Alkaline xylanase mutant with improved specific activity
By performing a T149Q single-point mutation on the wild-type xylanase, its specific activity was significantly improved, solving the problem of insufficient specific activity of existing xylanase, reducing production costs, and promoting its application in the industrial field.
Patent Information
- Application Number
- CN202510696637.7
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-05-28
- Publication Date
- 2025-09-16
- Estimated Expiration
- 2045-05-28
AI Technical Summary
The low specific activity of existing xylanases limits their widespread application in industrial fields, especially by increasing production costs.
By performing a single-point mutation on the wild-type xylanase, the Thr at the 149th amino acid was mutated to Gln, an alkaline xylanase mutant with improved specific activity was constructed, and recombinant expression was performed in Pichia pastoris, significantly improving its specific activity.
The specific activity of the xylanase mutant was increased by 32.83%, which reduced the production cost and was conducive to its wide application in the industrial field.
Abstract
Description
Technical Field
[0001] The present invention relates to the technical field of gene engineering and protein engineering, in particular to an alkaline xylanase mutant with improved specific activity. Background Art
[0002] Xylan is a five-carbon polysaccharide and a key component of plant hemicellulose. It accounts for one-third of plant carbohydrates and is the second most abundant renewable resource in nature after cellulose. It is present in plant cell walls and nearly all other parts of the body.
[0003] Xylanase is a general term for a class of enzymes that can degrade xylan into oligosaccharides or xylose. The complete enzymatic degradation of a xylan molecule requires several enzymatic reactions. Two enzymes act on the backbone: β-1,4-xylanase (1,4-β-D-xylanohydrolase: EC3.1.2.8) and β-xylosidase (1,4-β-D-xylanxylohydrolase: EC3.2.1.37). Generally speaking, the former acts on the xylosidic bonds within the backbone, breaking down xylan into oligosaccharides, while the latter acts on the ends of xylo-oligosaccharides, releasing xylose.
[0004] Many microorganisms produce xylanases. The biochemical properties of xylanases are primarily understood through studies of bacterial and fungal xylanases. Bacterial xylanases can be broadly divided into two categories: high-molecular-weight, acid-resistant xylanases and low-molecular-weight, alkali-resistant xylanases. This distinction is not observed in fungi, however, as low-molecular-weight xylanases are all alkaline-resistant.
[0005] Xylan in feed is difficult for monogastric animals to digest. It also binds to large amounts of water, increasing the volume and viscosity of the chyme in the digestive tract of the feeder, reducing the interaction between nutrients and endogenous enzymes in the digestive tract. This hinders the digestion and absorption of nutrients, especially fat and protein, and reduces feed utilization. Research results show that adding xylanase to feed can significantly reduce the molecular size of arabinoxylan, breaking it down into oligoxylose with a smaller degree of polymerization, thereby improving feed performance and eliminating or reducing the anti-nutritional effects caused by increased viscosity.
[0006] Xylanase can be used as a biobleaching agent in the paper and pulp industry. Its importance in the paper and pulp industry lies in its ability to replace toxic chemicals while allowing for the recovery of useful byproducts through enzymatic pretreatment. Its bleaching action is achieved by cleaving the bonds between lignin and sugars, loosening the pulp structure. Scanning electron microscopy studies have shown that pulp pretreated with xylanase exhibits increased porosity within the pulp fibers, enhancing their affinity for bleaching compounds.
[0007] Research on the application of xylanase in the production of wine and Japanese barley shochu has already been conducted. Japanese researchers applied the acid-resistant xylanase Xy1C to the brewing of Japanese barley shochu and found that the enzyme helped improve fermentation efficiency and increase alcohol yield.
[0008] Extensive research has focused on modifying the enzymatic properties of xylanases to adapt them to diverse applications, but specific activity is a key factor limiting their application. The higher the specific activity of xylanase, the lower its production cost and price, which in turn promotes its widespread application in industries such as textiles and papermaking. Summary of the Invention
[0009] The present invention solves the problems of the prior art and provides an alkaline xylanase mutant with improved specific activity. The specific activity of the mutant is significantly improved compared with the wild type, which is conducive to its wide application in the industrial field.
[0010] One aspect of the present invention relates to a xylanase mutant, which is obtained by mutating the 149th amino acid of the xylanase with the amino acid sequence of SEQ ID NO: 1 from Thr to Gln.
[0011] The present invention also relates to a DNA molecule encoding the mutant.
[0012] The present invention also relates to a recombinant expression plasmid comprising the above DNA molecule.
[0013] The present invention also relates to a host cell comprising the above-mentioned recombinant expression plasmid.
[0014] When the above plasmid is transferred into host cells, the specific activity of the recombinantly expressed xylanase mutant is significantly improved.
[0015] In some embodiments of the present invention, the host cell is Pichia pastoris ( Pichia pastoris ).
[0016] The present invention is based on wild-type xylanase H1 and provides a xylanase mutant containing a T149Q single point mutation, the specific activity of which is increased by 32.83% to 1574 U / mg, achieving unexpected technical effects.
[0017] In summary, the specific activity of the alkaline xylanase mutant provided by the present invention is significantly improved, which is beneficial to reducing production costs and promoting its wide application in industrial fields such as papermaking. DETAILED DESCRIPTION
[0018] The present invention has used the conventional techniques and methods used in genetic engineering and molecular biology fields, for example the methods described in MOLECMLAR CLONING:A LABORATORY MANUAL, 3rd Ed. (Sambrook, 2001) and CURRENT PROTOCOLS INMOLECMLAR BIOLOGY (Ausubel, 2003). These general references provide definitions and methods known to those skilled in the art. However, those skilled in the art can, on the basis of the technical solutions described in the present invention, adopt other conventional methods, experimental protocols and reagents in this area, and are not limited to the limitations of the specific embodiments of the present invention. For example, the present invention can select the following experimental materials and reagents:
[0019] Strains and vectors: Escherichia coli DH5α, Pichia pastoris GS115, vectors pPIC9k, Amp, and G418 were purchased from Invitrogen.
[0020] Enzymes and kits: PCR enzyme and ligase were purchased from Takara, restriction endonucleases were purchased from Fermentas, plasmid extraction kit and gel purification recovery kit were purchased from Omega, and GeneMorph II random mutagenesis kit was purchased from Beijing Bomeis Biotechnology Co., Ltd.
[0021] Culture medium formula:
[0022] BMGY medium: 2% peptone, 1% yeast extract, 100 mM potassium phosphate buffer (pH 6.0), 1.34% YNB, 4×10 -5 % biotin, 1% glycerol;
[0023] BMMY medium: 2% peptone, 1% yeast extract, 100 mM potassium phosphate buffer (pH 6.0), 1.34% YNB, 4 × 10 -5 % biotin, 0.5% methanol;
[0024] LB-AMP medium: 0.5% yeast extract, 1% peptone, 1% NaCl, 100 μg / mL ampicillin, pH 7.0;
[0025] LB-AMP plates: 0.5% yeast extract, 1% peptone, 1% NaCl, 1.5% agar, 100 μg / mL ampicillin, pH 7.0.
[0026] The present invention will be further described below in conjunction with the embodiments:
[0027] Example 1 Expression plasmid construction
[0028] from Paecilomyces spp. Paecilomyces. sp The xylanase gene from ( ) was codon-optimized based on the codon preference of Pichia pastoris. Six bases, GAATTC (an EcoR I restriction site), were added before the start codon ATG, and GCGGCCGC (a Not I restriction site) was added after the stop codon TAA. The optimized nucleotide sequence was synthesized by Shanghai Jierui Bioengineering Co., Ltd. This xylanase was named H1. Its amino acid sequence is shown in SEQ ID NO: 1, and its encoding nucleotide sequence is shown in SEQ ID NO: 2.
[0029] The xylanase gene was digested with restriction enzymes EcoRI and NotI (Fermentas). Simultaneously, the plasmid pPIC9K was digested with restriction enzymes EcoRI and NotI. The digestion products were purified using a gel purification kit and ligated using T4 DNA ligase (Fermentas). The ligated products were transformed into DH5α Escherichia coli (Invitrogen) and selected with ampicillin. Several clones were sequenced (Invitrogen) to ensure accuracy.
[0030] Plasmids were purified from E. coli clones with correct sequencing results using a plasmid miniprep kit (Omega) to obtain an expression plasmid, which was named pPIC9K-PSL.
[0031] Example 2 Screening of high specific activity xylanase mutants
[0032] To further enhance the enzymatic activity of xylanase H1, the applicants conducted protein structural analysis. This protein, a G11 family xylanase, has a β-jellyroll structure. Using directed evolution, the applicants screened a large number of mutations in the enzyme.
[0033] 1.1 Design PCR primers H1-F1 and H1-R:
[0034] H1-F1: GGC GAATTC ATGATGATTGGTATCACTTCTTTTGC (as shown in SEQ ID NO: 3, the underline indicates the restriction endonuclease EcoRI recognition site);
[0035] H1-R1:ATA GCGGCCGC TTAACCGACGTCTGCAACGGTAATTC (as shown in SEQ ID NO: 4, the underline indicates the restriction endonuclease NotI recognition site).
[0036] Using the H1 gene (SEQ ID NO: 2) as a template, PCR amplification was performed using the above-mentioned primers using the GeneMorph II Random Mutation PCR Kit. The PCR product was recovered from gel, digested with EcoRI and NotI, and ligated with the pET21a vector that had been digested with the same enzymes. The product was then transformed into Escherichia coli BL21 (DE3), plated on LB-Amp plates, and incubated upside down at 37°C. After transformants appeared, they were picked individually with a toothpick into a 96-well plate. 150 μL of LB-Amp medium containing 0.1 mM IPTG was added to each well of the plate. The cells were incubated at 37°C and 220 rpm for approximately 6 h. The supernatant was discarded after centrifugation, and the cells were resuspended in buffer and repeatedly frozen and thawed to break the cell wall to obtain E. coli cell lysate containing xylanase.
[0037] 30 μL of lysate was transferred to two new 96-well plates. 30 μL of substrate was added to one of the 96-well plates and the reaction was incubated at 37°C for 30 minutes. The resulting reducing sugars were then determined by the DNS method. 150 μL of Coomassie Brilliant Blue solution was added to the other plate and allowed to stand for 10 minutes. Protein content was then determined by the Coomassie Brilliant Blue (Bradford) binding method. The enzyme activity and protein content of the different mutants were then calculated. Ultimately, the applicant identified a single point mutation, T149Q, that significantly increased the specific activity of xylanase from over 20,000 transformants.
[0038] Example 3 Expression of xylanase in Pichia pastoris
[0039] 3.1 Expression plasmid construction
[0040] The gene sequences of xylanase H1 and its mutants were optimized according to the codon preference of Pichia pastoris and synthesized by Shanghai Jierui Bioengineering Co., Ltd., and two restriction sites, EcoRI and NotI, were added to the 5' and 3' ends of the synthetic sequence, respectively.
[0041] According to the method described in Example 1, the gene sequences of the synthesized xylanase H1 and its mutants were double-digested with EcoRI and NotI, respectively, and then ligated with the pPIC-9K vector digested with the same enzymes overnight at 16°C. The resulting DNA was transformed into Escherichia coli DH5a, spread on LB-Amp plates, and inverted cultured at 37°C. After transformants appeared, colony PCR was performed (reaction system: template-picked single clone, rTaq DNA polymerase 0.5 μL, 10× Buffer 2.0 μL, dNTPs (2.5 mM) 2.0 μL, 5'AOX primer (10 mM): 0.5 μL, 3'AOX primer: 0.5 μL, ddH2O 14.5 μL, reaction procedure: pre-denaturation at 95°C for 5 min, 30 cycles of: 94°C for 30 sec, 55°C for 30 sec, 72°C for 2 min, 72°C for 10 min). The positive clones were verified by sequencing and the correct recombinant expression plasmid was obtained.
[0042] 3.2 Construction of Pichia pastoris engineered strains
[0043] 3.2.1 Preparation of competent yeast
[0044] The Pichia pastoris GS115 strain was activated on a YPD plate and cultured at 30°C for 48 h. The activated GS115 monoclonal was inoculated into 6 mL of YPD liquid medium. The culture was carried out at 30°C and 220 rpm for about 12 h. The bacterial solution was then transferred to a conical flask containing 30 mL of YPD liquid medium and cultured at 30°C and 220 rpm for about 5 h. The bacterial density was detected by UV spectrophotometer. When the OD600 value was in the range of 1.1–1.3, 4 mL of bacteria were collected into sterile EP tubes by centrifugation at 4°C and 9000 rpm for 2 min, and the supernatant was gently discarded. The remaining supernatant was absorbed with sterilized filter paper and resuspended in 1 mL of pre-cooled sterile water. The bacteria were centrifuged at 4°C and 9000 rpm for 2 min, and the supernatant was gently discarded. The cells were washed again with 1 mL of sterile water and centrifuged at 4°C and 9000 rpm for 2 min. min, gently discard the supernatant, and resuspend the cells in 1 mL of pre-cooled sorbitol (1 mol / L); centrifuge at 4°C and 9000 rpm for 2 min, gently discard the supernatant, and gently resuspend the cells in 100-150 μL of pre-cooled sorbitol (1 mol / L).
[0045] 3.2.2 Transformation and screening
[0046] The recombinant expression plasmids constructed in 3.1 were linearized with Sac I. The linearized fragments were purified and recovered and transformed into Pichia pastoris GS115 by electroporation. The recombinant Pichia pastoris strains were screened on MD plates, and then multi-copy transformants were screened on YPD plates containing different concentrations of geneticin (0.5 mg / mL-8 mg / mL).
[0047] The resulting transformants were transferred to BMGY medium and cultured with shaking at 30°C and 250 rpm for 1 day. The transformants were then transferred to BMMY medium and cultured with shaking at 30°C and 250 rpm. Expression was induced daily with the addition of 0.5% methanol for 4 days. The cells were centrifuged at 9000 rpm for 10 minutes to remove the cells. The fermentation supernatants containing xylanase H1 and its single-point mutant were obtained. The xylanase activity and protein content in the fermentation supernatants were assayed according to the following methods, and the specific activity was calculated.
[0048] 1. Xylanase activity determination method
[0049] (1) Definition of xylanase activity unit
[0050] Under the conditions of temperature of 50℃ and pH of 8.0, the amount of enzyme required to degrade and release 1 μmol of reducing sugar from a 5 mg / mL xylan solution per minute is one enzyme activity unit, expressed as U.
[0051] (2) Xylanase activity determination method
[0052] Pipette 10.0 mL of xylan solution and equilibrate at 50°C for 20 min.
[0053] Pipette 10.0 mL of appropriately diluted enzyme solution and equilibrate at 50°C for 5 min.
[0054] Blank sample determination: Pipette 2.00 mL of appropriately diluted enzyme solution (equilibrated at 50°C) into a graduated test tube, then add 5 mL of DNS reagent and oscillate for 3 seconds. Then add 2.0 mL of xylan solution, equilibrate at 50°C for 30 minutes, and heat in a boiling water bath for 5 minutes. Cool to room temperature with tap water, add water to make up to 25 mL, and oscillate for 3 to 5 seconds. Using the standard blank as a blank control, measure the absorbance at 540 nm (A). B .
[0055] Sample Assay: Pipette 2.00 mL of appropriately diluted enzyme solution (equilibrated at 50°C) into a graduated test tube. Add 2.0 mL of xylan solution (equilibrated at 50°C), shake in an electromagnetic field for 3 seconds, and maintain at 50°C for 30 minutes. Add 5.0 mL of DNS reagent and shake in an electromagnetic field for 3 seconds to terminate the enzymatic hydrolysis reaction. Heat in a boiling water bath for 5 minutes, cool to room temperature with tap water, dilute to 25 mL with water, and shake in an electromagnetic field for 3 seconds. Measure the absorbance A at 540 nm using a standard blank as a blank control. E .
[0056] Formula (1): X D =[(A E - AB )×K+C0] ×1000 / (M×t).
[0057] Where:
[0058] X D —Xylanase activity in the sample dilution, U / mL;
[0059] A E —Absorbance of enzyme reaction solution;
[0060] A B —Absorbance of enzyme blank;
[0061] K —slope of the standard curve;
[0062] C0 —intercept of the standard curve;
[0063] M — molar mass of xylose M (C5XYN 110 O5) = 150.2 g / mol;
[0064] t —enzyme hydrolysis reaction time, min;
[0065] 1000 —conversion factor, 1 mmol = 1000 μmol;
[0066] X D The value should be between 0.04 and 0.10 U / mL. If it is not within this range, the enzyme solution dilution should be reselected and the analysis should be repeated.
[0067] Formula (2): X = X D ×D f .
[0068] Where:
[0069] X — xylanase activity in the sample, U / mL;
[0070] D f —Dilution factor of the sample.
[0071] The calculated value of enzyme activity was rounded to three significant figures.
[0072] (3) Measurement results
[0073] The xylanase activity was detected according to the above method.
[0074] 2. Protein content determination method
[0075] The Coomassie Brilliant Blue (Bradford) binding assay for protein content determination is a hybrid method combining colorimetry and pigmentation. Coomassie Brilliant Blue G-250 appears brownish-red in acidic solutions and turns blue upon binding to protein. Within a certain protein concentration range, it conforms to Beer's law and can be measured colorimetrically at 595 nm. Substantial absorption occurs within 3-5 minutes and remains stable for at least 1 hour. Within the range of 10-1000 μg / mL, absorbance is directly proportional to protein concentration.
[0076] The enzyme solution and Coomassie Brilliant Blue solution were mixed in a volume ratio of 1:5, and allowed to stand for 10 minutes. The protein content was determined by the Coomassie Brilliant Blue (Bradford) binding method.
[0077] 3. Specific activity calculation
[0078] “Specific Activity” refers to the number of enzyme activity units per unit weight of protein, generally expressed as U / mg protein.
[0079] The formula for calculating specific activity is: specific activity (U / mg) = enzyme activity (U / mL) / protein content (mg / mL).
[0080] See Table 1 for specific results.
[0081] Table 1 Comparison of specific activities of xylanase mutants
[0082] Xylanase Specific activity (U / mg) Wild-type H1 1185 T149Q single point mutant 1574
[0083] From the results in Table 1, it can be seen that compared with the wild-type xylanase H1, the xylanase mutant containing the T149Q single point mutation provided by the present invention has a specific activity increased by 32.83%, reaching 1574 U / mg, achieving an unexpected technical effect.
[0084] In summary, the specific activity of the xylanase mutant provided by the present invention is significantly improved, which is beneficial to reducing the production cost of the enzyme and promoting its wide application in the industrial field.
Claims
1. A xylanase mutant, characterized in that The mutant is obtained by mutating the 149th amino acid of the xylanase with the amino acid sequence of SEQ ID NO: 1 from Thr to Gln.
2. A DNA molecule encoding the xylanase mutant according to claim 1.
3. A recombinant expression plasmid comprising the DNA molecule of claim 2.
4. A host cell, characterized in that The host cell comprises the recombinant expression plasmid according to claim 3.
5. The host cell according to claim 4, wherein The host cell is Pichia pastoris ( Pichia pastoris ).
Citation Information
Patent Citations
Alkaline xylanase mutant with high specific activity
CN115029334A