Whole blood sample treating fluid, kit and whole blood direct expansion method

Abstract

The invention discloses a whole blood sample treatment liquid, a kit and a whole blood direct expansion method, and the whole blood sample treatment liquid comprises a buffer solution, a lysis solution, a nucleic acid protection solution, an impurity removal solution, a precipitation solution and an adsorption substance. According to the method, the whole blood sample treating fluid and the whole blood sample are uniformly mixed and centrifuged, the vast majority of inhibitors can be effectively removed only through simple centrifugation, and the whole process is simple, convenient, rapid and accurate to operate. The nucleic acid extraction-free whole blood direct expansion method disclosed by the invention has good tolerance to clinically common complex blood samples such as hemolysis, lipolysis and jaundice, effectively avoids the problem of leak detection caused by complex blood, and is simpler and more convenient to operate, more efficient and lower in cost compared with a blood purification method. The precipitation liquid and the adsorption substance can remove impurities, the inhibition effect of inhibitors in blood on PCR amplification is obviously reduced, and the problem of leak detection caused by too many inhibitors can be effectively reduced.

Description

Technical Field

[0001] The present invention belongs to the technical field of molecular diagnostic reagents, and particularly relates to a whole blood sample processing solution, a kit and a whole blood direct amplification method. Background Art

[0002] In the field of in vitro diagnosis, whole blood samples contain rich biological information. Before being applied to molecular diagnosis, they need to be processed by PCR amplification technology to obtain relatively pure sample nucleic acids. The pure sample nucleic acids are then applied to a fluorescence quantitative PCR instrument for amplification, thereby completing the detection of whole blood samples.

[0003] The existing processing methods for PCR amplification of whole blood samples are as follows: First, nucleic acids in whole blood samples are purified by the magnetic bead method or the column extraction method. Secondly, the whole blood samples are lysed by physical, chemical or biological methods. Then, multiple washings are carried out repeatedly. Finally, relatively pure sample nucleic acids are obtained. However, the above processing process is relatively complex and time-consuming, and requires relatively professional operations or special nucleic acid extraction instruments to complete, with limited applications. It is difficult for those who are new to this field or not in this field to complete the operations. Moreover, nucleic acid loss is inevitable during the multiple washing processes, and for whole blood samples containing pathogens at low concentrations, missed detections may occur. Summary of the Invention

[0004] The present application provides a whole blood sample processing solution, a kit and a whole blood direct amplification method to solve the problems of complex processing, long time consumption and easy missed detection in the prior art.

[0005] In the first aspect of the present application, a whole blood sample processing solution is provided, including: a buffer solution, a lysis solution, a nucleic acid protection solution, a impurity removal solution, a precipitation solution and an adsorption substance.

[0006] Optionally, the buffer reagent is selected from one of Tris-HCl buffer solution, Phosphate buffer solution, HEPES buffer solution and MOPS buffer solution.

[0007] Optionally, the lysis solution is selected from at least one of guanidine isothiocyanate, guanidine thiocyanate, SDS, Triton-X100 and NP40.

[0008] Optionally, the nucleic acid protection solution is selected from at least one of EDTA, DTT, sucrose, trehalose and BSA.

[0009] Optionally, the impurity removal solution is selected from at least one of NaOH and KOH.

[0010] Optionally, the precipitation solution is selected from at least one of ferric sulfate, ferrous sulfate, ferric nitrate, ammonium ferrous sulfate and ammonium sulfate.

[0011] Optionally, the adsorbent material is selected from at least one of activated carbon particles and silica gel particles.

[0012] In a second aspect of the present application, a method for direct amplification of whole blood without nucleic acid extraction is provided, including:

[0013] Mix the whole blood sample treatment solution provided in any one of the first aspects evenly to obtain a mixed system;

[0014] After standing, centrifuge the mixed system;

[0015] Use the supernatant after centrifugation to dissolve the PCR lyophilized beads;

[0016] Use the dissolved PCR lyophilized beads as a template for amplification.

[0017] In a third aspect of the present application, a detection kit is provided, and the kit contains the whole blood sample treatment solution provided in any one of the first aspects.

[0018] In a fourth aspect of the present application, an application of the whole blood sample treatment solution provided in any one of the first aspects in molecular diagnosis is provided.

[0019] In the present application, the whole blood sample treatment solution and the whole blood sample are mixed and centrifuged. The whole blood sample treatment solution can lyse cells and pathogens, decompose proteins, lipids and adsorb colored substances such as heme. Most inhibitors can be effectively removed by simple centrifugation, and a relatively pure pathogen nucleic acid supernatant can be obtained. The supernatant is aspirated and transferred to a PCR tube containing PCR lyophilized beads, and then directly detected in a fluorescence quantitative PCR instrument. The whole process is simple, fast and accurate.

[0020] The method for direct amplification of whole blood without nucleic acid extraction of the present invention has good tolerance to clinically common complex blood samples such as hemolysis, lipolysis, and jaundice, effectively avoiding the problem of missed detection caused by complex blood. Compared with blood purification methods, the operation is simpler, more efficient, and the cost is lower. The removal of impurities by the precipitation solution and the adsorbent material significantly reduces the inhibitory effect of inhibitors in the blood on PCR amplification, and can effectively reduce the problem of missed detection of negative-to-positive caused by excessive inhibitors. Description of the Drawings

[0021] Figure 1 It is a schematic diagram of the detection result of Comparative Example 1 provided by the present invention;

[0022] Figure 2 It is a schematic diagram of the detection result of Example 1 provided by the present invention;

[0023] Figure 3 It is a schematic diagram of the detection result of Comparative Example 2 provided by the present invention;

[0024] Figure 4 Schematic diagram of the detection result of Example 2 provided by the present invention;

[0025] Figure 5 Schematic diagram of the detection result of Comparative Example 3 provided by the present invention;

[0026] Figure 6 Schematic diagram of the detection result of Example 3 provided by the present invention;

[0027] Figure 7 Schematic diagram of the detection result of Comparative Example 4 provided by the present invention;

[0028] Figure 8 Schematic diagram of the detection result of Example 4 provided by the present invention. Detailed implementation manners

[0029] The technical solutions in the embodiments of the present invention will be clearly and completely described below. Apparently, the described embodiments are only a part of the embodiments of the present invention, rather than all of the embodiments. All other embodiments obtained by those of ordinary skill in the art based on the embodiments of the present invention without creative efforts shall fall within the protection scope of the present invention.

[0030] The present application provides a whole blood sample processing solution, including: a buffer solution, a lysis solution, a nucleic acid protection solution, a impurity removal solution, a precipitation solution, and an adsorption substance.

[0031] The buffer solution can maintain the system within a certain pH range; the main function of the lysis solution is to lyse cells and pathogens; the nucleic acid protection solution can protect the pathogen DNA or RNA released by lysis.

[0032] In the prior art, it usually contains three components: a buffer solution, a lysis solution, and a nucleic acid protection solution. However, since the blood sample may contain inhibitors, such as hemoglobin, plasma proteins, and various enzyme substances in the blood, such as nucleases, proteases, and glycosidases, and at the same time, the blood sample also contains some metal ions, such as magnesium ions, iron ions, etc. These inhibitors have an adverse effect on the lysis of the blood sample and are likely to interfere with the fluorescence detection module of the detection instrument, resulting in abnormal fluorescence curves. To eliminate these effects, the present application adds an impurity removal solution, a precipitation solution, and an adsorption substance. The main function of the impurity removal solution is to denature and decompose the inhibitors and reduce their interference with subsequent PCR amplification; the main function of the precipitation solution is to remove substances such as hemoglobin and heme in the whole blood; the main function of the adsorption substance is to remove colored substances in the system, such as heme, etc.

[0033] Optionally, the buffer reagent is selected from one of Tris-HCl buffer solution, Phosphate buffer solution, HEPES buffer solution, and MOPS buffer solution.

[0034] Optionally, the lysis solution is selected from at least one of guanidine isothiocyanate, guanidine thiocyanate, SDS, Triton-X100, and NP40.

[0035] Optionally, the nucleic acid protection solution is selected from at least one of EDTA, DTT, sucrose, trehalose, and BSA.

[0036] Optionally, the impurity removal solution is selected from at least one of NaOH and KOH.

[0037] Optionally, the precipitation solution is selected from at least one of ferric sulfate, ferrous sulfate, ferric nitrate, ammonium ferrous sulfate, and ammonium sulfate.

[0038] Optionally, the adsorbent is selected from at least one of activated carbon particles and silica gel particles.

[0039] The present application also provides a whole blood direct amplification method without nucleic acid extraction, including the following steps:

[0040] Step 100: Mix the whole blood sample and the whole blood sample treatment solution of the present application evenly to obtain a mixed system.

[0041] In this step, the mixing is carried out according to the ratio of whole blood sample: whole blood sample treatment solution = 1:10, that is, 1 volume of blood is added to 10 volumes of the whole blood sample treatment solution and mixed evenly.

[0042] Step 200: After standing, centrifuge the mixed system.

[0043] Step 300: Dissolve the PCR lyophilized beads with the supernatant after centrifugation.

[0044] Step 400: Use the dissolved PCR lyophilized beads as a template for amplification.

[0045] The present application uses the whole blood sample treatment solution and the whole blood sample for mixing and centrifugation. The whole blood sample treatment solution can lyse cells and pathogens, decompose proteins, lipids, and adsorb colored substances such as heme. Most inhibitors can be effectively removed by simple centrifugation, and a relatively pure pathogen nucleic acid supernatant can be obtained. The supernatant is aspirated and transferred to a PCR tube containing PCR lyophilized beads, and then directly detected in a fluorescence quantitative PCR instrument. The whole process is simple, rapid, and accurate, without the need for professional background, and non-professionals can also quickly get started. It has good application prospects for community hospitals, pet hospitals, etc.

[0046] The present application also provides a detection kit, and the kit contains the whole blood sample treatment solution of the present application.

[0047] The above-mentioned whole blood sample processing solution of the present application is applied to molecular diagnosis. The whole blood sample is processed using the whole blood sample processing solution, and the supernatant after centrifugation is used to dissolve the PCR lyophilized beads. The dissolved PCR lyophilized beads are used as templates for amplification. It can be applied to the detection of pathogens in blood samples related to animal infections, such as the detection of Babesia canis, Babesia gibsoni, feline leukemia virus, feline immunodeficiency virus, Bartonella henselae, Leptospira, etc., and can also be applied to the detection of pathogens in blood samples related to human infections, such as the detection of hepatitis B virus, hepatitis C virus, human immunodeficiency virus, Mycobacterium tuberculosis, Plasmodium, Schistosoma, Treponema pallidum, etc.

[0048] The following further illustrates the present application through specific examples.

[0049] Examples 1 - 4 :

[0050] (1) Prepare the whole blood sample processing solution according to the following components and ratios. Among them, all concentrations are the final concentrations that can be directly used after mixing.

[0051] Table 1 Components and ratios of Examples 1 - 4

[0052]

[0053] (2) Prepare the PCR lyophilized bead solution according to the following components and ratios:

[0054]

[0055] The prepared PCR lyophilized bead solution is added dropwise to liquid nitrogen at 25 μL per portion, and then placed in a freeze dryer for vacuum freezing into PCR lyophilized beads.

[0056] The concentrations in the above ratios are all the final concentrations of the mixed system, and "%" is the mass - volume ratio, that is, g / 100 mL. FPV - F, FPV - R, and FPV - P represent the upstream primer, downstream primer, and probe respectively.

[0057] (3) PCR amplification:

[0058] Adopt the one - step method for processing. Pipette 60 μL of blood sample and add it to a storage tube containing 600 μL of whole blood sample processing solution. Invert it up and down 10 times, then let it stand at room temperature for 2 min. Place the storage tube in a centrifuge for centrifugation. The centrifugation speed and time are set to 8000 rpm for 1 min. After centrifugation, pipette 50 μL of the supernatant and add it to a PCR tube containing 1 PCR lyophilized bead, and use an ABI7500 fluorescence quantitative PCR instrument or a Hongshi SLAN96P fluorescence quantitative PCR instrument for amplification detection.

[0059] Among them, the amplification program is shown in Table 2 below.

[0060] Table 2 Amplification programs of Examples 1-4

[0061]

[0062] Comparative Example 1 :

[0063] The blood samples were purified using the magnetic bead method blood genomic DNA extraction kit (product number DP329) produced by Tiangen Biochemical Technology (Beijing) Co., Ltd. 200 μL of blood samples were added, and 50 μL of eluent was used for nucleic acid elution. 5 μL was taken for PCR amplification. The PCR amplification reagent used was the 2×HotStartTaq PCR Premix reagent (product number KT202) produced by Tiangen Biochemical Technology (Beijing) Co., Ltd. The specific amplification system is as follows:

[0064]

[0065] Among them, the amplification program is as shown in Table 3 below:

[0066] Table 3 Amplification program of Comparative Example 1

[0067]

[0068] In this application, the upstream primers, downstream primers and probes used in each example and comparative example are the same. The specific base sequences are as follows:

[0069] Table 4 Base sequences of Comparative Example 1

[0070] Item Base sequence FPV - F (upstream primer) TAACACCTTGGTCATTGGTTGAT FPV - R (downstream primer) AAAAATTTCTTGTTCAAAACTRACTAAAT FPV - P (probe) CTTGGGGAGTTTGGTTTAATCCAGGAGA

[0071] Comparative Example 2 :

[0072] Using Lyo-Ready TM Direct DNA qPCR Blood reagent (product number MDX0122) from Mideian, direct whole blood one-step loading detection was performed. 5 μL of blood samples were taken and added to the prepared PCR system with a total volume of 50 μL. An ABI7500 fluorescence quantitative PCR instrument was used for amplification detection.

[0073] The specifically prepared amplification system is as follows:

[0074]

[0075]

[0076] Among them, the amplification program is as follows:

[0077] Table 5 Amplification program of Comparative Example 2

[0078]

[0079] Comparative Example 3 :

[0080] The difference between Comparative Example 3 and Example 3 lies only in the whole blood sample treatment solution. The components and ratios of the whole blood sample treatment solution in Comparative Example 3 are shown in the following table.

[0081] Table 6 Components and ratios of Comparative Example 3

[0082] Component Comparative Example 3 Buffer 15 mM HEPES buffer Lysis solution 20 mM guanidine isothiocyanate; 16 mM NP40 Nucleic acid protection solution 0.6 mM DTT; 0.003 mM BSA; 8.8 mM trehalose; 3 mM sucrose; 2 mM EDTA Impurity removal solution 20 mM KOH Precipitation solution 10 mM iron nitrate; 15 mM ammonium sulfate Adsorbent /

[0083] Comparative Example 4 :

[0084] The difference between Comparative Example 4 and Example 4 lies only in the whole blood sample treatment solution. The components and ratios of the whole blood sample treatment solution in Comparative Example 4 are shown in the following table.

[0085] Table 7 Components and ratios of Comparative Example 4

[0086]

[0087]

[0088] Detection method :

[0089] Four whole blood samples were selected, namely S1, S2, S3, and S4. Among them, S1 is a newly collected non-hemolyzed sample, S2 is a hemolyzed sample, S3 is a lipolyzed sample, and S4 is a jaundiced sample. At the same time, 1 case of FPV-positive whole blood sample with a concentration of 1.00E+06 copies / mL was selected. According to the ratio of 1:99, S1-S4 were respectively diluted, and the same amount of high-concentration FPV (feline panleukopenia virus) positive whole blood sample was added to make the final concentration of FPV in the four blood samples 10000 copies / mL.

[0090] The above four diluted FPV-positive whole blood samples were respectively amplified under the experimental conditions of Examples 1-4 and Comparative Examples 1-4, and the experimental results are as Figures 1 - 8 shown in Tables 8-11. Figures 1 - 8 In the figure, red represents S1, yellow represents S2, blue represents S3, and green represents S4. The vertical coordinate ΔRn in the figure represents the fluorescence value, the horizontal coordinate Cycle represents the number of cycles, CT is the number of cycles experienced by PCR when the fluorescence value reaches the set threshold, and the smaller the CT value, the higher the initial concentration; if the same nucleic acid template is added, the smaller the CT, the higher the amplification efficiency of the system and the fewer the inhibitors in the system.

[0091] Table 8 Statistical table of amplification results of control reagents and samples of the present invention

[0092] Sample name Control reagent (Comparative Example 1) This invention (Example 1) S1 (Newly collected) 31.81 31.34 S2 (Hemolysis) 31.61 31.62 S3 (Lipolysis) 31.93 32.00 S4 (Jaundice) 31.83 31.57

[0093] Table 9 Statistical Table of Amplification Results of Control Reagents and Samples of the Present Invention

[0094] Sample name Control reagent (Comparative Example 2) This invention (Example 2) S1 (Newly collected) 32.11 32.54 S2 (Hemolysis) - 32.11 S3 (Lipolysis) 34.53 32.36 S4 (Jaundice) 33.99 32.17

[0095] Table 10 Statistical Table of Amplification Results of Control Reagents and Samples of the Present Invention

[0096] Sample name Control reagent (Comparative Example 3) This invention (Example 3) S1 (Newly collected) 32.54 31.52 S2 (Hemolysis) - 31.79 S3 (Lipolysis) 33.98 32.09 S4 (Jaundice) 33.89 31.98

[0097] Table 11 Statistical Table of Amplification Results of Control Reagents and Samples of the Present Invention

[0098] Sample name Control reagent (Comparative Example 4) This invention (Example 4) S1 (Newly collected) 31.52 31.22 S2 (Hemolysis) 31.23 S3 (Lipolysis) 33.51 31.53 S4 (Jaundice) 33.34 31.66

[0099] (1) From the comparison results of Example 1 and Comparative Example 1, the Tiangen reagent compared with the present invention has purified nucleic acid from blood and removed inhibitory components such as heme, so there is no inhibition in amplification. The method of direct whole blood amplification without nucleic acid extraction of the present invention is comparable to the nucleic acid amplification result after whole blood purification, has good tolerance to clinically common complex blood samples such as hemolysis, lipolysis, and jaundice, effectively avoids the problem of missed detection caused by complex blood, and is more simple, efficient, and lower in cost compared with the blood purification method, and is very suitable for places such as community hospitals and pet clinics that require simple operation, fast speed, and low cost.

[0100] (2) From the comparison results of Example 2 and Comparative Example 2, for the lipolysis and jaundice samples, the curve of the Maidian reagent will be significantly delayed, and for the hemolysis sample, the amplification is directly inhibited. Since Maidian directly adds untreated blood to the amplification system and does not process the blood like the present invention, PCR inhibitory components such as lipids and heme in the blood will exist and will have a relatively large inhibition on PCR amplification. The reagent and operation method of the present invention have good amplification effects on hemolysis, lipolysis, and jaundice samples and have a high consistency with newly collected samples.

[0101] (3) From the comparison results of Examples 3 and 4 and Comparative Examples 3 and 4, the removal of impurities by the precipitation solution and adsorption substances significantly reduces the inhibition of PCR amplification by inhibitors in the blood, can effectively improve the amplification efficiency of the PCR system, especially for hemolysis samples with more inhibitory components, the effect is more obvious, and can effectively reduce the problem of missed detection of negative-to-positive caused by excessive inhibitors.

[0102] In summary, the method of direct whole blood amplification without nucleic acid extraction of the present invention has more advantages for complex blood samples such as hemolysis, lipolysis, and jaundice, can effectively avoid or reduce the inhibitory effect of impurities in the blood on the amplification system, and avoid the problem of missed detection caused by inhibitory substances in the blood.

[0103] The above are only embodiments of the present invention and are not intended to limit the present invention. Any modifications, equivalent replacements, improvements, etc. made within the spirit and principle of the present invention are included within the scope of the claims of the present invention pending approval.

Claims

1. A whole blood sample processing solution, characterized in that, Comprising: Buffer solution, lysis solution, nucleic acid protection solution, impurity removal solution, precipitation solution and adsorption substance.

2. The whole blood sample processing solution according to claim 1, wherein The buffer reagent is selected from one of Tris-HCl buffer solution, Phosphate buffer solution, HEPES buffer solution and MOPS buffer solution.

3. The whole blood sample processing solution according to claim 1, wherein The lysis solution is selected from at least one of guanidine isothiocyanate, guanidine thiocyanate, SDS, Triton-X100 and NP40.

4. The whole blood sample processing solution according to claim 1, characterized in that, The nucleic acid protection solution is selected from at least one of EDTA, DTT, sucrose, trehalose and BSA.

5. The whole blood sample processing solution according to claim 1, wherein The impurity removal solution is selected from at least one of NaOH and KOH.

6. The whole blood sample processing solution according to claim 1, characterized in that, The precipitation solution is selected from at least one of ferric sulfate, ferrous sulfate, ferric nitrate, ammonium ferrous sulfate and ammonium sulfate.

7. A whole blood sample processing solution according to claim 1, characterized in that, The adsorption substance is selected from at least one of activated carbon particles and silica gel particles.

8. A whole blood direct amplification method without nucleic acid extraction, characterized in that, Comprising: Mix the whole blood sample and the whole blood sample treatment solution according to any one of claims 1 to 7 evenly to obtain a mixed system; After standing, perform centrifugation on the mixed system; Dissolve the PCR lyophilized beads with the supernatant after centrifugation; Use the dissolved PCR lyophilized beads as a template for amplification.

9. A detection kit, characterized in that, The kit contains the whole blood sample treatment solution according to any one of claims 1-7.

10. Use of the whole blood sample treatment solution according to any one of claims 1 to 7 in molecular diagnosis.

Images