutical preparation is any one selected from Lenvatinib, regorafenib, donafenib or tislelizumab.

[0109] Preferably, the second pharmaceutical preparation is an HDAC inhibitor, and more preferably, an HDAC1 / 2 inhibitor.

[0110] Preferably, the HDAC1 / 2 inhibitor in the method includes vorinostat, panobinostat, valproic acid, entinostat, romidepsin, chidamide, TNG260, tacedinaline, cis-BG47, Santacruzamate A or HDAC-IN-53;

[0111] More preferably, the HDAC1 / 2 inhibitor is romidepsin.

[0112] Preferably, the HDAC inhibitor is used in combination with any one selected from Lenvatinib, regorafenib, donafenib or tislelizumab.

[0113] Optionally, the administration includes systemic or local administration; more preferably, it is administered through a route selected from parenteral, intraperitoneal, intradermal, intracavitary, intrasynovial, intrathecal, intramuscular injection, intravenous injection, intraarterial injection, oral, buccal, sublingual, transdermal, rectal, subcutaneous and / or local administration routes.

[0114] Optionally, the HDAC inhibitor is any one selected from fatty acids (such as valproic acid), hydroxamic acids (such as SAHA (vorinostat), Belinostat (PXD101), Panobinostat (LBH589), Givinostat (ITF-2357), Resminostat (4SC-201), Abexinostat (PCI 2478I), benzamides (such as Tubacin, Entinostat (MS-275), Mocetinostat (MGCD0103), Tacedinaline (CI-994), Romidepsin (FK 228), Apicidin or KD 5170).

[0115] Optionally, the HDAC inhibitor is any one selected from carboxylates (short-chain fatty acids), hydroxamic acids, epoxy derivatives, electrophilic ketones (thioredoxin), cyclic peptides, benzamides or hybrid compounds.

[0116] Optionally, the HDAC inhibitor is any one selected from butyrate, desferrioxamine, phenylbutyrate, valproate, trichostatin, suberoylanilide hydroxamic acid (SAHA), azelaic acid bis-hydroxamic acid (ABHA), scriptaid, pyroxamide, chlamydocin, apicidin, depudecin, MS-275, MGCD0103, PXD101, Daceca, Savisol, LBH589, PCI-24781 or ITF2357.

[0117] III. Examples

[0118] Samples, reagents, experimental operation methods and computer algorithms used in the following examples:

[0119] Human tissue specimens

[0120] The HCC specimens for the PDX model were from the First Affiliated Hospital of Zhejiang University and were approved by the hospital ethics committee. Written informed consent was obtained from the patients and the patient's party. 5-week-old BALB / c nude mice were purchased from Shanghai SLAC Laboratory Animal Co., Ltd.

[0121] Animal feeding

[0122] Standard laboratory chow for mice was purchased from Xietong Biotech and fed ad libitum. The humidity in the SPF animal room was 45% - 60%, and the light / dark cycle was 12 h (7:00 am - 7:00 pm). Mice were euthanized by cervical dislocation or carbon dioxide. Animal care was provided according to the regulatory standards of the Laboratory Animal Center of Zhejiang University. All animal experimental protocols were approved by the Animal Care and Use Committee of Zhejiang University (ZJU20210073).

[0123] Hydrodynamic tail vein injection

[0124] Hydrodynamic tail vein injection was performed as described previously. Plasmids for tail vein injection were prepared using the Qiagen EndoFree Maxi kit and diluted in sterile Ringer's buffer before injection. Specifically, 4-week-old male ICR mice received 50 μg (25 μg each of RAS, MYC, or CTNNB1) of total transposon plasmid and 10 μg of Hyper-PB transposase plasmid with a volume equal to 10% of the mouse body weight for the drug treatment experiment. After tumor formation, the mice were randomly assigned to receive treatment with vehicle, Lenvatinib (10 mg / kg, oral), Romidepsin (1 mg / kg, intraperitoneal injection), or a drug combination every 2 days, where each compound was administered at the same dose and schedule as the single drug. Survival curve analysis: Treatment was continued for 30 days, and survival time was analyzed using the Kaplan-Meier curve. Animals were euthanized within the designed time. In the rescue experiment, 95 μg of total plasmid (containing 25 μg of RAS and shRNA, 25 μg of MYC or CTNNB1, 25 μg of plasmid for re-expression, and 20 μg of Hyper-PB transposase plasmid) was injected. When obvious symptoms of tumor occurrence appeared, such as abdominal distension, lethargy, or behavioral changes, such as increased eating, getting out of bed, excretion, defecation, or breathing intensity, the animals were euthanized. The liver was photographed and weighed, and then the tissue was fixed or frozen for further processing.

[0125] PDX model experiment

[0126] Tumor tissues surgically resected from 3 patients with liver cancer were used for xenotransplantation. Briefly, patient samples were collected, trimmed, cut into 20 - 30 mm 3 fragments, and implanted subcutaneously into the anterior abdomen of anesthetized 5-week-old male BALB / c nude mice within 5 hours. When the tumor volume reached approximately 800 mm 3When it is time, collect the PDX and re-implant it. After tumor formation (~150 mm3), the mice are randomly divided into solvent, Lenvatinib (3 mg / kg, oral gavage), and / or Romidepsin (0.3 mg / kg, intraperitoneal injection), and administered once every 2 days for a total of 30 days. The tumor volume based on caliper measurement is calculated using the modified ellipsoid formula: tumor volume = 1 / 2 length × width 2 The mice are sacrificed 30 days after treatment.

[0127] Western blotting

[0128] Perform Western blotting according to the standard protocol. Briefly, homogenize the tissue with tissue lysis buffer (20 mM pH 7.5 Tris-HCl, 1 mM EDTA, 1 mM EGTA, 2% SDS, 150 mM NaCl, 0.1 mM DTT, 1 mM PMSF, 1 mM Na3VO4, 50 mM NaF, and protease inhibitor mixture), and collect the cells with cell lysis buffer (50 mM pH 6.8 Tris-HCl, 1% SDS). Then, separate the lysates by SDS-PAGE and transfer them to PVDF membranes. Block the membranes with 5% milk and incubate overnight with the required primary antibody at 4°C. Then, wash the membranes with 1×TBST and incubate with the HRP-conjugated secondary antibody for 1.5 hours at room temperature. Detect the proteins using a homemade ECL detection reagent or a commercial kit (Thermo-Scientific).

[0129] Quantitative reverse transcription PCR

[0130] Extract total cellular RNA using TRIzol reagent. Subsequently, synthesize cDNA using the first-strand synthesis system according to the manufacturer's instructions. Perform quantitative PCR analysis of the cDNA using SYBR Green and gene-specific primers. Analyze the results and use the 2–△△Ct method. Use succinate dehydrogenase subunit A (Sdha) or hypoxanthine phosphoribosyltransferase 1 (HPRT1) as the internal control.

[0131] Immunofluorescence staining and imaging

[0132] Fix the cells with 4% paraformaldehyde for 15 min, wash three times with PBS, permeabilize with 0.1% Triton X-100 for 5 min, wash three times with PBS, block with 3% BSA in PBS for 30 min, and incubate for 2 h at room temperature or overnight at 4°C. After washing, add the fluorophore-conjugated secondary antibody at a 1:1000 dilution at room temperature and incubate for another 2 hours. After washing, mount the slides with a coverslip using an anti-fade mounting medium with DAPI. Images are taken with an LSM 880 confocal microscope (Zeiss).

[0133] HE staining and immunohistochemistry

[0134] The liver was fixed at room temperature in 10% neutral buffered formalin for 18 - 24 hours and processed for embedding according to the standard protocol. Liver sections were dewaxed with xylene and gradient ethanol solutions. Tissue sections were stained with hematoxylin - eosin (HE). Immunohistochemical analysis: Sections were boiled in extraction solution for 40 min, incubated in 3% H2O2 for 30 min, and blocked with 10% goat serum in PBS. Sections were stained overnight at 4°C with specific antibodies using the avidin - biotin complex system. Signals were detected using an ABC kit, with 3,3'-diaminobenzidine (DAB) as the chromogenic substrate. Nuclei were counterstained with hematoxylin. Fluorescent multiplex immunohistochemistry was performed using a multiplex IHC kit according to the manufacturer's protocol. Briefly, sections were dewaxed, microwaved at 100% power for 50 seconds in antigen retrieval buffer, microwaved at 10% power for 15 minutes, blocked at room temperature in opal antibody diluent / block for 10 minutes, incubated overnight at 4°C with specific primary antibodies, incubated at room temperature with secondary horseradish peroxidase - conjugated antibody polymer HRP Ms+Rb for 20 minutes, and incubated with fluorescent working solution for 20 min. Sections were rinsed with 1×TBST buffer between staining steps and the antibodies on the sections were stripped between each round of staining by microwaving in antigen retrieval buffer. After the last microwave treatment, the slides were stained with DAPI for 5 minutes and then mounted. Image acquisition was performed using an LSM 880 confocal microscope.

[0135] Quantification and statistical analysis

[0136] GraphPad Prism was used for graphical representation and statistical analysis. Statistical methods were not used to estimate the sample size. Unless otherwise stated, standard two - tailed unpaired t - tests were used for statistical analysis of two groups. The experimental replicates were described in the legends. The results were consistent among replicates.

[0137]

[0138]

[0139] Example 1. KRT19 - HDAC1 inhibits HNF4A expression and liver differentiation through histone deacetylation

[0140] In this example, high - throughput sequencing methods such as ChIP - seq and RNA - seq were used to explore the downstream genes of HDAC1 and KRT19, and to study how KRT19 regulates the expression of downstream genes through HDAC1, thereby affecting the development of liver cancer.

[0141] (1) Construct a KRT19 knockout HepG2 cell line. Using the CRISPR-Cas9 system, two gRNAs targeting the KRT19 gene were designed (sgKRT19#1 CGCGCGCCCAGCATTCACGG (SEQ ID No.1), sgKRT19#2 CGGAGGACACGGATACGCCG (SEQ ID No.2)), which were constructed into the pep-KO vector to obtain a recombinant plasmid expressing the gRNA targeting the KRT19 gene and the cas9 protein.

[0142] (2) Transfect the above plasmid and the pep-KO plasmid (sgNT) expressing non-target gRNA (CACCGGCGGGCAGAACGACCCTGAC (SEQ ID No.3)) into HepG2 cells. After monoclonal selection, KRT19 knockout cells (sgKRT19#1 and #2) were obtained.

[0143] (3) Perform ChIP-seq in sgNT, sgKRT19#1, and sgKRT19#2 cells using H3K9ac and H3K27ac antibodies. Perform ChIP-seq in sgNT and sgKRT19#1 cells using the KRT19 antibody. Perform ChIP-seq in sgNT cells using the HDAC1 antibody.

[0144] (4) After obtaining the data in (3), the data analysis method is as follows: Use Trim Galore (version 0.6.6) and the parameter "-q 20 - paired" to process the raw data to remove adapters and low-quality sequences. Then, use Bowtie2 (version 2.4.2) to map the trimmed data to the human reference genome (hg38). Use SAMtools (version 1.11) to convert the output SAM file to a sorted BAM file. Use Picard's MarkDuplicates tool (version 2.23.3) to remove PCR duplicates with the parameter "--REMOVE duplicates = true". Use MACS2 (version 2.2.7.1) and the parameter "-nomodel -f BAMPE -g hg" to identify peaks. For H3K27ac and H3K9ac modifications, specify the parameter "--wide" to identify broad peaks. The genome coverage bigwig file is generated by BEDtools (version 3.5.0) genomecov and bedGraphToBigWig (version 4) with the parameter "-scale 1000000 / (the number of reads mapped to the dm6 genome)".

[0145] (5) The signals from the transcription start site (TSS) to the transcription end site (TES) of all genes in three types of cells, sgNT, sgKRT19#1, and sgKRT19#2, were plotted. It can be seen that histone acetylation in the genome was enhanced after KRT19 KO ( Figure 1 a) in []. The signal distribution across genes in WT and KRT19-knockout HepG2 cells is shown at the top. The heatmap is as follows.

[0146] (6) Similar to the distribution map in Figure 1 a, the distribution maps of HDAC1 and KRT19 were also plotted ( Figure 1 b) in [].

[0147] (7) The distribution of the binding signals of KRT19 and HDAC1 relative to different genomic regions was counted ( Figure 1 c) in []) and the distributions of H3K9ac and H3K27ac ( Figure 1 d) in []).

[0148] (8) The Venn diagram drawn by VennDiagram (version 1.7.1) shows the overlap of ChIP-seq peaks of KRT19, HDAC1, H3K9ac, and H3K27ac from HepG2 cells ( Figure 1 e) in []).

[0149] (9) Construct the recombinant plasmids of the liver cancer induction group, the Krt19 knockdown group, and the rescue group. Using the DAI plasmid as a vector, insert the Piggybac transposase (PB Transposase, Genbank ID: JX017375.1, with an HA tag with the amino acid sequence MYPYDVPDYA (SEQ ID No. 6) added at the N-terminus) gene, or the CTNNB1 gene (HA-CTNNB1 is obtained by mutating the S at positions 33 and 37 to A based on the amino acid sequence of GenPept ID: NP_001895), to obtain the Piggybac recombinant plasmid and the CTNNB1 recombinant plasmid for inducing liver cancer. Using the DAI plasmid as a vector, insert two shRNA genes (CCGGCTCCCTCGACTTGTCAATAAACTCGAGTTTATTGACAAGTCGAGGGAGTTTTTC (SEQ ID No. 4) (1#) and CCGGGCCAGACCTCAGCTATGTCTTCTCGAGAAGACATAGCTGAGGTCTGGCTTTTTC (SEQ ID No. 5) (2#)) and the RAS gene (simultaneously expressing shRNA targeting Krt19, the HA-RAS nucleotide sequence is obtained by mutating the G at position 12 to V based on the amino acid sequence of GenPept ID: NP_002515, with an HA tag with the amino acid sequence MYPYDVPDYA (SEQ ID No. 6) added at the N-terminus) to obtain the Krt19 knockdown recombinant plasmid. Similarly, using the DAI plasmid as a vector, insert the two non-target shRNAs and RAS described in step (1) to obtain the recombinant plasmid of the control knockdown group.

[0150] Adopt the high-pressure liquid injection method to inject different recombinant plasmids into mouse liver cells to construct different experimental groups. The specific injection scheme is as follows:

[0151] The shNT+Vec (NT, Non-target; Vec, vector) group: Inject the recombinant plasmid of the control knockdown group, the CTNNB1 recombinant plasmid, and the DAI empty vector; The shKrt19+Vec group: Inject the Krt19 knockdown recombinant plasmid, the CTNNB1 recombinant plasmid, and the DAI empty vector.

[0152] For the above two groups of mice, take three mice from each group, take one tumor from each mouse, extract total RNA, and then perform RNA-seq.

[0153] The RNA-seq data analysis process is as follows. The raw data is trimmed using Trim Galore (version 0.6.6) with the parameter "-q 20 -paired" to remove adapters and low-quality sequences. Then, the trimmed data is mapped to the mouse (mm9) reference genome using STAR (version 2.7.7a). The output SAM file is converted to a sorted BAM file using SAMtools (version 1.11). The expression matrix is counted using featureCount (version 2.0.1) and normalized to fragments per kilobase of exon per million mapped reads using StringTie (version 2.1.7). DESeq2 (version 1.34.0) is used to calculate differential genes, with the threshold set to log2(fold change) > 1 and p < 0.05.

[0154] (10) As shown in a of Figure 2 , the Venn diagram shows the genes that are upregulated in the shKrt19+Vec group compared to the NT+Vec group in (10), and the KRT19-HDAC1 target genes in (9) (promoters / enhancers occupied by KRT19 and HDAC1, highly acetylated after KRT19 KO). Finally, 97 downstream target genes of KRT19-HDAC1 were obtained, among which 3 are liver differentiation-related genes HFN4A, RXRA, and PPARA.

[0155] (12) Use the IGV software to browse the peak maps of all samples in (3). Figure 2 As shown in b of

[0156] , the signal enrichment near the HNF4A locus is shown. It can be seen that HDAC1 and KRT19 bind to the promoter and enhancer regions of HNF4A, and the signals in these regions are significantly increased in the sgKRT19#1 and sgKRT19#2 groups compared to the sgNT group. This indicates that after KRT19 knockout, the histone acetylation level in the promoter and enhancer regions of HNF4A increases, which explains why HNF4A increases after KRT19 knockdown. Figure 2 Based on this, ChIP-qPCR primers were designed for the promoter region of HNF4A (upstream primer: CACCTCCCCGTGTGTTTCTT (SEQ ID No.7), downstream primer: TAGGGAAGCGGTCACATTGC (SEQ ID No.8)) and the enhancer region (upstream primer: AGTTTGGTCAGTGGTTGGGG (SEQ ID No.9), downstream primer: GTCGTGGAGGAAAGAAGCCA (SEQ ID No.10)), and detected using qPCR. The results are consistent with the trends in the IGV software ( Figure 2 as shown in b and c of

[0157] (13) Using the pLVX plasmid as a vector, the KRT19 gene (NCBI Reference Sequence ID is NP_002267.2) was inserted to obtain a lentiviral recombinant plasmid expressing KRT19. 293T cells were used to package the virus, which was then used to infect the sgNT, sgKRT19#1, and sgKRT19#2 cells in step (1), ultimately obtaining 5 types of cells, namely NT+vec, NT+sgKRT19#1, KRT19+sgKRT19#1, NT+sgKRT19#2, and KRT19+sgKRT19#2.

[0158] RT-qPCR primers targeting human HNF4A (forward primer: ATCAGAAGGCACCAACCTCA (SEQ ID No.11), reverse primer: TTGTCTTTGTCCACCACGCA (SEQ ID No.12)), PPARA (forward primer: GACTTATCCTGTGGTCCCCG (SEQID No.13), reverse primer: CATCCCGACAGAAAGGCACT (SEQ ID No.14)), and RXRA (forward primer: AACATTTCCTGCCGCTCGAT (SEQ ID No.15), reverse primer: AGCTGATGACCGAGAAAGGC (SEQ IDNo.16)) were designed. Using RT-qPCR to detect the above 5 types of cells, it was found that the expression of these three genes was upregulated after KRT19 knockout and decreased again after re-supplementation of KRT19 ( Figure 2 c) in

[0159] (14) Similar to (9), using the DAI plasmid as a vector, Ollas-Krt19 (composed of Ollas (N-terminal) with the amino acid sequence MSGFANELGPRLMGK and KRT19 (Genbank ID is EDL02575)) was inserted to obtain a wild-type (WT) Krt19 recombinant plasmid. Using the DAI plasmid as a vector, Ollas-Krt19△19 (composed of Ollas (N-terminal) with the amino acid sequence MSGFANELGPRLMGK and Krt19 (Genbank ID is EDL02575, deleting amino acids at positions 1 - 10 and 41 - 50)) was inserted to obtain a mutant Krt19△19 recombinant plasmid.

[0160] (15) Using the high-pressure liquid injection method, as Figure 3 shown in a of

[0161] shNT + Vec (NT, Non - target; Vec, vector) group: Inject the recombinant plasmids of the control knockdown group, CTNNB1 recombinant plasmid, DAI empty vector, and Piggybac recombinant plasmid;

[0162] shKrt19 + Vec group: Inject the Krt19 knockdown recombinant plasmid, CTNNB1 recombinant plasmid, DAI empty vector, and Piggybac recombinant plasmid;

[0163] shKrt19 + Krt19 WT group: Inject the Krt19 knockdown recombinant plasmid, CTNNB1 recombinant plasmid, wild - type Krt19 recombinant plasmid, and Piggybac recombinant plasmid;

[0164] shKrt19 + Krt19△19 group; Inject the Krt19 knockdown recombinant plasmid, CTNNB1 recombinant plasmid, mutant Krt19 recombinant plasmid, and Piggybac recombinant plasmid.

[0165] (16) Designed shRNAs targeting Foxp4 with nucleotide sequences CCGGGCTGACGCTAAATGAGATTTACTCGAGTAAATCTCATTTAGCGTCAGCTTTTTC (SEQ ID No.17) (1#) and CCGGGCAGGAGAAGTAATGACAAATCTCGAGATTTGTCATTACTTCTCCTGCTTTTTC (SEQ ID No.18) (2#). Using the DAI plasmid as a vector, the above two shRNA genes and the HA-RAS gene (expressing shRNAs targeting Foxp4 back-to-back, the nucleotide sequence of HA-RAS is the amino acid sequence of GenPept ID NP_002515 with the 12th G mutated to V, and an HA tag with the amino acid sequence MYPYDVPDYA (SEQ ID No.6) added at the N-terminus) were inserted to obtain a recombinant plasmid expressing RAS while knocking down Foxp4 (RAS+shFoxp4). Using the DAI plasmid as a vector, the Foxp4 gene (NCBI Reference Sequence ID NP_001104294.1, and an Ollas tag with the amino acid sequence MSGFANELGPRLMGK added at the N-terminus) was inserted to obtain a wild-type FOXP4 recombinant plasmid. Using the DAI plasmid as a vector, the Foxp4 gene (NCBI Reference Sequence ID NP_001104294.1, deleting the 366th (S) and 367th (E) amino acids, and an Ollas tag with the amino acid sequence MSGFANELGPRLMGK added at the N-terminus) was inserted to obtain a mutant FOXP4 (△SE) recombinant plasmid.

[0166] (17) Using the high-pressure liquid injection method, as shown in Figure 3 b below, different recombinant plasmids were injected into mouse liver cells to construct different experimental groups. The specific injection protocol is as follows:

[0167] shNT+Vec (NT, Non-target; Vec, vector) group: Inject the RAS+shNT recombinant plasmid, CTNNB1 recombinant plasmid, DAI empty vector, and Piggybac recombinant plasmid;

[0168] shFoxp4+Vec group: Inject the RAS+shFoxp4 recombinant plasmid, CTNNB1 recombinant plasmid, DAI empty vector, and Piggybac recombinant plasmid;

[0169] shFoxp4 + Foxp4 WT group: injected with RAS + shFoxp4 recombinant plasmid, CTNNB1 recombinant plasmid, wild-type Foxp4 recombinant plasmid, and Piggybac recombinant plasmid;

[0170] shFoxp4 + Foxp4△SE group: injected with RAS + shFoxp4 recombinant plasmid, CTNNB1 recombinant plasmid, mutant Foxp4 recombinant plasmid, and Piggybac recombinant plasmid.

[0171] (18) Designed RT-qPCR primers for mouse Hnf4a gene (forward primer: CATGGATATGGCCGACTACAGC (SEQ ID No.19), reverse primer: ACGCTCCTCCTGAAGAACCC (SEQ ID No.20)), Ppara (forward primer: AGCTTTGGTTTTGCAGACTAC (SEQ ID No.21), reverse primer: TCACATGCGTGAACTCCGTA (SEQ ID No.22)), and Rxra (forward primer: GGAAATATGGCCTCCTTCACCA (SEQ ID No.23), reverse primer: AGTCCTTGTTGTCTCGGCA (SEQ ID No.24)). Used RT-qPCR to detect the mouse liver cancer samples in (15 and 17), and it was found that the expression of these three genes was inhibited by KRT19 and FOXP4 ( Figure 3 in c) of

[0172] (15) To further verify the conservation of the FOXP4 - KRT19 - H3K27ac (substrate of HDAC1) - HNF4A regulatory axis in human liver cancer samples. Used FOXP4 antibody, KRT19 antibody, H3K27ac antibody, Histone3 (H3) antibody, HNF4A antibody, and Actin antibody to detect 49 pairs of human liver cancer samples (tumor and adjacent non-tumor tissues, Figure 3 in d) of Figure 3 in e) of

[0173] (16) To further verify the conservation of the FOXP4-KRT19-HNF4A / PPRAP / RXRA regulatory axis in human liver cancer samples, two published transcriptome datasets of human liver cancer samples (GSE124751 and TCGA LIHC) were analyzed using the Heatmap data package. It was found that in the GSE124751 dataset, 33 out of 206 patients showed high expression of FOXP4 and KRT19, while low expression of HNF4A, RXRA, and PPARA ( Figure 3 f in Figure 3 ), and in TCGA LIHC, 45 out of 371 patients showed this trend (

[0174] g in

[0175] ). In addition, all patients were classified according to the Hoshida_S classification. It was found that these 33 patients in GSE124751 and 45 patients in TCGA LIHC were both classified into the S1 category, which is characterized by poorly differentiated liver cancer. Therefore, liver cancer patients with high expression of FOXP4 and KRT19 have the characteristics of low expression of hepatocyte genes (HNF4A, PPARA, RXRA) and low differentiation.

[0174] Example 2. HDAC1 inhibitor inhibits KRT19- and FOXP4-positive liver cancer

[0175] In this example, a mouse liver cancer model and a PDX mouse liver cancer model constructed by a multiplex genome editing strategy were treated with lenvatinib and romidepsin, and the significant efficacy of the combined treatment of lenvatinib and romidepsin on KRT19-positive tumors was studied (as Figure 4 shown), including the following steps:

[0176] (1) Construct a recombinant MYC plasmid for the liver cancer induction group to induce MYC+RAS-type mouse liver cancer. Using the DAI plasmid as a vector, the MYC gene (UniProtKB ID is P01106.2, and an HA tag with the amino acid sequence MYPYDVPDYA (SEQ ID No. 6) is added to the N-terminus) was inserted to obtain the MYC recombinant plasmid for inducing liver cancer.

[0177] (2) Different recombinant plasmids were injected into mouse liver cells by high-pressure liquid injection to construct different experimental groups. The specific injection schemes are as follows:

[0178] MYC+RAS group: MYC recombinant plasmid, RAS recombinant plasmid, Piggybac recombinant plasmid.

[0179] CTNNB1+RAS group: CTNNB1 recombinant plasmid, RAS recombinant plasmid, Piggybac recombinant plasmid.

[0180] (3) Two types of mouse liver cancer models obtained in step (2) were sacrificed, and after laparotomy to remove the liver, WB samples were prepared by grinding. For each type of liver cancer, 3 mice were taken, and 2 tumors were taken from each mouse, numbered 1-6 accordingly.

[0181] The above samples were detected by WB using Foxp4, H3K9ac, H3K14ac, H3K27ac, Histone3 (H3), and Actin antibodies. As Figure 4 shown in a of [reference], it can be seen that in MYC+RAS tumors, the expressions of Foxp4 and KRT19 are lower than those in CTNNB1+RAS, while H3K9ac, H3K14ac, and H3K27ac are higher than those in CTNNB1+RAS.

[0182] (4) Drug treatment was started on day 41 or 21 after injection in step (2) for CTNNB1+RAS / MYC+RAS, and the survival curve was traced. The experimental time line design is shown in Figure 4 b of [reference].

[0183] The specific implementation details are as follows. For the two types of tumors, 4 experimental groups were set up for each: control group (Veh), lenvatinib (Len) treatment group, romidepsin (Rom) treatment group, and lenvatinib and romidepsin (Len+Rom) treatment group. There were 20 mice in each group. The mice were randomly assigned to receive lenvatinib (10 mg / kg, by gavage), romidepsin (1 mg / kg, by intraperitoneal injection), or combined medication every 2 days. Each compound was administered at the same dose and schedule as the single drug. Among them, 1 mouse of each type of liver cancer was sacrificed before drug administration, and the liver was removed by laparotomy and photographed to determine whether the size of the liver cancer nodules was suitable for drug administration at this time. The drug administration time is as Figure 4 shown in b of [reference]. After 25 days of drug administration, 4 mice of each of the 4 experimental groups of the two types of liver cancer were sacrificed, the liver was removed by laparotomy and photographed ( Figure 4 c of [reference]) and samples were collected. It can be seen that for the two types of liver cancer, single drug treatment with lenvatinib or romidepsin has a weak inhibitory effect on liver cancer progression, while dual drug treatment with lenvatinib and romidepsin significantly inhibits CTNNB1+RAS liver cancer but has no effect on MYC+RAS liver cancer.

[0184] (5) After 30 days of drug administration, the remaining mice in step (4) stopped drug administration, and the survival time was traced and recorded ( Figure 4 e of [reference]). It can be seen that similar to the results in Figure 4 c of [reference], compared with single drug treatment, dual drug treatment significantly prolonged the survival time of CTNNB1+RAS mice, and the survival curve of the dual drug was better than the theoretically additive effect curve of the dual drug (summation, Figure 4The dashed line in e is prominent, so the dual-drug combination therapy has a synergistic effect. For MYC+RAS type liver cancer, neither single drug nor dual drug is effective.

[0185] (6) Paraffin sections of mouse liver cancer were stained with HA antibody, and ImageJ software was used to quantify the proportion of the HA-positive area in the whole tissue. The results are as Figure 4 shown in d of Figure 4 and are similar to the photographing results in c of

[0186] (7) To measure whether drug treatment has an impact on the quality of life of mice, the body weight of mice was simultaneously tracked ( Figure 4 f in

[0187] (8) To further verify the effectiveness of the combination therapy of lenvatinib and romidepsin on KRT19- and FOXP4-positive liver cancer. Three human liver cancer tissue samples (2 cases were double-positive for KRT19 and FOXP4, and 1 case was double-negative as a control) were used and transplanted into nude mice to construct a PDX mouse liver cancer model.

[0188] For these 3 human liver cancer samples and 3 PDX samples, after paraffin embedding, through multiplex fluorescence immunohistochemistry, they were stained with FOXP4 antibody, FOXP4 antibody, H3K27ac antibody, HNF4A antibody and DAPI dye. The detection results of PDX tissues are as Figure 5 shown in a of Figure 5 and the detection results of human tissues are as

[0189] (9) Similar to the above drug treatment settings, for 3 PDX mice, a control group, a lenvatinib treatment group, a romidepsin treatment group, and a lenvatinib and romidepsin treatment group were set up, with 5 mice in each group.

[0190] To conduct the drug treatment experiment, a sufficient number of mice need to be prepared. Using the PDX tissues obtained in step (8), when their size is about 800 mm 3 , after the mice were sacrificed, the PDX tissues were taken out and transplanted into new nude mice again. When the tumor size is about 150 mm 3 , each group was treated with drugs for 30 days, lenvatinib (3 mg / kg, oral gavage) and / or romidepsin (0.3 mg / kg, intraperitoneal injection), every 2 days for 30 consecutive days.

[0191] (10) After 30 days of drug treatment, the mice were treated, the PDX tissues were taken out, photographed ( Figure 5 c in Figure 5In d), measure the size using a vernier caliper and collect the samples. The tumor volume calculation formula is as follows: Tumor volume = 1 / 2 length × width 2 . The results are shown in Figure 5 In e) of [reference], for the two cases of KRT19 and FOXP4 double-positive liver cancer (PDX1 and PDX2), lenvatinib and romidepsin monotherapy groups had slight efficacy, while the combination treatment group significantly inhibited liver cancer. For PDX3 with KRT19 and FOXP4 double-negative liver cancer, neither single drug nor dual drug was effective. This result is consistent with the treatment effect of the mouse liver cancer model constructed by the multiple genome editing strategy.

[0192] (11) Stain the paraffin sections of the above 3 PDX samples with HepPar1 antibody, and use ImageJ software to quantify the signal intensity (H score, (1×% low positive)+(2×% positive)+(3×% high positive)). The results are shown in Figure 6 In a) of [reference], it can be seen that in PDX1 and PDX2, dual drug treatment significantly increased HepPar1 expression, while there was no effect in PDX3. This indicates that for KRT19-positive liver cancer such as PDX1 and PDX2, after combined treatment with lenvatinib and romidepsin, the liver cancer differentiated.

[0193] (12) To further verify that the combined treatment of lenvatinib and romidepsin affects the expression of liver genes, RT-qPCR primers were designed for human HNF4A, CYP7A1 (forward primer: CTTCTGCGAAGGCATTTGGG (SEQ ID No.25), reverse primer: GTGTGTCCCGCCTTGTAAGA (SEQ ID No.26)), FABP1 (forward primer: ATCGTGCAGAATGGGAAGCA (SEQ ID No.27), reverse primer: TATGTCGCCGTTGAGTTCGG (SEQ ID No.28)) and APOC3 (forward primer: GGTTACATGAAGCACGCCAC (SEQ ID No.29), reverse primer: CACGGCTGAAGTTGGTCTGA (SEQ ID No.30)) genes. Use RT-qPCR to detect the above 3 PDX samples. The results show that for PDX1 and PDX2, the combined treatment of lenvatinib and romidepsin significantly increased the expression of these 4 genes ( Figure 6 in b) of [reference]).

[0194] The technical features of the above-described embodiments can be combined arbitrarily. For the sake of brevity of description, not all possible combinations of the various technical features in the above embodiments are described. However, as long as there is no contradiction in the combination of these technical features, it should be considered as the scope described in this specification.

[0195] The above-described embodiments merely represent several implementation manners of the present disclosure. The description thereof is relatively specific and detailed, but it should not be construed as a limitation on the scope of the invention patent. It should be noted that for those of ordinary skill in the art, without departing from the concept of the present disclosure, several modifications and improvements can still be made, and these all belong to the protection scope of the present disclosure. Therefore, the protection scope of the patent of the present disclosure shall be subject to the appended claims.

Claims

1. Use of an HDAC inhibitor in the preparation of a medicament for treating liver cancer, slowing the progression of liver cancer and / or preventing recurrence of liver cancer.

2. The use according to claim 1, wherein the HDAC inhibitor is an HDAC1 / 2 inhibitor.

3. The use according to claim 2, wherein the HDAC1 / 2 inhibitor comprises vorinostat, panobinostat, valproic acid, entinostat, romidepsin, chidamide, TNG260, tacedinaline, cis - BG47, Santacruzamate A or HDAC - IN - 53; more preferably, the HDAC1 / 2 inhibitor is romidepsin.

4. The use according to claim 1, wherein the liver cancer comprises hepatocellular carcinoma, intrahepatic cholangiocarcinoma or hepatoblastoma.

5. The use according to claim 4, wherein the hepatocellular carcinoma is selected from HCC pathological types with ICC pathological features or HCC - ICC combined pathological features, or, any one of HCC pathological types characterized by intratumoral pseudoglandular proliferation or intratumoral pseudoglands filled with bile.

6. A pharmaceutical combination for treating liver cancer, slowing the progression of liver cancer and / or preventing recurrence of liver cancer, which at least comprises: A first pharmaceutical preparation that does not contain an HDAC inhibitor as an active ingredient; and A second pharmaceutical preparation that contains an HDAC inhibitor as an active ingredient.

7. The pharmaceutical combination according to claim 6, wherein the first pharmaceutical preparation is any one of the following drugs: proteasome inhibitors, such as bortezomib, carfilzomib or disulfiram; mTOR pathway inhibitors, such as sirolimus, rapamycin or everolimus; PI3K inhibitors, such as perifosine, CAL101, PX-866, IPI-145 or BAY 80-6946; B-raf inhibitors, such as vemurafenib, sorafenib; JAK2 inhibitors, such as tofacitinib or pacritinib; tyrosine kinase inhibitors (TKIs), such as erlotinib, imatinib, sunitinib, lapatinib, gefitinib, sorafenib, nilotinib, toceranib, bosutinib, neratinib, vandetanib, regorafenib or cabozantinib; multi-target receptor tyrosine kinases (TKIs), such as lenvatinib or donafenib; other protein kinase inhibitors, such as crizotinib or regorafenib; serine / threonine kinase inhibitors, such as Ras / Raf signal inhibitors, such as farnesyltransferase inhibitors; serine protease inhibitors, such as matriptase, hepsin or urokinase inhibitors; intracellular signal transduction inhibitors, such as tipifarnib or perifosine; preparations that inhibit cell signal transduction through MEK and / or AKT kinases; aurora kinase inhibitors, such as AZD1152, PH739358, VX-680, MLN8054, R763, MP235, MP529, VX-528 or AX39459; cyclin-dependent kinase inhibitors, such as CDK2 and / or CDK4 inhibitors; survival signal protein inhibitors, such as ABT-737; HSP90 inhibitors; therapeutic monoclonal antibodies, PD-1 antibodies, such as tislelizumab; anti-EGFR monoclonal antibodies, such as cetuximab, panitumumab or nimotuzumab; anti-ERBB2 monoclonal antibodies, such as trastuzumab or pertuzumab; anti-CD20 monoclonal antibodies, such as rituximab, ofatumumab or veltuzumab; monoclonal antibodies targeting other tumor antigens, such as alemtuzumab, ramucirumab, adecatumumab, orgetinib or obinutuzumab; TRAIL pathway agonists, such as dulanermin (soluble rhTRAIL), apomab, mapatumumab, lexatumumab, conatumumab or tigatuzumab; antibody fragments, bispecific antibodies or bispecific T cell engagers (BiTEs), such as catumaxomab or blinatumomab;Antibody-drug conjugates (ADCs) or other immunoconjugates, such as ibritumomab triuxetan, tositumomab, brentuximab vedotin, gemtuzumab ozogamicin, clivatuzumab tetraxetan, pemtumomab or trastuzumab emtansine.; 8. The pharmaceutical combination according to claim 6, wherein the first pharmaceutical preparation is selected from any one of lenvatinib, regorafenib, donafenib or tislelizumab.

9. The pharmaceutical combination according to claim 6, wherein the HDAC inhibitor is an HDAC1 / 2 inhibitor.

10. The pharmaceutical combination according to claim 9, wherein the HDAC1 / 2 inhibitor comprises vorinostat, panobinostat, valproic acid, entinostat, romidepsin, chidamide, TNG260, tacedinaline, cis - BG47, Santacruzamate A or HDAC - IN - 53; more preferably, the HDAC1 / 2 inhibitor is romidepsin.

11. The pharmaceutical combination according to claim 6, wherein the pharmaceutical combination is used for treating patients with chemotherapy - resistant liver cancer; preferably, the chemotherapy resistance is doxorubicin, mitomycin, 5 - fluorouracil or cisplatin resistance; optionally, the liver cancer patient is a recurrent liver cancer patient; optionally, the liver cancer patient is a hepatocellular carcinoma patient.

12. The pharmaceutical combination according to claim 6, wherein the pharmaceutical combination is used for treating FOXP4 and / or KRT19 - positive liver cancer; Preferably, the FOXP4 and / or KRT19 positive liver cancer includes any one of ICC pathological type liver cancer, HCC-ICC combined pathological type liver cancer, or HCC pathological type liver cancer characterized by intratumoral pseudoglandular proliferation or intratumoral pseudoglands filled with bile.

13. The pharmaceutical composition according to claim 6, wherein, The HDAC inhibitor is used in combination with any one selected from lenvatinib, regorafenib, donafenib, and tislelizumab.

14. The pharmaceutical composition according to claim 6, wherein, The administration mode of the drug combination includes systemic or local administration; more preferably, the administration is carried out through a route selected from parenteral, intraperitoneal, intradermal, intracavitary, intrasynovial, intrathecal, intramuscular injection, intravenous injection, intraarterial injection, oral, buccal, sublingual, transdermal, rectal, subcutaneous and / or local administration routes.

15. The pharmaceutical composition according to claim 6, wherein, The HDAC inhibitor is any one selected from fatty acids (such as valproic acid), hydroxamic acids (such as SAHA (vorinostat), belinostat (PXD101), panobinostat (LBH589, Panobinosta), givinostat (ITF-2357), resminostat (4SC-201, Resminostat), abexinostat (PCI 2478I (abexinostat))), benzamides (such as Tubacin, entinostat (MS-275, entinostat), MGCD0103 (mocetinostat), tacedinaline (CI-994, Tacedinaline), romidepsin (FK 228), apicidin or KD 5170); Optionally, the HDAC inhibitor is selected from any one of carboxylates (short-chain fatty acids), hydroxamic acids, epoxy derivatives, electrophilic ketones, cyclic peptides, benzamides or hybrid compounds; Optionally, the HDAC inhibitor is selected from any one of butyrate, desferrioxamine, phenylbutyrate, valproate, trichostatin, suberoylanilide hydroxamic acid (SAHA), azelaic acid dihydroxamic acid (ABHA), scriptaid, pyroxamide, chlamydocin, apicidin, depudecin, MS-275, MGCD0103, PXD101, Daceca, Savisol, LBH589, PCI-24781 or ITF2357.

Images