Site-directed knock-in heterozygote mouse with conditional overexpression SaCas9 gene as well as preparation method and application of site-directed knock-in heterozygote mouse

Abstract

The invention belongs to the technical field of gene editing, and discloses a site-directed knock-in heterozygote mouse of conditional overexpression SaCas9 gene and a preparation method and application thereof. Based on the bottleneck of the prior art, the invention provides an innovative solution for constructing the uterus specific conditional editing mouse based on the CRISPR / SaCas9 system. The efficient editing ability of SaCas9 is innovatively combined with the uterus tissue specific Pgr promoter. Rapid and efficient single gene editing is realized in the uterus, such as activation expression of Egfp and specific conditional knockout of Ythdc2. The system breaks through breeding limitation of a traditional Cre system, and rapid and accurate editing is achieved. The system not only can remarkably shorten the model construction period, but also can provide an animal model for diseases such as reproductive disorder or infertility.

Description

Technical Field

[0001] The present invention belongs to the technical field of gene editing, and more specifically, relates to a site-directed knock-in heterozygous mouse for conditional overexpression of the SaCas9 gene, and a preparation method and application thereof. Background Art

[0002] Compared with conventional SpCas9, SaCas9 has a more compact molecular structure (1053 amino acid residues), and achieves DNA cutting through the synergistic action of the RuvC and HNH dual domains: the RuvC domain uses the RNase H fold and dual metal ion mechanism to cut the non-target chain, while the HNH domain acts on the target chain through the ββα-metal fold and single metal ion mechanism. It is worth noting that SaCas9's specific recognition of the 5'-NNGRRT-3'PAM sequence, combined with its smaller molecular size, makes it easier to achieve efficient delivery through adenoviral vectors. Studies have confirmed that the SaCas9-mediated in vivo editing system shows significant advantages in gene knockout efficiency and targeting specificity.

[0003] In the field of reproductive medicine, the uterus is the core organ for embryo implantation and pregnancy maintenance, and its functional regulation involves a complex spatiotemporal-specific gene expression network. Traditional systemic gene knockout models are often difficult to accurately analyze uterine-specific gene functions due to embryonic lethality or multi-organ compensatory effects. For example, systemic deletion of key genes may cause endocrine disorders, thereby masking their local mechanisms of action in endometrial proliferation, embryo implantation or decidualization. Conditional knockout models constructed using uterine epithelial / stromal cell-specific promoters (such as Wnt7a, Ltf, and Pgr) can effectively circumvent systemic interference and provide a high-precision research platform for studying the molecular mechanisms of diseases such as recurrent miscarriage and endometriosis.

[0004] At present, conditional gene editing in utero mainly relies on the Cre / loxP recombinase system. In this system, the Cre recombinase derived from bacteriophage P1 realizes DNA recombination by recognizing 34bp LoxP sites: the same-direction LoxP sites mediate gene fragment deletion, the reverse sites cause sequence flipping, and the interchromosomal sites cause translocation. Although this system plays an important role in the spatiotemporal regulation of genes, its application has significant limitations: tissue-specific knockout must be achieved through multi-generational hybridization of mouse strains (target gene floxed mice × Cre tool mice), resulting in a long experimental cycle and high artificial breeding costs. Summary of the invention

[0005] In order to overcome the above-mentioned problems existing in the prior art, the primary purpose of the present invention is to provide a sgRNA for targeted knockout of uterine-specific conditional Ythdc2.

[0006] The second object of the present invention is to provide a method for constructing a uterus-specific conditional Ythdc2 knockout mouse.

[0007] The object of the present invention is achieved by the following technical solutions:

[0008] An sgRNA for targeting and knocking out uterus-specific conditional Ythdc2, and the sequence of the sgRNA is shown as SEQ ID NO: 1 and SEQ ID NO: 2.

[0009] The present invention first screens sgRNAs with activities in vivo and in vitro, thus laying a foundation for subsequent construction of mice with targeted knockout of uterus-specific conditional Ythdc2.

[0010] Therefore, the present invention also provides the application of the sgRNA in the method for constructing a uterus-specific conditional Ythdc2 knockout mouse.

[0011] The present invention also provides a gene expression cassette, and the gene expression cassette is CAG-LSL-SaCas9-WPRE-polyA.

[0012] The present invention also provides the application of the gene expression cassette in constructing tissue-specific conditional gene-editing mice based on the CRISPR-SaCas9 system.

[0013] Preferably, in a homologous recombination manner, the expression cassette described in claim 3 is inserted at the H11 gene locus to obtain a recombinant vector, and the recombinant vector, Cas9 mRNA, and gRNA are microinjected into the fertilized eggs of mice to obtain F0 generation mice, and the F0 generation mice are backcrossed to obtain positive heterozygous mice.

[0014] The above-obtained positive heterozygous mice have the efficient editing ability of SaCas9, and by combining with the uterus-specific Pgr promoter, rapid and efficient single-gene editing is achieved in the uterus.

[0015] Therefore, the present invention also provides a method for constructing a uterus-specific conditional Ythdc2 knockout mouse, including the following steps:

[0016] S1. Construct a heterozygous H11 knock-in mouse with conditional overexpression of the SaCas9 gene at the H11 locus LSL-SaCas9 / + ;

[0017] S2. Construct a U6 sgYthdc2 sgRNA mouse: By the method of fertilized egg injection, a homologous recombination vector containing U6-sgRNA and PiggyBAC mRNA are injected into the fertilized eggs of mice to obtain F0 generation mice, and the F0 generation mice are backcrossed to obtain positive U6 sgYthdc2sgRNA mice; wherein, the sequences of the sgRNAs are shown as SEQ ID NO: 1 and SEQ ID NO: 2;

[0018] S3. Cross and breed the H11 LSL-SaCas9 / + heterozygous mice and Pgr Cre / + mice to obtain double-gene heterozygous mice;

[0019] S4. Cross the Pgr Cre / + ; H11 LSL-SaCas9 / + double-gene heterozygous mice with U6 sgYthdc2 sgRNA mice and breed them to obtain triple-gene heterozygous mice, which are the uterus-specific conditional Ythdc2 knockout mice.

[0020] The present invention also provides the application of the above method in the development of uterine-targeted gene therapy for non-disease diagnosis and treatment purposes.

[0021] Compared with the prior art, the present invention has the following beneficial effects:

[0022] Based on the bottlenecks of the prior art, the present invention proposes an innovative solution - constructing a uterus-specific conditional editing mouse based on the CRISPR / SaCas9 system. Innovatively combines the efficient editing ability of SaCas9 with the uterus tissue-specific Pgr promoter. Achieves rapid and efficient single-gene editing in the uterus, such as the activation expression of Egfp and the specific conditional knockout of Ythdc2. This system breaks through the breeding limitations of the traditional Cre system and realizes rapid and precise editing. This system can not only significantly shorten the model construction cycle, but also provide animal models for diseases such as reproductive disorders or infertility. BRIEF DESCRIPTION OF THE DRAWINGS

[0023] Figure 1 is the design strategy of the heterozygous mice in Example 1 of the present invention;

[0024] Figure 2 is the plasmid map of the homologous recombination vector in Example 1;

[0025] Figure 3 is the restriction enzyme digestion identification of the homologous recombination plasmid; wherein M is 1 kb DNA ladder;

[0026] Figure 4 is the schematic diagram of the identification strategy of F0 generation mice;

[0027] Figure 5 is the PCR identification result of the homologous recombination positive F0 generation mice; wherein 6 and 9 are the numbers of F0 generation mice, and M is 1 kb DNA Marker;

[0028] Figure 6Results of double-arm PCR genotype identification of F1-generation mice. Among them, the numbers represent the numbers of F1-generation mice, wt is the wild-type control, and M is the 1kb DNA ladder;

[0029] Figure 7 Results of sequencing reaction comparison of PCR product 1#. Query is the target sequence (H11-LSL-SaCas9 recombinated genomic DNA sequence), Subject is the sequencing result, and the bases underlined in red are the 5arm homologous arm sequences;

[0030] Figure 8 Results of sequencing reaction comparison of PCR product 2#. Query is the target sequence (H11-LSL-SaCas9 recombinated genomic DNA sequence), Subject is the sequencing result, the bases underlined in red are the 5arm homologous arm sequences; the bases underlined in blue are the knock-in sequences;

[0031] Figure 9 Results of sequencing reaction comparison of PCR product 3#. Query is the target sequence (H11-LSL-SaCas9 recombinated genomic DNA sequence), Subject is the sequencing result, the bases underlined in red are the 3arm homologous arm sequences; the bases underlined in blue are the knock-in sequences;

[0032] Figure 10 Results of sequencing reaction comparison of PCR product 4#. Query is the target sequence (H11-LSL-SaCas9 recombinated genomic DNA sequence), Subject is the sequencing result, and the bases underlined in red are the 3arm homologous arm sequences;

[0033] Figure 11 Schematic diagram of the sgRNA mouse design strategy;

[0034] Figure 12 Genotype identification of Egfp-ON-SaCas9 mice. Among them, lane 1 represents Pgr Cre / + ; H11 LSL-SaCas9 / + ; U6 sgmCherryⅡ Triple-gene heterozygous mice, lane 2 represents Pgr Cre / + ; H11 LSL-SaCas9 / + Double-gene heterozygous mice, lane 3 represents U6 sgmCherryⅡ mice, lane 4 represents WT mice, lane 5 represents H2O, and M represents Marker;

[0035] Figure 13 Show the expression of EGFP in the uterus of Egfp-ON-SaCas9 mice, where (a) white light and fluorescence images of the uterus of early pregnant mice (D4), scale bar, 1 cm; (b) protein levels of EGFP and SaCAS9 in the uterus of early pregnancy (D4); (c) immunohistochemical image of EGFP in the uterus of early pregnancy (D4), scale bar, 100 μm. ST: stroma, L: lumen, LE: luminal epithelium, GE: glandular epithelium.

[0036] Figure 14 The genotype identification results of Ythdc2-CKO mice, where lane 1 represents Pgr Cre / + ; H11 LSL-SaCas9 / + ; U6 sgYthdc2 Triple heterozygous mice, lane 2 represents Pgr Cre / + ; H11 LSL-SaCas9 / + Double heterozygous mice, lane 3 represents U6 sgYthdc2 Mice, lane 4 represents WT mice, lane 5 represents H2O, M represents Marker;

[0037] Figure 15 Show the verification of the knockout efficiency of Ythdc2-CKO mice, where (a) relative mRNA expression level of Ythdc2 in the uterus of pregnant D4, * represents P<0.05; (b) protein levels of YTHDC2 and SaCAS9 in the uterus of pregnant D4 and quantification of YTHDC2 protein, ** represents P<0.01; (c) localization of YTHDC2 in the uterus of pregnant D4 and quantification of H-Score, scale bar, 100 μm, **** represents P<0.0001. Detailed implementation mode

[0038] To better illustrate the purpose, technical solution and advantages of the present invention, the present invention will be further described below in conjunction with specific drawings and embodiments. In the embodiments, the experimental methods used are all conventional methods unless otherwise specified, and the materials, reagents, etc. used can be obtained from commercial channels unless otherwise specified.

[0039] Example 1 Construction of a heterozygous mouse with a site-specific knock-in of the conditional overexpression of the SaCas9 gene (H11 LSL-SaCas9 )

[0040] The design strategy is as Figure 1, Cas9 mRNA and gRNA were obtained by in vitro transcription; a homologous recombination vector (donor vector) was constructed by In-Fusion cloning method, and this vector contains a 5.0 kb 5' homologous arm, CAG-LSL-SaCas9-WPRE-polyA and a 3.7 kb 3' homologous arm (such as Figure 2 ). Cas9 mRNA, gRNA (sequence of gRNA: 5'-ACTGCCTCCTCAGCTTCAAGAGG-3') and donor vector were microinjected into the fertilized eggs of C57BL / 6J mice to obtain F0 generation mice. Positive F0 generation mice identified by PCR amplification and sequencing were mated with C57BL / 6J mice to breed 6 positive F1 generation mice.

[0041] Gene name at the insertion site: Hipp11 locus (located at the junction of genes Eif4enif1 (ENSMUSG00000020454) and Drg1 (ENSMUSG00000020457)), abbreviation: H11, Ensembl website link of the target gene at the insertion site: http: / / www.ensembl.org / Mus_musculus / Gene / Summary?db=core;g= ENSMUSG00000020454;r=11 : 3202392-3244588 ; Chromosomal location at the insertion site (Ensembl): Chromosome 11:3,245,259.

[0042] The above constructed homologous recombination vector was identified by restriction enzyme digestion, and the results were as Figure 3 , and the theoretical band sizes were 9760 bp, 4686 bp, 2776 bp, 2320 bp, and 1527 bp respectively, which met the expectations.

[0043] 1. Genotype identification of F0 and F1 generation mice

[0044] The injected fertilized eggs were transplanted into pseudopregnant female mice, and the mice born about 20 days later were F0 generation mice. Their genotypes were identified by PCR amplification and sequencing. Since the early cleavage rate of fertilized eggs is very fast, the obtained F0 generation mice are chimeras and do not necessarily have the ability to stably inherit, and need to be passed on to obtain F1 generation mice that can stably inherit.

[0045] PCR identification of homologous recombination positive mice: The 5' arm homologous recombination positive genome should amplify a 5.4 kb fragment, and the negative genome should amplify a 10.2 kb fragment; the 3' arm homologous recombination positive genome should amplify a 4.8 kb fragment, and the negative genome should amplify a 9.4 kb fragment.

[0046] 1.1. PCR identification method for 5' homologous arm recombination positive F0 generation mice

[0047] The primer information is shown in Table 1, the reaction system is shown in Table 2, and the reaction conditions are shown in Table 3.

[0048] Table 1

[0049] Primer Sequence 5'-->3' Primer Type I CTTGTGAGGGCCTACTGTGAC Forward II CTTTCCGGAGATAGGGTGTTA Reverse

[0050] Table 2 Reaction System

[0051]

[0052]

[0053] *KOD-Multi&Epi-(TOYOBO, CodeNo: KME-101)

[0054] Table 3 Reaction Conditions

[0055] Step# Temp(℃) Time Note 1 94 3min - 2 98 20sec - 3 63 20sec - 4 68 4min repeat steps 2-4 for 35 cycles 5 68 5min - 6 12 - hold

[0056] 1.2, PCR Identification Method for 3'Homologous Arm Recombinant Positive F0 Generation Mice

[0057] The primer information is shown in Table 4, the reaction system is shown in Table 5, and the reaction conditions are shown in Table 6.

[0058] Table 4

[0059] Primer Sequence 5'-->3' Primer Type III TGCCCCTTTGTGTTCTCTTGTAG Forward IV TGCACCTTTAGCTCCTCAGC Reverse

[0060] Table 5 Reaction System

[0061] Reaction Component Volume(μl) ddH2O 8.05 2xPCR Buffer 10 Primer III(20pmol / μl) 0.3 Primer IV(20pmol / μl) 0.3 KOD-Multi&Epi-* 0.35 Genomic DNA 1 Total 20

[0062] *KOD-Multi&Epi-(TOYOBO, Code No: KME-101)

[0063] Table 6

[0064] Step# Temp(℃) Time Note 1 94 3min - 2 98 20sec - 3 63 20sec - 4 68 4min repeat steps 2-4 for 35 cycles 5 68 5min - 6 12 - hold

[0065] The F0 generation mice with positive double-arm homologous recombination are Nos. 6 and 9, and the electrophoresis results of long-fragment PCR identification are as Figure 5 .

[0066] 1.3, 5' and 3'Homologous Arm PCR Identification of F1 Generation Mice

[0067] The F0 generation positive mice were mated with wild-type C57BL / 6J mice to breed F1 generation mice, and their genotypes were identified by PCR identification and sequencing. The PCR identification strategy and method are the same as those in the F0 generation mouse identification section. The electrophoresis results of 5' and 3'homologous arm PCR identification of F1 generation mice are as Figure 6As shown, the positive mice identified by PCR were: No. 8, 9, 10, 11, 13, 14; all were confirmed to be positive by sequencing.

[0068] Sequencing of the PCR identification products of the F1 generation positive mice (the results are as Figures 7-10 ), and a total of 4 sequencing reactions were carried out. The regions corresponding to the sequencing reactions. Among them, for the identification of the 5' homologous arm, 2 sequencing reactions were carried out for the PCR product sequencing, which were respectively labeled as: 1, 2; for the identification of the 3' homologous arm, 2 sequencing reactions were carried out for the PCR product sequencing, which were respectively labeled as: 3, 4.

[0069] Example 2 Construction of sgRNA Mice

[0070] Construction of U6 sgmCherryⅡ and U6 sgYthdc2 sgRNA mice: These 2 kinds of sgRNA mice are overexpressing transgenic mice obtained by randomly transferring U6-sgRNA into the mouse genome using the PiggyBAC transposase system and the method of injecting fertilized eggs. First, the mRNA of PiggyBAC was obtained by in vitro transcription, and then the homologous recombination vector containing the target fragment and the mRNA of PiggyBAC were injected into the fertilized eggs of mice by microinjection, and the F0 generation mice were obtained through breeding. The F0 generation mice were subsequently backcrossed with wild-type mice for 2 - 3 generations, and then strains were established by selecting mice with stable expression. The schematic diagram of the sgRNA mouse design strategy is as Figure 11 shown.

[0071] Table 7 sgRNA Sequences

[0072]

[0073] Example 3 Construction of Uterus-Specific Conditional Editing Mice

[0074] I. Breeding of Double-Gene Heterozygous Mice

[0075] The H11 LSL-SaCas9 / + heterozygous mice were mated and bred with Pgr Cre / + mice to obtain double-gene heterozygous mice. The Pgr Cre / + mice were purchased from Model Animal Research Center, and have been widely used in the production of specific uterine gene-deficient mice.

[0076] II. Breeding of Triple-Gene Heterozygous Mice to Achieve Activation and Expression of EGFP in the Uterus

[0077] To verify the feasibility of the CRISPR / SaCas9 system in achieving gene editing in the uterus, in this study, the Pgr Cre / + ; H11 LSL-SaCas9 / + double-gene heterozygous mice were mated and bred with U6 sgmCherryⅡ sgRNA mice to obtain triple-gene heterozygous mice: PgrCre / + ; H11 LSL-SaCas9 / + ; U6 sgmCherryⅡ Mouse. The working principle of this system is that Cre enzyme excises the LSL termination box to enable the expression of SaCAS9 protein in the mouse uterus. After SaCAS9 recognizes and binds to sgRNA-mCherryⅡ, it cuts in the uterine DNA to make EGFP expressed.

[0078] Genotype identification results of Egfp-ON-SaCas9 mice: Figure 12 As shown by the electrophoresis results: The one with a band at 859bp, 830bp, 567bp, 362bp and 597bp each is Pgr Cre / + ; H11 LSL-SaCas9 / + ; U6 sgmCherryⅡ Mouse (Egfp-ON-SaCas9); The one with a band at 859bp, 830bp, 567bp and 362bp each is Pgr Cre / + ; H11 LSL-SaCas9 / + Double-gene heterozygous mouse (Control); The one with a band at 597bp is U6 sgmCherryⅡ Mouse; The one with a band at 859bp and 567bp each is the WT mouse.

[0079] To detect whether EGFP is normally activated in the uterus of Egfp-ON-SaCas9 mice, this study collected samples from Egfp-ON-SaCas9 mice on D4 of early pregnancy. Under white light, compared with the control group, the uterine morphology of Egfp-ON-SaCas9 mice was normal; under green excitation light, the uterus of Egfp-ON-SaCas9 mice showed red due to carrying mCherryⅡ; under blue excitation light, the uterus of Egfp-ON-SaCas9 mice showed green due to correct DNA cleavage and normal expression of EGFP( Figure 13 a). To further detect the expression of EGFP in the uterus, this study conducted Western Blot experiments. The results showed that there was no EGFP protein in the control group mice, and EGFP protein was detected in Egfp-ON-SaCas9 mice; both groups of mice had SaCAS9 protein expression in the uterus( Figure 13 b). The immunohistochemical results showed that there was a large amount of localization and expression of EGFP in the uterine stroma and myometrium of the experimental group mice( Figure 13 c).

[0080] Example 4 Construction of Uterus-Specific Conditional Ythdc2-Knockout Mice

[0081] As can be seen from the content of Example 3, the CRISPR / SaCas9 system can achieve gene editing in the uterus. To further confirm the effectiveness of this system, this study used PgrCre / + ; H11 LSL-SaCas9 / + Double - gene heterozygous mice and U6 sgYthdc2 mice were mated and bred to obtain triple - gene heterozygous mice. Figure 14 As shown by the electrophoresis results: The one with a band at 859bp, 830bp, 567bp, 362bp and 384bp respectively is Pgr Cre / + ; H11 LSL-SaCas9 / + ; U6 sgYthdc2 mice (Ythdc2 - CKO); The one with a band at 859bp, 830bp, 567bp and 362bp respectively is Pgr Cre / + ; H11 LSL-SaCas9 / + Double - gene heterozygous mice (Control); The one with a band at 384bp is U6 sgYthdc2 mice; The one with a band at 859bp and 567bp respectively is WT mice.

[0082] To verify whether Ythdc2 was successfully knocked out in the uterus of Ythdc2 - CKO mice, this study detected it at the mRNA level and protein level. Compared with the control group, the relative mRNA expression level of Ythdc2 was significantly down - regulated (P < 0.05), and the protein level of YTHDC2 was also significantly down - regulated (P < 0.01)( Figure 15 a - b). In addition, the localization of YTHDC2 in the uterus of mice on D4 of early pregnancy was also significantly reduced (P < 0.0001)( Figure 15 c). The above results indicate that Ythdc2 was specifically knocked out in the uterus.

[0083] Experimental methods

[0084] I. Genotype identification

[0085] Cut a 5-mm mouse ear sample to be identified and transfer it to a 200-μL centrifuge tube. Add mouse tissue lysis Buffer and Proteinase K to the centrifuge tube, 50 μL and 1 μL respectively, mix well, and centrifuge quickly for 20 s. Put the centrifuged centrifuge tube into a PCR instrument, set the program to 55 °C for 20 min and 95 °C for 5 min to lyse and extract DNA from the sample. Store the extracted DNA sample in a -40 °C refrigerator for later use. Prepare a DNA amplification system and perform amplification according to the PCR reaction conditions for different genes. The system contains 10 μL of Taq enzyme, 6 μL of dd water, 1 μL of upstream primer, 1 μL of downstream primer, and 2 μL of DNA. Prepare a 2% agarose gel using 1×TAE solution. After dissolving the agarose by high temperature in a microwave oven, add 1 μL of nucleic acid dye per 10 mL volume when the liquid is not hot, and insert a comb. Adjust the concentration of the gel according to the actual situation. After the gel solidifies, gently remove the comb, transfer the gel to an electrophoresis tank, and the sample loading volume is 8 μL per well, and the loading volume of D2000 DNA Marker (biosharp, BL102A) is 5 μL per well. The electrophoresis conditions are 125 V for 25 min. After electrophoresis, scan and photograph with a gel imager.

[0086] Table 8 Primers used in PCR

[0087]

[0088] Table 9 Gene reaction program

[0089] (1) H11 LSL-SaCas9

[0090]

[0091] (2) Pgr Cre

[0092]

[0093] (3) U6 sgmCherryⅡ and U6 sgYthdc2

[0094]

[0095] II. Real-time fluorescence quantitative PCR

[0096] (1) Place a 0.5-cm-long uterine tissue in a 2-mL grinding tube. Add 500 μL of TRIZOL (Aikrui Biotech, AG21102) and 3 magnetic beads into the tube. Then place the sample in a low-temperature tissue grinding instrument for tissue disruption and stop grinding when no tissue chunks can be seen. After grinding, transfer the sample to a 1.5-mL enzyme-free EP tube. (2) Add 100 μL of chloroform into the tube, cover the lid and shake vigorously, then let it stand at room temperature for 3 min. Place the sample in a 4°C centrifuge and centrifuge at 12,000 r / min for 15 min. After centrifugation, pipette the supernatant (250 - 280 μL) into another EP tube. Add an equal volume of isopropanol (4°C), gently shake well and let it stand at room temperature for 10 min. (3) After standing, place the EP tube in a 4°C centrifuge and centrifuge at 13,000 r / min for 10 min. Take out the centrifuge tube and discard the supernatant. (4) Add 700 μL of 75% ethanol (4°C) to each tube, centrifuge at 13,000 r / min for 10 min, and discard the supernatant. Centrifuge again at 13,000 r / min for 3 min. Take out the EP tube from the centrifuge, gently aspirate the residual alcohol in the tube, open the lid of the EP tube and let it stand at room temperature to air dry. (5) After air drying, add 20 μL of DEPC water to the EP tube in sequence, pipette to resuspend the precipitate to dissolve the precipitate and make it uniform. (6) Use a Nanodrop 2000 ultra-micro spectrophotometer to measure the OD260 value and calculate the RNA concentration. The magnetic beads of the instrument should be cleaned before detection, and the blank value should be detected. Use the instrument after meeting the requirements. After measuring the concentration, dilute the RNA concentration of each tube to 500 ng / μL with DEPC water. (7) In order to remove DNA in the extraction solution, DNA digestion is carried out next. Prepare the digestion system in advance. The composition of the system is shown in the following table. Pipette the digestion system into an EP tube and digest it in a 37°C water bath for 30 min. DNA digestion system: Reagent 10×Reaction Buffer, DEPC water, RQ1 DNase DTT (50 mM), RNase In (40 U / μL) and RNA solution Dosage 3 μL. (8) After digesting for 30 min, add 100 μL of chloroform and 100 μL of water-saturated phenol, and 170 μL of DEPC water to the digestion solution. Invert the EP tube up and down to mix the digestion solution, shake vigorously, and let it stand at room temperature for 2 - 3 min. Then place it in a 4°C centrifuge and centrifuge at 12,000 r / min for 15 min. Pipette the supernatant (about 230 μL) into another EP tube. (9) Add 3M sodium acetate solution to the new EP tube at a ratio of 9:1, that is, 35.5 μL, and then add anhydrous ethanol (890 μL) at a ratio of 1:2.5. The anhydrous ethanol is pre-cooled at -20°C in advance. Invert up and down to mix well and place it in an -80°C refrigerator overnight.(10) On the second day, after the sample was thawed, it was centrifuged at 12,000 r / min in a 4°C centrifuge for 15 min. The supernatant was discarded, and 75% ethanol (700 μL) was added to wash the precipitate. Then it was centrifuged at 13,000 r / min at 4°C for 10 min, the supernatant was poured off, and centrifugation was continued at 13,000 r / min for 3 min. After sucking out the remaining alcohol in the tube, it was left to stand at room temperature (23°C) for 15 - 20 min. (11) 10 μL of DEPC water was added to each tube, and the pipette was used to blow and beat about 50 times to dissolve the RNA precipitate. Finally, the RNA concentration was measured and diluted to 62.5 ng / μL. (12) The volume of the reverse transcription system for reverse transcription PCR was 10 μL, which consisted of 2 μL of PrimeScript RT Master Mix and 8 μL of RNA solution. The conditions for reverse transcribing the diluted RNA into cDNA were 37°C for 15 min, 85°C for 5 s, and finally stored at 4°C. After reverse transcription was completed, 20 μL of sterilized water was added and mixed well for use at 4°C. (13) The instrument used for the Real-time PCR amplification experiment was the BIORAD-CFX96TM Real-Time System, and the PCR amplification conditions were as follows: First, 95°C for 3 min; then 40 cycles were carried out according to 95°C for 10 s and 60°C for 30 s. The reaction system for Real-time PCR was 10 μL, with 5 μL of SYBR, 1 μL of each upstream and downstream primer, and 3 μL of cDNA template. After the amplification experiment was completed, the relative expression difference multiple (N) of the target gene and the internal reference gene was analyzed according to the ΔΔCT method. The calculation formula for ΔΔCT: ΔΔCT = (CT value of the target gene - CT value of the internal reference gene) - (average CT value of the target gene in the control group - average CT value of the internal reference gene in the control group), and Ntreatment group / control group = 2. ^(﹣△△CT) 。

[0097] Table 10 Primers related to the real-time fluorescence quantitative PCR experiment

[0098]

[0099] III. Immunohistochemistry

[0100] 1.1 Solution preparation: 4% paraformaldehyde fixative: Measure 4 g of paraformaldehyde and dissolve it in 10 mL of 1×PBS and 90 mL of distilled water. 10×PBS: Weigh 14.2 g of Na2HPO4, 14.2 g of KH2PO4, 2 g of KCL, and 81.8 g of NaCl, add deionized water to make up to 1 L. 1×PBS: Measure 100 mL and add distilled water to make up to 1000 mL. Sodium citrate antigen retrieval solution: Weigh 1.47 g of trisodium citrate dihydrate and 0.18 g of anhydrous sodium citrate, dissolve in 300 mL of distilled water, then add distilled water to make up to 500 mL, and adjust the pH value to 6.0. EDTA antigen retrieval solution: Measure 50 mL of 50×Tris-EDTA antigen retrieval solution, add 490 mL of distilled water, and adjust the pH value to 8.0. 3% hydrogen peroxide solution: 20 mL of hydrogen peroxide (30%) + 180 mL of methanol. Blocking solution (10% goat serum): 100 μL of blocking goat serum + 900 μL of 1×PBS. Ammonia water for blueing: 1 mL of ammonia water + 200 mL of distilled water. Hydrochloric acid for color separation: 20 μL of hydrochloric acid + 20 mL of distilled water. Weak hematoxylin staining agent: 1 mL of hematoxylin staining solution + 3 mL of 1×PBS. DAB chromogenic solution: 60 μL of DAB chromogen + 1200 μL of DAB chromogenic solution B.

[0101] 1.2 Steps for making paraffin sections (1) Sacrifice the target mice by cervical dislocation, dissect and remove the uterus, remove the mesentery, fallopian tubes and ovaries, cut the excised uterus into sections, put them into a tissue embedding frame and immerse in 4% paraformaldehyde (PFA) solution for more than 16 hours. (2) Set the program of the automatic tissue dehydrator and perform gradient dehydration: 50% alcohol for 1 h, 70% alcohol for 1 h, 80% alcohol for 1 h, 90% alcohol for 1 h, 100% alcohol I for 1 h, 100% alcohol II for 1 h, 1:1 mixture of alcohol and xylene for 20 min, xylene I for 10 min, xylene II for 10 min, 1:1 mixture of xylene and paraffin for 30 min, paraffin I for 1 h. (3) After the dehydrator program is completed, take out the embedding frame containing the tissue and put it into pre-melted wax II, and fully infiltrate the wax at 70°C for 1 h. Take out the tissue on the paraffin embedding machine, pour liquid paraffin into the embedding mold, quickly put the uterine section in the required direction with forceps, let the wax block cool and solidify, make a mark and store it for subsequent paraffin sectioning. (4) Fix the wax block on a wooden block, trim the section range with a blade, fix it on a microtome, set the section thickness to 5 microns, spread the sections with water drops, observe the tissue morphology under a microscope, collect the intact and flat sections, make a mark, place them in a 40°C oven to dry overnight, and collect and store them.

[0102] 1.3 Immunohistochemical staining

[0103] (1) Set the roasting machine at 55 °C and place the sections for roasting for 1 h. (2) Place the sections on the staining rack and immerse them in a staining cylinder containing xylene for dewaxing, 10 min each time. Alcohol gradient: 100%, 100%, 90%, 80%, 70%, 50% for 5 min each, and rehydrate with deionized water for 5 min. (3) Weigh 1.47 g of trisodium citrate dihydrate and 0.18 g of anhydrous citric acid, dissolve them in 500 mL of deionized water to prepare an acidic repair solution. Heat the repair solution to boiling in a microwave oven, put in the sections, and heat at low fire for 10 min to repair the antigenic determinant. After cooling to room temperature, place them in 1×PBS for 5 min. (4) Prepare 200 ml of 3% hydrogen peroxide solution by mixing 30% hydrogen peroxide and methanol in a ratio of 1:9, put in the sections for 10 min to block endogenous peroxidase, wash with 1×PBS 3 times, 5 min each time. (5) Outline the tissue area with a histochemical pen, add 10% goat serum, and incubate at 37 °C in an oven for 1 h. (6) Dilute the rabbit-derived specific antibody with 10% goat serum in proportion (primary antibody). The primary antibodies used include: Anti-YTHDF1 (1:100), Anti-YTHDF2 (1:1000), YTHDF3 (1:500), and incubate overnight at 4 °C. (7) Recover the primary antibody, wash with 1×PBS three times, 5 min each time. (8) Prepare a goat anti-rabbit IgG solution (secondary antibody) in the corresponding proportion and incubate at 37 °C for 1 h. (9) Discard the secondary antibody, wash with 1×PBS three times, 5 min each time. Dilute the horseradish peroxidase (HRP) solution (tertiary antibody) in proportion and incubate at 37 °C for 40 min. (10) Discard the tertiary antibody, wash with 1×PBS three times, 5 min each time. Add the chromogenic solution, develop color in real time under the microscope, record the color development time, and stop color development by putting it into deionized water. (11) Stain with hematoxylin diluent for about 1 min, rinse with deionized water, put into ammonia water for blueing for 2 min, differentiate with hydrochloric acid for 2 s, rinse with deionized water, and then put into ammonia water for blueing for 4 min. Place the sections in deionized water for 5 min. (12) Dehydrate with alcohol gradients of 50%, 70%, 80%, 90%, 100%, 100% for 2 min each, and soak in xylene I and xylene II for 3 min each. (13) Drop an appropriate amount of neutral resin, cover with a clean coverslip, observe and photograph under the microscope after sealing.

[0104] IV. Western Blot

[0105] 1.1. Solution Preparation

[0106] RIPA Protein Lysate: 1 mL of RIPA and 10 μL of protease inhibitor; 1× SDS-PAGE Protein Loading Buffer: 1 mL of 5× SDS-PAGE Protein Loading Buffer and 4 mL of RIPA Protein Lysate; 1× Electrophoresis Buffer: 100 mL of SDS-PAGE Electrophoresis Solution (10×), made up to 1 L with distilled water; 1× Transfer Buffer: 100 mL of Western Blot Transfer Solution (10×), 200 mL of methanol, made up to 1 L with distilled water; 10% Upper Gel: 0.75 mL of upper gel solution, 0.75 mL of upper gel buffer, 15 μL of modified coagulant; 10% Lower Gel: 2.7 mL of lower gel solution, 2.7 mL of lower gel buffer, 60 μL of modified coagulant; 1× TBST Buffer: 100 mL of TBST Membrane Washing Solution (10×), made up to 1 L with distilled water; 5% Skim Milk Blocking Solution: 5 g of skim milk and 100 mL of 1× TBST Buffer.

[0107] 1.2 Preparation of Mouse Uterine Protein Samples

[0108] (1) The target mice were sacrificed by cervical dislocation, the uterus was dissected out, the mesentery, fallopian tubes and ovaries were removed, and the excised uterus was cut into several segments. (2) For every 20 mg of tissue sample, 100 - 250 μL of lysate containing protease inhibitor was added, placed into a grinding tube, with 2 - 3 grinding beads in each tube, marked and the tube caps were tightened, and the tissue homogenizer was used to homogenize thoroughly. (3) Centrifuge at 13,000 rpm for 15 min at 4°C, use a pipette to collect the supernatant, aliquot and label it, and store it at -40°C for subsequent experiments. (4) Use the BCA method to measure the protein sample concentration, according to the BCA Protein Concentration Assay Kit (Pierce TMInstructions of BCA Protein Assay Kit: Dilute the BCA standard product (2 mg / mL) in the kit to standard products with concentrations of 0, 250, 500, 1000, and 2000 ng / μL. Vigorously shake the prepared standard products, centrifuge them, and store them at 4°C. (5) Mix solution A and solution B in the kit according to a volume ratio of 50:1, prepare an appropriate amount of the mixed solution according to a volume of 100 μL per sample, vortex and mix well, and centrifuge briefly for standby. (6) Prepare 200 μL PCR empty tubes for the standard products and the samples to be tested. Add 100 μL of freshly prepared BCA working solution to each tube. Sequentially add 5 μL of each gradient standard product and the protein sample to be tested. Replace the 4000 ng / μL standard product with 10 μL of the 2000 ng / μL standard product. Vortex and mix well, centrifuge briefly, and incubate in an oven at 37°C for 1 h. (7) Take 80 μL of the BCA reaction solution into a 96-well plate, check and puncture the bubbles, place it in an enzyme-linked immunosorbent assay (ELISA) reader, set the absorbance value at a wavelength of 560 nm, plot a binomial standard curve for the standard product concentrations from 0 to 4000 ng / μL and the corresponding absorbance values, and calculate the protein concentration of the sample to be tested according to the formula. (8) Dilute the concentration of each sample uniformly with RIPA protein lysate to the same concentration. Add 5×SDS-PAGE protein loading buffer (loading buffer) according to one-fourth of the sample volume, vortex and mix well, centrifuge, and boil for 5 - 10 min, and store at -20°C for standby.

[0109] 1.3. Preparation of SDS-PAGE Gel

[0110] (1) Prepare the tools for gel preparation. Select a 1-mm-thick long glass plate and a short glass plate, clean them with clean pure water until there is no residue. Align the two ends of the long and short plates and clip them into the gel preparation bracket. Inject pure water into the glass plates to check for leakage. If leakage is found in a short time, reassemble them. If there is no leakage, dry them for standby. (2) Use the Yamei PAGE Gel Rapid Preparation Kit (10%) to prepare a 1-mm gel according to the instructions. Take 2.7 mL of the lower-layer gel solution and 2.7 mL of the lower-layer gel buffer, and mix them well. (3) Add 60 μL of the modified coagulant accelerator to the lower-layer gel mixture. After mixing well, use a 1-mL pipette to suck the solution and slowly inject it along the edge of the short plate into the glass plate until the liquid level is about 0.5 cm away from the upper edge of the short glass plate. Then add it to the upper edge of the short glass plate to make the lower-layer gel solidify flat. (4) Wait for the lower-layer gel to solidify, pour off the isopropanol, gently rinse the excess liquid with pure water, invert it for several minutes to filter out the water, and carefully suck the excess liquid with absorbent paper. Take 0.75 mL of the upper-layer gel solution and 0.75 mL of the upper-layer gel buffer, mix them well, add 15 μL of the modified coagulant accelerator, gently mix them, fill the glass tank, insert a pre-prepared clean 1-mm comb, and wait for the upper-layer gel to solidify.

[0111] 1.4. SDS Polyacrylamide Gel Electrophoresis

[0112] (1) Install the solidified gel plate into the electrophoresis tank, pour in the freshly prepared electrophoresis buffer, carefully remove the comb, observe the integrity of the teeth holes, suck the electrophoresis solution with a syringe and gently rinse the sample loading wells to balance the liquid in the sample loading wells with the electrophoresis solution, so as to avoid affecting the migration of the loaded proteins. (2) According to the requirements of the experimental sequence, add 10 μL of protein samples in sequence (the sample loading volume is considered according to the gel thickness and the comb), add protein Marker on one side, and add the same volume of 1× SDS-PAGE protein sample loading buffer to the blank wells. (3) Install the electrophoresis equipment, set a constant voltage electrophoresis at 100 V, after the bromophenol blue band runs out of the stacking gel, adjust it to a constant voltage of 120 V for electrophoresis until the protein Marker is completely separated, and stop electrophoresis when the bromophenol blue band reaches the lower part of the gel.

[0113] 1.5. Immunoblotting

[0114] (1) After the separation of proteins by gel electrophoresis, take out the gel plate, separate the short glass plate, use a gel knife to cut off the stacking gel and the gel below the bromophenol blue, and carefully place it in the pre-cooled transfer buffer for wetting and equilibration. (2) Take out the pre-cut PVDF membrane with a pore size of 0.22 to 0.45 microns, place it in methanol for activation for 3 minutes, then transfer it to the pre-cooled transfer buffer for equilibration and standby. At the same time, put the filter paper and the sponge pad for transfer into the pre-cooled transfer buffer for wetting and standby. (3) Place the clamping plate with the blackboard facing down, stack them in the order of sponge, filter paper, SDS-PAGE gel, PVDF membrane, filter paper, and sponge from bottom to top. Note that this is carried out in the pre-cooled transfer buffer, keeping the SDS-PAGE gel and the PVDF membrane free of impurity contamination and damage, fully infiltrating and avoiding the generation of bubbles during stacking, which may affect the protein transfer effect, and clamp the clamping plate tightly. (4) Place the transfer clamp in the transfer tank corresponding to the positive and negative poles, put in an ice box and fill it with transfer buffer, place the transfer electrophoresis box in ice water, cover the lid according to the corresponding positive and negative poles, and set a constant current of 150 mA for 90 minutes of transfer. (5) After the transfer is completed, remove the PVDF membrane, with the side in contact with the SDS-PAGE gel facing up, immerse it in Ponceau S staining solution for 1 minute, and then wash off the staining solution with methanol to observe the protein lane. (6) According to the molecular weight of the target protein and the protein Marker band, cut out the corresponding lane position, put the cut PVDF membrane into the labeled incubation box, and wash the membrane three times with 1×TBST, 5 minutes each time. (7) Block with freshly prepared 5% skim milk powder on a shaker at room temperature for 1 hour, and wash the membrane three times with 1×TBST, 5 minutes each time. (8) Dilute the antibody according to the instructions of the Western Blot primary antibody dilution solution of Guangzhou Shuiyuntian Company. The primary antibodies used include: Anti-GAPDH Rabbit mAb (1:1000, CST), Anti-YTHDC2 Rabbit mAb (1:1000, Abcam), Anti-SaCAS9 Mouse mAb (1:1000, Genscript). Add the corresponding primary antibody to the PVDF membrane and immerse it evenly, and incubate overnight on a shaker at 4°C. Recover the primary antibody, and wash the PVDF membrane three times with 1×TBST, 5 minutes each time. (9) Select the secondary antibody according to the source of the primary antibody and dilute it with 5% skim milk powder at 1:20000; add the secondary antibody to the PVDF membrane and incubate on a shaker at room temperature for 1 hour, discard the secondary antibody, and wash the membrane three times with 1×TBST, 5 minutes each time. (10) According to the instructions of the Shuiyuntian ECL chemiluminescence kit, mix solution A and solution B in a 1:1 ratio, evenly drip it onto the membrane, detect it on a chemiluminescence instrument, take a picture and save it, and make a graph for analysis.

[0115] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention rather than to limit the protection scope of the present invention. Although the present invention has been described in detail with reference to the preferred embodiments, those of ordinary skill in the art should understand that the technical solutions of the present invention can be modified or equivalently replaced without departing from the essence and scope of the technical solutions of the present invention.

Claims

1. A sgRNA for targeted knockout of uterine-specific conditional Ythdc2, characterized in that: The sequences of the sgRNA are shown in SEQ ID NO: 1 and SEQ ID NO:

2.

2. Use of the sgRNA according to claim 1 in a method for constructing a uterus-specific conditional Ythdc2 knockout mouse.

3. A gene expression cassette, characterized in that The gene expression frame is CAG-LSL-SaCas9-WPRE-polyA.

4. Use of the gene expression cassette described in claim 3 in constructing tissue-specific conditional gene-edited mice based on the CRISPR-SaCas9 system.

5. The use according to claim 4, characterized in that: By homologous recombination, the expression frame of claim 3 is inserted into the H11 gene locus to obtain a recombinant vector, and the recombinant vector, Cas9 mRNA, and gRNA are microinjected into fertilized eggs of mice to obtain F0 generation mice, and the F0 generation mice are backcrossed to obtain positive heterozygous mice.

6. A method for constructing a uterus-specific conditional Ythdc2 knockout mouse, characterized in that: The following steps are involved: S1. Constructing the H11 site-directed knock-in heterozygous mouse H11 that conditionally overexpresses the SaCas9 gene using the method described in claim 5 LSL-SaCas9 / + ; S2. Build U6 sgYthdc2 sgRNA mice: The homologous recombination vector containing U6-sgRNA and PiggyBAC mRNA were injected into the fertilized eggs of mice to obtain F0 generation mice. The F0 generation mice were backcrossed to obtain positive U6 sgYthdc2 sgRNA mouse; wherein the sequences of sgRNA are shown in SEQ ID NO: 1 and SEQ ID NO: 2; S3, H11 LSL-SaCas9 / + Heterozygous mice and Pgr Cre / + Mice were mated and bred to obtain digenic heterozygous mice; S4. Pgr Cre / + ;H11 LSL-SaCas9 / + Double gene heterozygous mice and U6 sgYthdc2 sgRNA mice were mated and bred to obtain three-gene heterozygous mice, which were uterus-specific conditional Ythdc2 knockout mice.

7. Use of the method of claim 6 in developing uterine-targeted gene therapy for non-disease diagnosis and treatment purposes.

Images