Lipase, coding gene Lip1.1 and genetically engineered bacterium and application thereof

Abstract

The invention belongs to the field of gene engineering and enzyme engineering, and relates to lipase, a coding gene Lip1.1, a genetically engineered bacterium of the lipase and application of the lipase and the coding gene Lip1.1. The invention aims to provide lipase with a specific nucleotide sequence (SEQ ID NO. 1), and further provides a lipase gene, an extracellular secretion expression engineering bacterium and application of the lipase gene in the field of foods or medicines. Particularly, the invention emphasizes the application potential of the lipase gene in the aspect of fish oil fatty acid. The invention provides a lipase gene sequence which is integrated into a yeast genome through a plasmid vector, so that the high expression stability and the exocytosis capacity of target encoding protein are ensured. The recombined target gene fragment can be transferred to any strain with strong lipase production capacity, and the strong expandability of the recombined target gene fragment is embodied. The characteristic not only enhances the utilization efficiency of gene resources, but also provides powerful support for popularization of lipase in various industrial applications.

Description

Technical Field

[0001] The present invention belongs to the fields of genetic engineering and enzyme engineering, and relates to a lipase, a coding gene Lip1.1 and its genetically engineered bacterium and application. Background Art

[0002] Lipase (EC 3.1.1.3, glycerol acyl hydrolase) has been widely used in many industrial fields, including but not limited to food flavor improvement, hydrolysis and modification of oils and fats, leather degreasing, drug modification, biodiesel, and the pharmaceutical industry. For example, in the pharmaceutical industry, acidic lipase is used to manufacture lipase drugs for treating diseases such as gastrointestinal disorders and indigestion; in the food industry, it is used to improve food flavor and generate flavor components such as lower fatty acids under appropriate conditions, thereby enhancing the fragrance of food; in biodiesel production, this enzyme shows excellent application prospects, especially suitable for treating oils and fats containing high free fatty acids and moisture, and can achieve high yields; in the feed industry, adding acidic lipase can improve the digestion and utilization rate of animal fat substances in feed.

[0003] Lipase belongs to the carboxylester hydrolase family and is responsible for catalyzing the hydrolysis of long-chain (≥C10) triglycerides. As a glycerol acyl hydrolase, its characteristic is to catalyze hydrolysis reactions in heterogeneous systems, that is, water-soluble enzymes catalyze at the interface of water-insoluble substrates and water, rather than acting on water-soluble substrates. In the treatment of high-concentration oily wastewater, lipase is widely used by degrading oils and fats into fatty acids and glycerol, but they are usually soluble and unstable. In addition, lipase is also known as triacylglycerol hydrolase, which can catalyze the decomposition of triglycerides into diglycerides, monoglycerides, glycerol, and fatty acids, and is a unique ester bond hydrolase.

[0004] Lipases from microbial sources are particularly abundant. These enzymes can not only catalyze hydrolysis, alcoholysis, esterification, transesterification, and synthesis reactions of ester compounds, but also do not require coenzymes, have mild conditions, low energy consumption, low requirements for substrate raw materials, and few by-products. Current research shows that microorganisms from about 65 genera, including Candida sp. ), Rhizopus ( Rhizopus sp. ), Penicillium ( Penicillium sp. ), and Pseudomonas ( Pseudomonas sp. ), etc., can produce lipases, including 28 bacterial genera, 4 actinomycete genera, 10 yeast genera, and 23 other fungal genera. However, there are still more lipase-producing microorganisms in nature waiting to be discovered.

[0005] With the development of biotechnology and informatics, researchers are able to identify suitable enzyme-encoding genes from existing gene databases and construct efficient expression systems to accelerate the development and large-scale application of enzyme resources with excellent performance, significantly shortening the development cycle of enzyme preparations. In recent years, the progress of heterologous protein expression systems has promoted the large-scale production of more and more enzyme preparations and their extensive industrial applications.

[0006] However, the means of optimizing the culture environment are still time-consuming and laborious, requiring a large amount of preliminary exploration work. At the same time, transferring from small-scale laboratory tests to the pilot plant stage in the factory requires re-adjusting the conditions, which increases additional costs. The strains obtained by ultraviolet mutagenesis show significant instability and may undergo self-repair with an increase in the number of passages, resulting in the failure of mutations. In contrast, the strains obtained by recombinant plasmids are in a more stable state, but there are relatively few mature commercial lipase products on the market. Therefore, screening and developing new lipase sequences with stability has become the key to solving the current challenges.

[0007] In addition, due to differences in the understanding of those skilled in the art; and when the inventor made this invention, a large number of literatures and patents were studied, but all details and contents could not be listed in detail due to space limitations. However, this does not mean that this invention does not possess the features of these prior arts. On the contrary, this invention already possesses all the features of the prior arts, and the applicant reserves the right to add relevant prior arts in the background art. Summary of the Invention

[0008] Based on the above technical problems, the purpose of the present invention is to provide a lipase, its encoding gene Lip1.1, its genetic engineering bacterium and applications. The purpose of the present invention is also to provide an extracellular secretion expression engineering bacterium of the lipase gene and its applications in the food or pharmaceutical fields. In particular, it relates to the application of the lipase gene in fish oil fatty acids. Using the lipase involved in the present invention as an important component of the fish oil degradation complex enzyme has good application potential in the field of fish oil fatty acids.

[0009] The purpose of the present invention is to provide a lipase, and the nucleotide sequence of the lipase is shown in SEQ ID NO. 1.

[0010] The sequence of SEQ ID NO. 1 is: GCCCCCACTGCCACACTTGCAAACGGCGATAC

[0011] The present invention also aims to provide a lipase gene lip1.1 , whose nucleotide sequence is shown in SEQ ID NO. 1.

[0012] The present invention also aims to provide a recombinant extracellular secretion expression vector, which contains the nucleotide sequence shown in SEQ ID NO. 1. Preferably, the recombinant extracellular secretion expression vector further contains one or more of the promoter AOX1, the secretion signal peptide α, and the resistance gene. More preferably, the resistance gene is the ampicillin gene. The recombinant extracellular secretion expression vector contains the plasmid pPIC9K. The recombinant extracellular secretion expression vector further contains the geneticin gene G418 or histidine auxotrophy (such as His-).

[0013] The present invention also aims to provide a genetically engineered cell, which contains the nucleotide sequence shown in SEQ ID NO. 1.

[0014] According to a preferred embodiment, the genetically engineered cell is obtained by transforming a recombinant extracellular secretion expression vector containing the nucleotide sequence shown in SEQ ID NO. 1 into a host cell.

[0015] The present invention also aims to provide a genetically engineered bacterium for extracellular secretion expression, which contains the nucleotide sequence shown in SEQ ID NO.1.

[0016] According to a preferred embodiment, the genetically engineered bacterium is selected from one of the Pichia pastoris strain, the Saccharomyces cerevisiae strain, or the Hanseniaspora polymorpha strain. Preferably, the genetically engineered bacterium is the Pichia pastoris strain GS115. Preferably, the genetically engineered bacterium further contains the geneticin gene G418 or histidine auxotrophy (such as His-).

[0017] The present invention also aims to provide a culture medium for cultivating a genetically engineered bacterium or a genetically engineered cell containing the lipase gene lip1.1 . Preferably, the culture medium is used for cultivating Pichia pastoris containing the lipase gene lip1.1 . The culture medium is a histidine auxotrophic solid medium. The histidine auxotrophic solid medium can be the MD-HIS medium conventionally defined in the art.

[0018] According to a preferred embodiment, the culture medium contains one or more of yeast nitrogen base (YNB), glucose, biotin, ammonium sulfate, calcium pantothenate, folic acid, inositol, nicotinic acid, riboflavin, p-aminobenzoic acid, pyridoxine hydrochloride, thiamine hydrochloride, boric acid, copper sulfate, potassium iodide, ferric chloride, manganese sulfate, sodium molybdate, zinc sulfate, magnesium sulfate, potassium dihydrogen phosphate, sodium chloride, and calcium chloride.

[0019] The object of the present invention also lies in providing a genetic engineering preparation, which comprises: one or more of the culture, culture extract, cell lysate, bacterial cells, fermentation broth, fermentation broth precipitate, and freeze-dried powder of the above genetic engineering cells; or one or more of the culture, culture extract, cell lysate, fermentation broth, fermentation broth precipitate, and freeze-dried powder of the above genetic engineering bacteria.

[0020] The object of the present invention also lies in providing the above lipase, the above lipase gene lip1.1 , the above recombinant extracellular secretion expression vector, the above genetic engineering cells, the above genetic engineering bacteria, or the above genetic engineering preparation for use in food production, feed production, drug production, or catalyzing fat hydrolysis.

[0021] According to a preferred embodiment, the above application specifically includes the application in degrading fish oil.

[0022] The object of the present invention also lies in providing a culture medium for detecting the hydrolysis performance of cells, engineering bacteria, or engineering preparations. The culture medium contains (NH4)2SO4, KH2PO4, MgSO4·7H2O, NaC1, agar, and tributyrin emulsion.

[0023] According to a preferred embodiment, the culture medium contains 1 g / L (NH4)2SO4, 1.5 g / L KH2PO4, 0.5 g / L MgSO4·7H2O, 0.5 g / L NaC1, 15 - 20 g / L agar, and 120 mL tributyrin emulsion. Preferably, the culture medium contains 1 g / L (NH4)2SO4, 1.5 g / L KH2PO4, 0.5 g / L MgSO4·7H2O, 0.5 g / L NaC1, 20 g / L agar, and 120 mL tributyrin emulsion. The culture medium contains 1 g / L (NH4)2SO4, 1.5 g / L KH2PO4, 0.5 g / L MgSO4·7H2O, 0.5 g / L NaC1, 15 g / L agar, and 120 mL tributyrin emulsion.

[0024] The object of the present invention also lies in providing a method for improving the efficiency of fat degradation, which comprises the following steps: using the above lipase, the above genetic engineering cells, the above genetic engineering bacteria, or the above genetic engineering preparation to catalytically degrade fat.

[0025] Advantages of this technical solution: The present invention provides a lipase gene sequence, which is integrated into the yeast genome through a plasmid vector, ensuring high expression stability and achieving extracellular secretion of the target encoded protein. The recombinant target gene fragment can be transferred into any strain with strong lipase production ability, demonstrating strong scalability. lip1.1 The lipase gene exhibits stable enzyme activity in oil degradation, showing great potential for commercial application. Compared with traditional methods for optimizing the culture environment, the present invention not only shortens the processing time but also does not require additional actual costs. In this way, both production efficiency is improved and the economic burden is reduced, providing a more feasible solution for industrial applications. Description of the Drawings

[0026] Figure 1 Is the new lipase gene lip1.1 Fragment sequence, with a full length of 1650 bp; Figure 2 Is the recombinant vector pPIC9K vector sequence and annotation map; Figure 3 Is the growth of the recombinant vector Escherichia coli positive transformant colonies and its plasmid EcoRI / NotI Double digestion electrophoresis identification gel running map. Among them, in the right electrophoresis gel, lane 1 is the result of double digestion of the recombinant plasmid, lane 2 is the result of the recombinant plasmid gel running, and M is the marker; Figure 4 Is the recombinant vector Lip1.1 - His _pPIC9K recombinant vector after digestion with restriction endonuclease sacI and the gel electrophoresis PCR identification result; Figure 5 Is to use the yeast transformation operation kit to Lip1.1 - His _pPIC9K recombinant vector is linearized by digestion and then transformed into yeast cells, and the coating result on the histidine auxotrophic medium (MD-HIS); Figure 6 Is the gel electrophoresis PCR amplification identification result using the yeast genomic DNA extraction kit. Among them, lane 1 is PIC9K-1, lane 2 is PIC9K-2, lane 3 is PIC9K-3, lane 4 is PIC9K-4, lane 5 is the PIC9K plasmid, and lane 6 is PIC9K negative; Figure 7 Is the Western Blotting protein gel electrophoresis identification result of the supernatant after 50 mL pilot-scale fermentation of the positive engineering strain; Figure 8Identification results of SDS-PAGE protein gel electrophoresis of the supernatant after 50 mL small-scale fermentation of the positive recombinant strain. Among them, lane 1 is the precipitate before induction of PIC9K-2, lane 2 is the precipitate of PIC9K-2-72 h, lane 3 is the supernatant of PIC9K-2-72 h, and lane 4 is the precipitate before induction of PICZαA-1; Figure 9 For Pichia pastoris GS115 strain and GS115- lip1.1 Comparison diagram of the hydrolysis zones produced by the genetically engineered bacteria on the screening plate containing tributyrin. Detailed implementation mode

[0027] In the description of the present invention, the terms are only for descriptive purposes and cannot be construed as indicating or implying relative importance or implicitly specifying the quantity of the indicated technical features. In the description of the present invention, "a plurality" means two or more unless otherwise specifically defined. Those skilled in the art should understand that the details and forms of the technical solutions of the present invention can be modified or replaced without departing from the spirit and scope of the present invention, but these modifications or replacements all fall within the protection scope of the present invention. For the experimental methods without specific conditions indicated in the following examples, they are carried out according to conventional methods and conditions, or selected according to the product specifications.

[0028] The present invention unexpectedly discovered a novel lipase gene sequence that has not been reported, and its similarity with the existing known lipase gene sequences is less than 90%. By systematically comparing and analyzing the existing lipase gene sequences in the NCBI and Uniprot databases, a pair of specific primers was designed, and using the genome of Candida cylindracea ( Candida rugosa ) as a template, the amplification reaction program was optimized. Through PCR amplification and sequencing verification, this unreported lipase gene was successfully identified.

[0029] The present invention utilizes EcoRI / NotI Restriction endonucleases to construct the codon-optimized lipase gene sequence into the optimized Pichia pastoris eukaryotic secretory expression vectors pPIC9K and pPICZαA, and carry 6× His tag.

[0030] The present invention transfers the successfully constructed Lip1.1 -6× His :pPIC9K / pPICZαA recombinant plasmid into Pichia pastoris cells by electroporation, and then screens out the positive engineering strains through G418-MD resistance screening, SDS-PAGE and Western blotting techniques.

[0031] To evaluate the lipolytic performance of the positive engineered yeast strains, the present invention uses a tributyrin emulsified culture plate for testing, so as to screen out recombinant engineered strains with significantly enhanced tributyrin hydrolysis ability. In addition, by optimizing the basic fermentation medium and process, the extracellular secretion level of the target protein is achieved in the range of 150-200 mg / L.

[0032] Finally, by constructing an extracellular secretion expression engineered strain, the present invention not only realizes the extracellular expression of the above lipase, but also finds that it has good lipase hydrolysis activity, providing a new lipase gene resource for enriching the existing lipase resource library.

[0033] Example 1 1. Plasmid system construction Using the Pichia pastoris plasmid pPIC9K as a vector, the amplified lip1.1 gene fragment was ligated to the pPIC9K vector to obtain the recombinant vector Lip1.1 - His _pPIC9K. lip1.1 The gene PCR amplification primers (forward primer SEQ ID NO. 2: 5'-ATGGAGCTCGCTCTTGCGCTCTCT-3'; reverse primer SEQ ID NO. 3: 5'-TTACACGAAAAAAGATGGAGGATTTGAGAA-3') were synthesized by Tsingke Biotechnology Co., Ltd. lip1.1 The original gene sequence length is 1602 bp (as Figure 1 shown). The gene sequence and map of the plasmid are as Figure 2 shown. The recombinant vector structural sequence includes the following gene fragments: promoter AOX1, lipase gene without signal peptide and stop codon lip1.1 (shown in SEQ ID NO. 1), secretion signal peptide α, resistance gene (such as ampicillin gene Amp ).

[0034] The sequence of the lipase gene without signal peptide and stop codon lip1.1 (SEQ ID NO. 1) is:

[0035] 2. Transformation of Escherichia coli DH5α with plasmid, bacterial preservation and screening Add 100 ng of the amplified recombinant vector mentioned above to 50 μL of Escherichia coli DH5α competent cells, gently mix, place on ice for 30 min, heat shock at 42 °C for 45 s, and then place on ice for 2 min; Add 500 μL of LB liquid medium, culture with shaking at 37 °C for 45 min, centrifuge, resuspend the cells with 100 μL of the supernatant, and then spread on an LB plate containing Amp antibiotic (final concentration is 50 μg / mL); Pick out the transformants grown on the plate for identification by colony PCR and verification by double digestion of the plasmid.

[0036] As Figure 3 the results show, lip1.1 the gene fragment was successfully ligated to the plasmid vector, and at the same time, the transformant strains were preserved.

[0037] 3. Large-scale preparation of plasmid Pick a positive clone into 200 mL of Amp +LB medium, culture at 37 °C, 250 rpm, overnight until the OD600 value reaches 2 - 4; Extract the recombinant plasmid Lip1.1 _pPIC9K referring to the instruction manual of "Tiangen - Endotoxin - Free Plasmid Large Extraction Kit Standard Operating Procedure" TGC - RD - 4 - PD - 008.

[0038] 4. Preparation and detection of linearized plasmid Take 1 μL of the recombinant plasmid Lip1.1 _pPIC9K for restriction endonuclease SacI linearization treatment, perform agarose gel electrophoresis referring to the instruction manual of "Plasmid Homogeneity Agarose Gel Electrophoresis Test Standard Operating Procedure" CD - SOP - AD - 023 - 02 to detect the degree of linearization. The electrophoresis results are as Figure 4 shown, and the results show that the linearization result meets the requirements. After passing the test, the linearized plasmid can be used as the plasmid for transformation.

[0039] 5. Preparation of yeast competent cells S1 Streak - plate isolate single colonies of GS115 yeast on a yeast extract peptone dextrose (YPD) plate and culture at 30 °C for 2 days; S2 Inoculate into a triangular flask containing 10 mL of YPD medium, culture overnight at 30 °C until the OD600 is 2.0, then inoculate 0.2 mL of the bacterial solution into a triangular flask containing 200 mL of YPD medium, and culture for 13 - 15 h until the OD600 is between 1.3 and 1.5; S3 Transfer the bacterial solution to a sterile centrifuge bottle, centrifuge at 15,000 g for 10 min at 4°C, and resuspend the cells in 180 mL of pre-cooled sterile water; S4 Repeat S1, centrifuge the cells, and resuspend the cells in 90 mL of pre-cooled sterile water; S5 Repeat S1, centrifuge the cells, and resuspend the cells in 7.2 mL of pre-cooled sterile 1 mol / L sorbitol; S6 Repeat S1, centrifuge the cells, and resuspend the cells in 0.18 mL of pre-cooled sterile 1 mol / L sorbitol to a final volume of 0.54 mL with an OD600 of 200. Place the cells on ice for transformation.

[0040] 6. Electrocompetent cells Take 80 μL of the prepared competent cells and mix them with 5 - 10 μg of linearized plasmid in a centrifuge tube. Incubate on ice for 5 min, and transfer the mixture to a 0.2 cm electroporation cuvette; Set the electroporation parameters (2000 V, 25 μF, 200 Ω) and perform electroporation. Immediately add 1 mL of 1 mol / L sorbitol to the electroporation cuvette, and transfer the mixture to a 15 mL culture tube; Incubate at 30°C for 1 - 2 h, then add 1 mL of YPD medium, and incubate at 30°C and 250 rpm for 3 - 6 h; Take 50 μL, 100 μL, and 200 μL of the incubated culture solution and spread them on G418 - MD (150 mm petri dish) respectively, and culture at 30°C for 3 - 10 days.

[0041] The results are as Figure 5 , and the yeast cells grow normally in the petri dish.

[0042] 7. Positive identification, preservation, and protein expression verification of engineered bacteria Pick more than 10 monoclonal colonies grown on the above G418 - MD plate into a 50 mL centrifuge tube containing 5 mL of YPD medium, and culture at 30°C and 250 rpm overnight with an OD600 of approximately 10; Identify by colony PCR. Among them, the PCR system is: MonAmp2×MonHI - FI HS Mix (10 μL), upstream primer (0.5 μL), downstream primer (0.5 μL), ddH2O (8.5 μL), bacterial solution (0.5 μL), and mix well; The reaction procedure is: 98°C for 10 min, 58°C for 5 s, 68°C for 1 min, for a total of 35 cycles. Perform agarose gel electrophoresis on the PCR reaction products.

[0043] The results of the gel image are as Figure 6As shown in the figure, the results show that the vector containing the target gene was successfully transformed into the engineered strain.

[0044] Take 1 mL of the positive engineered strain obtained from the above identification and inoculate it into 100 mL of BMGY medium. Incubate at 30 °C and 250 rpm for 24 h, and the OD600 of the bacterial solution is 3.0. Preserve 3 tubes of the remaining bacterial solution in the form of glycerol bacteria. Add 300 μL of 50% glycerol and 700 μL of the bacterial solution to each tube. After mixing, store at -80 °C.

[0045] Centrifuge the bacterial solution cultured in YPD above at 1250 g for 10 min at room temperature. Discard the supernatant and retain part of the bacterial cells for subsequent identification control.

[0046] Resuspend the bacterial cells with 33 mL of BMMY medium; induce expression at 28 °C and 250 rpm; sample and detect the OD value every 24 h after induction of expression, and supplement methanol to a final concentration of 2%. Collect the flask and sample after 72 h of induction; centrifuge at 1250 g for 10 min at 2 - 8 °C, retain the supernatant, and store the supernatant and the bacterial cells separately at -80 °C after centrifugation; perform Western blotting detection on the retained supernatant samples.

[0047] The results are as Figure 7 , and it is determined that the protein is the target protein with His tag.

[0048] According to the Western blotting detection results, select the high-expression strains, pass the supernatant through a Ni column (gravity column with a diameter of 1.6 cm, a column height of 10 cm, and a packing height of 0.8 cm), and perform SDS-PAGE detection on the eluate. A band appears at the theoretical value position (red arrow), and the results are as Figure 8 .

[0049] 8. Identification and detection of the hydrolysis activity of the engineered strain Induce and culture the positive engineered strain obtained above with BMMY medium for 72 h. Take 2 μL and spot it on an inorganic culture plate containing tributyrin. Incubate at 30 °C for 3 - 5 days and observe the hydrolysis zone.

[0050] The inorganic culture plate contains 1 g / L (NH4)2SO4, 1.5 g / L KH2PO4, 0.5 g / L MgSO4·7H2O, 0.5 g / L NaCl, 15 g / L agar, and 120 mL of tributyrin emulsion.

[0051] The results are as Figure 9 shown. Compared with the control CK group, the groups labeled 1, 2, 3, 6, and 9 showed obvious hydrolysis zones (marked with red circles).

[0052] To further detect its hydrolysis activity, fish oil was used as the substrate, and the lipase activity of the target protein was determined by the p-NPP (p-nitrophenyl palmitate) method. The result of the enzyme activity detection showed that the lipase hydrolysis activity of the Lip1.1 protein was 54.30 U / mL.

[0053] The above results indicate that Lip1.1 the protein or lipase encoded by the gene has lipase hydrolysis activity, especially towards tributyrin and fish oil.

[0054] It should be noted that the above specific embodiments are exemplary. Those skilled in the art can come up with various solutions inspired by the disclosure of the present invention, and these solutions also fall within the scope of the disclosure of the present invention and within the protection scope of the present invention. Those skilled in the art should understand that the description and drawings of the present invention are illustrative and do not constitute a limitation on the claims. The protection scope of the present invention is defined by the claims and their equivalents.

Claims

1. A lipase, characterized in that, The nucleotide sequence of the lipase is shown in SEQ ID NO.

1.

2. A lipase gene lip1.1 , characterized in that The lipase gene lip1.1 has a nucleotide sequence as shown in SEQ ID NO.

1.

3. A recombinant extracellular secretion expression vector, characterized in that, The recombinant extracellular secretion expression vector described above contains the nucleotide sequence shown in SEQ ID NO.

1.

4. A genetically engineered cell, characterized in that, The genetically engineered cell described above contains the nucleotide sequence shown in SEQ ID NO.

1.

5. The genetically engineered cell according to claim 4, wherein The genetically engineered cell is obtained by transforming a recombinant extracellular secretion expression vector containing the nucleotide sequence shown in SEQ ID NO. 1 into a host cell.

6. A genetically engineered bacterium for extracellular secretion expression, characterized in that, The genetically engineered bacterium contains the nucleotide sequence shown in SEQ ID NO.

1.

7. The genetically engineered bacterium according to claim 6, characterized in that, The host cell is selected from one of Pichia pastoris cells, Saccharomyces cerevisiae cells or Hanseniaspora polymorpha cells.

8. A genetic engineering preparation, characterized in that, The genetically engineered preparation contains: One or more of the culture, culture extract, cell lysate, bacterial cells, fermentation broth, fermentation broth precipitate, and lyophilized powder of the genetically engineered cell according to claim 4 or 5; or One or more of the culture, culture extract, cell lysate, fermentation broth, fermentation broth precipitate, and lyophilized powder of the genetically engineered bacterium according to claim 6 or 7.

9. The lipase according to claim 1, the lipase gene according to claim 2 lip1.1 , the recombinant extracellular secretion expression vector according to claim 3, the genetically engineered cell according to claim 4 or 5, the genetically engineered bacterium according to claim 6 or 7, or the genetically engineered preparation according to claim 8, and their applications in food production, feed production, pharmaceutical production or catalyzing fat hydrolysis.

10. A method for improving the efficiency of oil degradation, characterized in that, Using the lipase according to claim 1, the genetically engineered cell according to claim 4 or 5, the genetically engineered bacterium according to claim 6 or 7, or the genetically engineered preparation according to claim 8 to catalytically degrade fats.

Images