Detection method of goat ASAP1 gene insertion or deletion marker and application thereof
By detecting the insertion/deletion polymorphisms of specific loci of goat ASAP1 gene, the problems of low efficiency and high cost of traditional breeding methods are solved, and early breeding and rapid expansion of sheep fighting against brucellosis are achieved, which improves the economic benefits and healthy development of the breeding industry.
Patent Information
- Application Number
- CN202510462839.5
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-04-14
- Publication Date
- 2025-06-24
AI Technical Summary
In the process of goat breeding, infectious diseases such as brucellosis are prone to cause significant losses, and traditional breeding methods are inefficient and costly, making it difficult to effectively screen disease-resistant groups.
Design a detection method for insertion or deletion markers of goat ASAP1 gene, and accurately detect insertion/deletion polymorphisms of specific sites of the ASAP1 gene by PCR amplification and agarose gel electrophoresis technology as a molecular marker for brucellosis.
The rapid, accurate and low-cost detection of the correlation between goat ASAP1 gene and brucellosis resistance is achieved, providing effective DNA markers to assist in selective breeding, and promoting early breeding and rapid expansion of brucellosis-resistant sheep.
Smart Images
Figure CN120193093A_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the technical field of livestock breeding, and particularly relates to a method for detecting insertion or deletion markers of goat ASAP1 gene and its application. Background Art
[0002] Goat breeding, as a traditional animal husbandry, is practiced in various countries around the world. Goat meat and goat dairy products are favored by consumers for their high protein, low fat and rich nutritional value. With the increasing demand for goat products, the scale of the goat breeding industry is constantly expanding. As an important economic animal, the disease resistance of goats directly affects the development level of animal husbandry. However, there are some problems in the process of goat breeding, which may lead to relevant products being unable to enter the market and the breeding efficiency decreasing, such as Brucella infection at present. With the continuous expansion of the goat breeding scale and the increasing number of goats, once infectious diseases such as brucellosis occur, it is easier to cause major losses. Brucellosis, as a zoonosis, not only affects the economic benefits of breeding in the animal husbandry industry, but also poses a great threat to veterinarians and breeding workers. Therefore, exploring genes related to Brucella resistance or susceptibility in goats and screening out groups with high resistance to Brucella can greatly improve the quality of goat feeding management and economic benefits, and promote the healthy development of the breeding industry. Traditional breeding methods mainly analyze and select based on phenotypes, which are slow, costly and inefficient. The molecular marker-assisted breeding technology can make up for these deficiencies. That is, by detecting DNA molecular markers to find gene mutation sites related to target traits, so as to achieve the purpose of selecting target traits. Insertion / deletion markers (InDel) are one of the most common molecular markers, referring to the insertion or deletion of a certain number of nucleotides in the genome. They are widely distributed, stable, accurate and easy to detect in the eukaryotic genome, and play an important role in molecular marker-assisted breeding.
[0003] The ASAP1 gene is a new gene discovered in recent years that may be related to tuberculosis susceptibility. The protein encoded by the ASAP1 gene is an Arf GTPase-activating protein, which has an SH3 domain, ankyrin repeat sequences and a PH domain. These domains enable ASAP1 to participate in a variety of cellular functions, including signal transduction, membrane trafficking, cytoskeleton remodeling, etc. It has been confirmed that ASAP1 is involved in regulating the migration and activation of macrophages and neutrophils, which play a key role in the inflammatory response. The deletion or abnormal expression of ASAP1 may lead to an imbalance in the inflammatory response, thereby affecting the host's disease resistance.
[0004] Therefore, a method for detecting insertion or deletion markers of goat ASAP1 gene and its application are designed to provide a technical solution for the above technical problems. Summary of the Invention
[0005] Based on this, it is necessary to provide a detection method and its application for the insertion or deletion markers of the goat ASAP1 gene to solve the technical problems proposed in the above background art.
[0006] To solve the above technical problems, the present invention adopts the following technical solutions:
[0007] The present invention provides a detection method for the insertion / deletion markers of the goat ASAP1 gene, which is characterized by including the following operations:
[0008] 1) Using the whole genome of the tested Shaanbei white cashmere goat as a template, PCR amplification is performed on the rs655531471 locus and / or the rs652252293 locus of the ASAP1 gene using a primer pair.
[0009] The primer pair for the rs655531471 locus of the ASAP1 gene includes:
[0010] Forward primer: 5’-TTTGAAAACTTCGGGCCGC-3’
[0011] Reverse primer: 5’-TGGGGACGACAACATAAAGCA-3’;
[0012] The amplified fragment contains the 17bp insertion / deletion polymorphism locus at positions g.71407951_71407952 of NC_030809.1:rs655531471 of the ASAP1 gene;
[0013] The primer pair for the rs652252293 locus of the ASAP1 gene includes:
[0014] Forward primer: 5’-CAGGTTCACCATTTGCCTGG-3’
[0015] Reverse primer: 5’-TTTCCAGCGTGTGTAGCAGA-3’;
[0016] The amplified fragment contains the 27bp insertion / deletion polymorphism locus at positions g.71446770_71446796 of NC_030809.1:rs652252293 of the goat ASAP1 gene;
[0017] 2) Perform agarose gel electrophoresis on the PCR amplification product, and determine the genotype of the target locus according to the electrophoresis result.
[0018] Furthermore, the PCR reaction program of the primer pair is:
[0019] Pre-denaturation at 94°C for 5 min, denaturation at 94°C for 30 s, annealing at 59.0°C for 30 s, extension at 72°C for 30 s, for a total of 30 cycles; extension at 72°C for 7 min, storage at 4°C.
[0020] Furthermore, the electrophoresis is all carried out using an agarose gel with a mass concentration of 3%.
[0021] Furthermore, the genotype of the target site is determined according to the electrophoresis results, and the determination method includes:
[0022] 1) For the rs655531471 site:
[0023] Insertion / insertion genotype, denoted as II, shows a single band of 317 bp;
[0024] Insertion / deletion genotype, denoted as ID, shows a double band of 317 bp and 300 bp;
[0025] Deletion / deletion genotype, denoted as DD, shows a single band of 300 bp;
[0026] 2) For the rs652252293 site:
[0027] Insertion / insertion genotype, denoted as II, shows a single band of 224 bp;
[0028] Insertion / deletion genotype, denoted as ID, shows a double band of 224 bp and 197 bp;
[0029] Deletion / deletion genotype, denoted as DD, shows a single band of 197 bp.
[0030] The present invention provides a detection kit for the insertion or deletion markers of the goat ASAP1 gene, including:
[0031] The above primer pair for the rs655531471 site, and / or, the primer pair for the rs652252293 site;
[0032] PCR reaction solution, including Taq DNA polymerase, dNTPs, and buffer.
[0033] Furthermore, the kit further includes: reagents required for 3% agarose gel electrophoresis, DNA molecular weight marker, and positive control sample.
[0034] The present invention provides the application of the above kit in the assistant selection breeding of Shaanbei white cashmere goats against Brucella.
[0035] The present invention provides the application of the rs655531471 locus and / or the rs652252293 locus of the goat ASAP1 gene in the assisted selection breeding of Shaanbei white cashmere goats against Brucellosis.
[0036] Furthermore, the insertion / deletion genotype of the rs655531471 locus is the dominant genotype resistant to Brucellosis;
[0037] The insertion / insertion genotype of the rs652252293 locus is the dominant genotype resistant to Brucellosis.
[0038] Furthermore, the selection breeding includes the following steps:
[0039] (1) Detect the genotypes of the rs655531471 and / or rs652252293 loci of the goat ASAP1 gene;
[0040] (2) Screen the insertion / deletion genotype of the rs655531471 locus and / or the insertion / insertion genotype of the rs652252293 locus as disease-resistant parents;
[0041] (3) Expand the disease-resistant population through genetic breeding.
[0042] Meanwhile, through the above technical solutions, the present invention has at least the following beneficial effects:
[0043] 1. A method for detecting insertion or deletion markers of the goat ASAP1 gene provided by the present invention and its application. According to the goat ASAP1 gene sequence, primers are designed. Using the genomic DNA of Shaanbei white cashmere goats as a template, through PCR amplification, agarose gel electrophoresis and direct sequencing technologies, the insertion / deletion polymorphisms of the rs655531471 and rs652252293 loci of the ASAP1 gene of Shaanbei white cashmere goats can be accurately, quickly and at low cost detected.
[0044] 2. The present invention uses PCR amplification technology to detect the insertion / deletion polymorphisms of the ASAP1 gene of Shaanbei white cashmere goats, and conducts genotype and allele frequency analysis. It is found for the first time that the ASAP1 gene is significantly correlated with the resistance of Shaanbei white cashmere goats to Brucellosis, and can be used as an effective DNA marker for the genetic breeding of Shaanbei white cashmere goats against Brucellosis.
[0045] 3. In the present invention, the rs655531471 and rs652252293 positions can be used as important candidate molecular marker sites for breeding Shaanbei white cashmere goats resistant to Brucella. By screening and combining with the Marker Assisted Selection (MAS) technology, DNA candidate marker sites closely related to the susceptibility or resistance to Brucella are detected, and correlation analysis is carried out based on the gene polymorphism and the susceptibility or resistance to Brucella, so as to early select the Brucella-resistant sheep flock, accelerate the establishment of the Brucella-resistant sheep flock and carry out rapid expansion.
[0046] 4. The risks of the insertion / deletion and deletion / deletion genotypes of the insertion / deletion polymorphic site at the rs655531471 position in the present invention for suffering from Brucella are 0.723 times and 1.229 times that of the insertion / insertion genotype respectively, and the insertion / deletion genotype may be the Brucella-resistant genotype of Shaanbei white cashmere goats; at the same time, the risks of the insertion / deletion and deletion / deletion genotypes of the insertion / deletion polymorphic site at the rs652252293 position for suffering from Brucella are 1.559 times and 1.004 times that of the insertion / insertion genotype respectively, and the insertion / insertion genotype may be the Brucella-resistant genotype of Shaanbei white cashmere goats. BRIEF DESCRIPTION OF THE DRAWINGS
[0047] In order to more clearly illustrate the technical solutions of the embodiments of the present invention, the drawings required for the description of the embodiments will be briefly introduced below. Obviously, the drawings in the following description are some embodiments of the present invention. For those of ordinary skill in the art, other drawings can be obtained based on these drawings without creative efforts.
[0048] Figure 1 Schematic diagram of the product of the primer pair of the present invention for amplifying the rs655531471 position of the ASAP1 gene of Shaanbei white cashmere goats by 3% agarose gel electrophoresis;
[0049] Figure 2 Schematic diagram of the product of the primer pair of the present invention for amplifying the rs652252293 position of the ASAP1 gene of Shaanbei white cashmere goats by 3% agarose gel electrophoresis;
[0050] Figure 3 Sequencing diagram of the PCR amplification product of the rs655531471 position of the ASAP1 gene of the present invention;
[0051] Figure 4 Sequencing diagram of the PCR amplification product of the rs652252293 position of the ASAP1 gene of the present invention;
[0052] Figure 5 Overall schematic diagram of the present invention. Detailed implementation manners
[0053] In order to make the objectives, technical solutions and advantages of the present invention clearer and more understandable, the present invention will be further described in detail below with reference to the accompanying drawings and embodiments. It should be understood that the specific embodiments described herein are only used to explain the present invention and are not used to limit the present invention.
[0054] In order to enable those skilled in the art of this technology to better understand the solution of the present invention, the technical solutions in the embodiments of the present invention will be clearly and completely described below with reference to the accompanying drawings.
[0055] It should be noted that, without conflict, the embodiments in the present invention and the features and technical solutions in the embodiments can be combined with each other.
[0056] It should be noted that similar reference numerals and letters indicate similar items in the following drawings. Therefore, once an item is defined in one drawing, it does not need to be further defined and explained in subsequent drawings.
[0057] Reference Figures 1-5 , a method for detecting an insertion or deletion marker of goat ASAP1 gene and its application are disclosed, wherein, Figure 1 and Figure 2 in, M represents Marker I, Figure 3 in the part marked by the black square indicates a 17bp insertion sequence: NC_030809.1:rs655531471, g.71407951_71407952, and this 17bp insertion sequence is AGTATTGTACTGTAATA, Figure 4 in, the part marked by the black square indicates a 27bp deletion sequence: NC_030809.1:rs652252293, g.71446770_71446796, and this 27bp insertion sequence is CCAGCATGGTGCCTCATTCAGTCGTCA, Figure 5 is Figures 1-4 the binding schematic diagram of.
[0058] The specific implementation manner of this embodiment is as follows:
[0059] The polymorphisms of multiple SNP sites in the ASAP1 gene are associated with the susceptibility to multiple intracellular bacteria such as Mycobacterium tuberculosis in populations such as humans, cattle, and sheep. At the same time, the expression of the immune checkpoint molecule in the ASAP1 gene shows differences during the infection of zebrafish by Mycobacterium marinum, suggesting that ASAP1 plays an important role in the bacterial pathogenic mechanism and the induction of cellular immunity in the body. As an important genetic marker, InDel is a small fragment of DNA with an insertion or deletion length of 5 - 50 bp in the genome. However, there have been no reports on the association between the InDel site polymorphisms of the ASAP1 gene and the susceptibility or resistance to brucellosis in Shaanbei white cashmere goats.
[0060] Referring to the base sequence of the goat ASAP1 gene published in the NCBI database and the Ensembl database (https: / / asia.ensembl.org / index.html), the InDel mutation sites at positions rs655531471 and rs652252293 were selected as candidate genetic variation sites for research.
[0061] The present invention uses the PCR technique to detect the insertion / deletion polymorphisms that may be generated by the mutations at the rs655531471 site and the rs652252293 site of the ASAP1 gene in Shaanbei white cashmere goats, and conducts a correlation analysis with the resistance to brucellosis in Shaanbei white cashmere goats to verify that it can be used as a molecular marker for assistant selection in the breeding of Shaanbei white cashmere goats resistant to brucellosis.
[0062] Experimental steps:
[0063] 1. Experimental drugs and reagents
[0064] Biochemical and biological reagents: ① Taq DNA polymerase; ② Proteinase K; ③ Marker I; ④ Rose Bengal plate agglutination antigen, standard negative serum, standard positive serum;
[0065] Common reagents: The common reagents were purchased from Huamei Engineering Biology Company and were imported and repackaged products: glucose, citric acid, sodium citrate, Tris, EDTA, NaCl, NaOH, KCl, Na2HPO4, KH2PO4, Tris-saturated phenol, isopentyl alcohol, chloroform, absolute ethanol, sodium acetate, sodium dodecyl sulfate (SDS), ethidium bromide (EB), bromophenol blue, dimethylbenzene cyan FF, sucrose, boric acid, acetic acid, agarose, etc.;
[0066] Solutions and buffers: All solutions and buffers were prepared with deionized ultrapure water; the autoclaving conditions were 15 bf / in (1.034×105 Pa), 25 min; the reagent preparation methods were all referred to "Molecular Cloning: A Laboratory Manual" edited by Sambrook et al.
[0067] Solution used for extracting tissue sample DNA:
[0068] ① Public solution used for extracting genomic DNA;
[0069] ②2mol / LNaCl: 11.688g dissolved in water, dilute to 100mL and sterilize under high temperature and high pressure;
[0070] ③ Tissue DNA extraction solution (100 mL): 1 mL of 1 mol / L Tris-HCl (pH 8.0), 20 mL of 0.5 mol / L LEDTA (pH 8.0), 5 mL of 2 mol / L NaCl, and dilute to 100 mL;
[0071] Agarose gel electrophoresis analysis solution:
[0072] ①0.5XTBE buffer: take 10XTBE50mL and dilute to 1000mL;
[0073] ② Loading buffer: contains 0.25% bromophenol blue and 0.25% dimethylbenzocyanate FF, and the solvent is 40.0% (w / v) sucrose aqueous solution.
[0074] 2. Design of primers for the InDel site of the ASAP1 gene of Shaanxi white cashmere goats
[0075] The sequence of goat ASAP1 gene was retrieved from NCBI, and primers capable of amplifying the DNA fragment of candidate InDel sites of ASAP1 gene were designed using Primer5.0. The primer pair capable of amplifying the InDel sites of rs655531471 and rs652252293 in the 5' upstream regulatory region of ASAP1 gene of Shaanxi white cashmere goat was shown in Table 1:
[0076] Table 1 Primers for cashmere goat ASAP1 gene rs655531471 and rs652252293
[0077]
[0078] 3. PCR amplification of the intron fragment of the ASAP1 gene of the northern Shaanxi white cashmere goat to be tested
[0079] Collection of ear tissue samples from Shaanxi white cashmere goats
[0080] The animals used in the experiment were selected from Shaanxi white cashmere goats, with a total of 1145 samples. The sampling time was April 2019. The test goat ear tissue samples were cut with ear clippers, stored in 75% ethanol, and then brought back to the laboratory in an ice box and stored in a -80℃ refrigerator;
[0081] Refer to "Molecular Cloning: A Laboratory Manual" (2002) edited by Sambrook et al. and the following references: Lan Xianyong. Genetic Analysis of Important Functional Genes in Goats and Their Relationships with Economic Traits [D]. Doctoral Dissertation of Northwest A&F University, Yangling, Shaanxi, 2007;
[0082] Detection of DNA by agarose gel electrophoresis
[0083] Refer to "Molecular Cloning: A Laboratory Manual" (2002) edited by Sambrook et al.
[0084] Purification of DNA
[0085] Refer to "Molecular Cloning: A Laboratory Manual" (2002) edited by Sambrook et al.
[0086] Detection of DNA by spectrophotometry
[0087] Use a UV spectrophotometer to measure the OD values of the extracted DNA sample at 260 nm and 280 nm. Calculate the DNA content and the ratio of OD 260 / OD 280 ratio. If the ratio of OD 260 / OD 280 is less than 1.6, it indicates that the sample contains more protein or phenol and should be purified; if the ratio is greater than 1.8, RNA removal should be considered for purification.
[0088] DNA concentration (ng / μL) = 50 × OD 260 value × dilution factor;
[0089] After DNA detection, take out a certain amount and dilute it to 20 ng / μL, store it in a -20°C refrigerator for later use, and store the remaining sample in an -80°C refrigerator.
[0090] 4. Detection of Brucella by Rose Bengal plate agglutination test
[0091] 4.1 Collection of serum from Shaanbei white cashmere goats
[0092] Use a disposable blood collection syringe to collect 3 mL of jugular vein blood from the experimental goats. After standing for 2 hours, the serum is separated out for serological detection of Brucella.
[0093] 4.2 Serological detection of Brucella in Shaanbei white cashmere goats
[0094] The RBPT method was used to conduct serological detection of brucellosis on the separated serum. 20 μL of the tested serum and 20 μL of the rose bengal plate agglutination antigen were taken, gently pipetted repeatedly, and evenly mixed on the rose bengal plate. It was left standing at room temperature for 5 min, and the changes in the serum were observed, with the negative serum used as a control. Different degrees of sandy particles or flocculent agglutination phenomena appeared in the standard positive serum, and there was no change in the standard negative serum. Based on this, the tested serum was judged. To ensure the accuracy of the results, the positive serum was retested. If it still showed positive, it was determined to be infected with Brucella.
[0095] 5. PCR amplification
[0096] The PCR reaction system included 6.5 μL of 2×TaqSuperMix (including Taq DNA polymerase, dNTPs, and optimized reaction buffer, with a concentration of 2X), 0.3 μL each of the upstream and downstream primers (each of the upstream and downstream primers was 10 pmol / μL), 0.7 μL of genomic DNA (with a concentration of 20 ng / μL), and 5.2 μL of deionized water; a total of 13 μL of the PCR amplification system;
[0097] PCR reaction procedure
[0098] The PCR reaction procedure for the primer pair was: pre-denaturation at 94 °C for 5 min, denaturation at 94 °C for 30 s, annealing at 59.0 °C for 30 s, extension at 72 °C for 30 s, for a total of 30 cycles; extension at 72 °C for 7 min, and storage at 4 °C;
[0099] PCR product agarose gel electrophoresis detection and analysis
[0100] 1) Prepare a 3% agarose gel, stain it with ethidium bromide (EB) nucleic acid dye, load 8 μL of the sample, and perform electrophoresis at 120 V for 1 hour;
[0101] 2) After the DNA fragments of different molecular weights were separated clearly, image them on the Invitrogen iBright gel imaging system;
[0102] 3) Analyze the genotype typing according to the results of the agarose gel electrophoresis.
[0103] PCR amplification was performed on the genomic DNA of Shaanbei white cashmere goats with the primer pair, and a fragment containing the rs655531471 site of the goat ASAP1 gene could be amplified. The electrophoresis detection map of the amplified fragment is shown ( Figure 1 ), where II is the insertion / insertion genotype, showing a single band of 317 bp; ID is the insertion / deletion genotype, showing two bands of 317 bp and 300 bp; DD is the deletion / deletion genotype, showing a single band of 300 bp; after sequencing and identification of the amplified fragment, it was found that (the sequencing results are as Figure 2As shown, the actual sequencing sequence is an insertion / deletion of 17bp AGTATTGTACTGTAATA.
[0104] Using primer pairs to perform PCR amplification on Shaanbei white cashmere goats, a fragment containing the rs652252293 site of the Shaanbei white cashmere goat ASAP1 gene can be amplified. The electrophoresis detection diagram of the amplified fragment is shown ( Figure 2 ), where II is the insertion / insertion genotype, showing a single band of 224bp; ID is the insertion / deletion genotype, showing two bands of 224bp and 197bp; DD is the deletion / deletion genotype, showing a single band of 197bp; after sequencing and identification of the amplified fragment (the sequencing results are as Figure 2 shown), the actual sequencing sequence is an insertion / deletion of 27bp CCAGCATGGTGCCTCATTCAGTCGTCA.
[0105] 6. Statistical analysis of the InDel site frequency of the Shaanbei white cashmere goat ASAP1 gene
[0106] Genotype frequency refers to the proportion of the number of a certain genotype in a population to the total number of individuals. The genotype frequencies of the insertion / deletion polymorphic sites at the rs655531471 and rs652252293 sites of the Shaanbei white cashmere goat ASAP1 gene are shown in Table 2.
[0107] Table 2 Allele frequency distribution at the rs655531471 and rs652252293 sites of the Shaanbei white cashmere goat ASAP1 gene
[0108]
[0109] 7. Correlation analysis of the gene effect of the InDel site of the Shaanbei white cashmere goat ASAP1 gene
[0110] Genotype data: Genotype production data identified by agarose gel electrophoresis and sequencing after PCR amplification;
[0111] Production data: Positive and negative data of Brucella melitensis in Shaanbei white cashmere goats detected by Rose Bengal plate agglutination test;
[0112] Using SPSS 26.0 software to perform correlation analysis between the InDel polymorphic sites of the ASAP1 gene and the resistance of Shaanbei white cashmere goats to Brucella melitensis. During the data processing, considering individual effects, gene interactions, and genotype effects, a fixed model was used for correlation analysis. Using the Logistic regression model, the OR value and 95% confidence interval were calculated to detect the effects of different factors on Brucella melitensis resistance / susceptibility. The statistical analysis model is Y ijkm = μ + G i + Rj +A k +F m +E ijkm , where Y ijkm represents whether the disease occurs, G i represents the genotype effect, R j represents the ram effect, A k represents the age effect, F m represents the farm effect, E ijkm represents the random error.
[0113] The results of the correlation analysis are shown in Tables 3 and 4.
[0114] It can be seen from Table 3 that there are significant differences in different genotypes at the rs655531471 site of the ASAP1 gene between the Brucella - positive group and the negative group (P = 0.017). The Brucella resistance of Shaanbei white cashmere goats with the II genotype is significantly lower than that of the ID genotype, and its OR value is 0.723 (0.553 - 0.944), that is, the probability of Shaanbei white cashmere goats with the ID genotype getting Brucella is 0.72 times that of the II genotype.
[0115] It can be seen from Table 3 that there are significant differences in different genotypes at the rs652252293 site of the ASAP1 gene between the Brucella - positive group and the negative group (P = 0.001). The Brucella resistance of Shaanbei white cashmere goats with the II genotype is significantly higher than that of the ID genotype, and its OR value is 1.559 (1.210 - 2.008), that is, the probability of Shaanbei white cashmere goats with the ID genotype getting Brucella is 1.559 times that of the II genotype.
[0116] Table 3 Correlation analysis of different genotypes at the rs655531471 site and the rs652252293 site of the ASAP1 gene in Shaanbei white cashmere goats and the Brucella resistance of Shaanbei white cashmere goats
[0117]
[0118] It can be seen from Table 4 that there are no significant differences in different alleles at the rs655531471 site of the ASAP1 gene between the Brucella - positive group and the negative group (P = 0.159); there are significant differences in different alleles at the rs652252293 site of the ASAP1 gene between the Brucella - positive group and the negative group (P = 0.050). The Brucella resistance of Shaanbei white cashmere goats with the I - type allele is significantly higher than that of the D genotype, and its OR value is 1.204 (1.000 - 1.451), that is, the probability of D - type goats getting Brucella is 1.356 times that of the I - type.
[0119] Table 4 Distribution of different alleles at the rs655531471 and rs652252293 positions of the ASAP1 gene in Brucella cases and controls in Shaanbei white cashmere goats
[0120]
[0121] The present invention uses the PCR amplification method to detect the insertion / deletion polymorphism sites at the rs655531471 and rs652252293 positions of the ASAP1 gene in cashmere goats, and conducts a correlation analysis with the resistance or susceptibility of Shaanbei white cashmere goats to Brucellosis, and finds that it can be used as an effective molecular marker for the prevention and control of Brucellosis and Brucellosis-resistant genetic breeding in Shaanbei white cashmere goats.
[0122] The preferred embodiments of the present invention disclosed above are only used to help illustrate the present invention. The preferred embodiments do not describe all the details in detail, nor do they limit the present invention to the specific embodiments described. Obviously, many modifications and variations can be made according to the content of this specification. These embodiments are selected and specifically described in this specification to better explain the principles and practical applications of the present invention, so that those skilled in the art can understand and utilize the present invention well. The present invention is only limited by the claims and their full scope and equivalents.
Claims
1. A method for detecting insertion / deletion markers of goat ASAP1 gene, characterized in that: The following operations are included: 1) Using the whole genome of the Shaanxi white cashmere goat to be tested as a template, PCR amplification was performed using primers targeting the rs655531471 site and / or the rs652252293 site of the ASAP1 gene; The primer pairs targeting the ASAP1 gene rs655531471 site include: Upstream primer: 5'-TTTGAAAACTTCGGGCCGC-3' Downstream primer: 5′-TGGGGACGACAACATAAAGCA-3′; The amplified fragment contained the ASAP1 gene NC_030809.1:rs655531471, g.71407951_71407952 position 17 bp insertion / deletion polymorphism site; The primer pairs for the ASAP1 gene rs652252293 site include: Upstream primer: 5'-CAGGTTCACCATTTGCCTGG-3' Downstream primer: 5′-TTTCCAGCGTGTGTAGCAGA-3′; The amplified fragment contained the 27 bp insertion / deletion polymorphism site of goat ASAP1 gene NC_030809.1:rs652252293, g.71446770_71446796; 2) Perform agarose gel electrophoresis on the PCR amplification products and determine the genotype of the target site based on the electrophoresis results.
2. The method for detecting the insertion / deletion marker of the goat ASAP1 gene according to claim 1, characterized in that: The PCR reaction procedure of the primer pair is: Pre-denaturation at 94°C for 5 min, denaturation at 94°C for 30 s, annealing at 59.0°C for 30 s, extension at 72°C for 30 s, for a total of 30 cycles; extension at 72°C for 7 min, and storage at 4°C.
3. The method for detecting the insertion / deletion marker of the goat ASAP1 gene according to claim 1, characterized in that: The electrophoresis used agarose gel with a mass concentration of 3%.
4. The method for detecting the insertion or deletion marker of the goat ASAP1 gene according to claim 1, characterized in that: The genotype of the target site is determined based on the electrophoresis results. The determination methods include: 1) For rs655531471 site: The insertion / insertion genotype, denoted as II, showed a single band of 317 bp; The insertion / deletion genotype, denoted as ID, appears as double bands of 317 bp and 300 bp; The deletion / deletion genotype, denoted as DD, appears as a single band of 300 bp; 2) For rs652252293 site: The insertion / insertion genotype, denoted as II, appeared as a single band of 224 bp; The insertion / deletion genotype, denoted as ID, appears as double bands of 224 bp and 197 bp; The deletion / deletion genotype, denoted as DD, appeared as a single band of 197 bp.
5. A detection kit for goat ASAP1 gene insertion or deletion marker, characterized in that: include: The primer pair for the rs655531471 site as claimed in claim 1, and / or, the primer pair for the rs652252293 site; PCR reaction solution.
6. Use of the kit as claimed in claim 5 in assisted selection breeding of white cashmere goats against brucellosis in northern Shaanxi.
7. Application of the rs655531471 locus and / or the rs652252293 locus of the goat ASAP1 gene in assisted selection breeding of Shaanxi white cashmere goats against brucellosis.
8. The use according to claim 7, characterized in that: The insertion / deletion genotype of the rs655531471 site is a dominant genotype for resistance to brucellosis; The insertion / insertion genotype of the rs652252293 site is a dominant genotype for resistance to brucellosis.
9. The use according to claim 7, characterized in that: The selective breeding comprises the following steps: (1) Detecting the genotype of goat ASAP1 gene rs655531471 and / or rs652252293; (2) screening parents carrying the insertion / deletion genotype of the rs655531471 site and / or the insertion / insertion genotype of the rs652252293 site as disease-resistant parents; (3) Expand disease-resistant populations through genetic breeding.