Method for obtaining zanthoxylum armatum transgenic seedlings

By using RUBY red reporter gene and DsRed2 red fluorescent protein as screening markers in bamboo leaf pepper and using P2A self-slicing body to construct the sequence structure of the target gene-P2A-fluorescent protein, the problems of low genetic transformation efficiency and antibiotic marking in transgenic breeding of bamboo leaf pepper were solved, efficient transgene screening and expression were achieved, and breeding efficiency and the creation of germplasm resources were improved.

CN120210283APending Publication Date: 2025-06-27SICHUAN AGRI UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202510440916.7
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-04-09
Publication Date
2025-06-27

AI Technical Summary

Technical Problem

Transgenic breeding of bamboo leaf peppercorns has problems with low genetic transformation efficiency and the use of antibiotics as screening marks to affect plant growth.

Method used

The bamboo leaf peppercorns that were sown and bred as materials, and the RUBY red reporter gene and DsRed2 red fluorescent protein were used as screening markers to establish the genetic transformation system of bamboo leaf peppercorns, and the target gene-P2A-fluorescent protein sequence structure was constructed through P2A self-shearing body to achieve efficient transgene screening and expression.

Benefits of technology

The genetic transformation efficiency of bamboo leaf peppercorns has been improved, reaching more than 80%, significantly improving the growth status of genetically modified seedlings, improving the visual screening efficiency of genetically modified materials, and providing technical support for the research on the gene function of bamboo leaf peppercorns and the creation of excellent germplasm resources.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120210283A_ABST
    Figure CN120210283A_ABST
Patent Text Reader

Abstract

The invention discloses a zanthoxylum armatum transgenic seedling acquisition method, which comprises: 1, selecting an overexpression vector containing a red protein gene, and fusing a target regulation gene into the overexpression vector; 2, transferring the overexpression vector into agrobacterium; 3, propagating agrobacterium tumefaciens, and preparing a treatment bacteria solution; 4, soaking Zanthoxylum armatum seedling culture tissues into the treatment bacteria solution, and carrying out dip dyeing and dark co-culture; 5, after dark co-culture, transferring zanthoxylum armatum seedling culture tissues into a screening rooting culture medium added with cephalosporin; and 6, observing the growth condition of the resistant bud, and determining the expression transfection expression condition of the target regulatory gene according to the expression condition of the red protein. The RUBY red reporter gene and the DsRed2 red fluorescent protein are used as selection markers, a genetic transformation system of zanthoxylum armatum is established, and the transformation efficiency reaches 80% or above.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention belongs to the technical field of plant genetic transformation, and particularly relates to a method for obtaining transgenic seedlings of Zanthoxylum armatum DC. Background Art

[0002] In recent years, with the development of modern biotechnology and the continuous in-depth research on transgenic breeding, establishing a plant genetic transformation system has become an important tool to promote the development of forest tree genetic engineering. The obtaining of transgenic plants plays a very important role in promoting the research of plant functional genes. At present, the most widely used and deeply studied method in the genetic transformation of woody plants is the Agrobacterium-mediated method, which has been successfully applied in many plants such as poplar, willow, and Chinese cabbage. Although the transformation process of the Agrobacterium-mediated method is generally similar, due to the completely different genetic backgrounds of different species and the differences in the developmental characteristics of different organs, there are extremely significant differences in transgenic conditions such as the types and concentrations of genetic transformation agents and the genetic transformation efficiency, making it difficult to directly utilize each other. Therefore, for different species and different tissues and organs of the same species, it is often necessary to develop corresponding genetic transformation systems to efficiently carry out genetic breeding research work.

[0003] Zanthoxylum armatum DC. is a perennial deciduous small tree of the genus Zanthoxylum in the family Rutaceae, with medicinal, edible, and ecological values and strong drought tolerance. The existing Zanthoxylum armatum DC. mainly relies on grafting, introduction and cultivation, and field selection and breeding, which have problems such as a long genetic improvement cycle, poor controllability of improved traits, and high difficulty in selecting excellent materials. Moreover, the preservation and cultivation cycle of new varieties is relatively long, making it difficult to meet the rapidly developing market demand. Through genetic engineering breeding, the breeding period can be greatly shortened, and new germplasms can be created efficiently and quickly. At the same time, developing a genetic transformation system for Zanthoxylum armatum DC. can provide important technical support for exploring the regulatory mechanisms of important economic traits such as the numb taste substances, plant stress resistance, fruit yield, and thorn differentiation and development of Zanthoxylum armatum DC., and has broad development and application prospects.

[0004] Up to now, the tissue culture and propagation systems of different Zanthoxylum plants have been reported many times, and new progress has been made in the tissue culture system of Zanthoxylum armatum DC. However, relevant research on the genetic transformation system of Zanthoxylum armatum DC. has not been reported so far, which severely restricts the pace of cultivating high-quality and high-yield varieties of Zanthoxylum armatum DC. and analyzing its genetic regulation mechanism in China. Although existing research reports the genetic transformation system of Zanthoxylum piperitum, the materials used are aseptic tissue culture seedlings, and the genetic transformation efficiency is only about 25%. Moreover, antibiotics are used as positive transformation screening markers in the transgenic process, which significantly restricts the growth and development of transgenic materials. Summary of the Invention

[0005] In view of the problems of low genetic transformation efficiency in transgenic breeding of Zanthoxylum armatum and the influence of using antibiotics as screening markers on plant growth, the present invention discloses a method for obtaining transgenic seedlings of Zanthoxylum armatum. The present invention uses sown and seedlings of Zanthoxylum armatum as materials, and uses the RUBY red reporter gene and DsRed2 red fluorescent protein as screening markers to establish a genetic transformation system for Zanthoxylum armatum. The transformation efficiency reaches more than 80%. Three transgenic tissue culture seedlings of Zanthoxylum armatum have been successfully constructed, showing good application effects, which can provide rich technical support for gene function research and excellent germplasm resource creation of Zanthoxylum armatum, and has significant innovation and practical significance in production.

[0006] The present invention discloses a method for obtaining transgenic seedlings of Zanthoxylum armatum, comprising the following steps: Step 1: Select an overexpression vector containing a red protein gene, and fuse the target regulatory gene into the overexpression vector; Step 2: Transfer the overexpression vector into Agrobacterium; Step 3: Propagate Agrobacterium and prepare a treated bacterial solution; Step 4: Immerse the seedling tissue of Zanthoxylum armatum in the treated bacterial solution, infect, and co-culture in the dark; Step 5: After co-culturing in the dark, transfer the seedling tissue of Zanthoxylum armatum to a screening rooting medium supplemented with cephalosporin; Step 6: Observe the growth of resistant buds, and determine the transfection and expression of the target regulatory gene through the expression of the red protein.

[0007] Further, the red protein gene is the RUBY red reporter gene and / or the P2A self-cleaving peptide fused with the DsRed2 red fluorescent protein gene. Among them, the function of the P2A self-cleaving peptide in the overexpression vector is to form a structure of gene-P2A-DsRed2, where gene refers to the target regulatory gene. When translating the protein finally, the P2A self-cleaving peptide undergoes self-cleavage to achieve the separation of the gene translation protein and DsRed2, without affecting the subsequent function of the gene translation protein.

[0008] The present invention innovatively introduces the P2A self-cleaving polypeptide sequence to construct a "target gene-P2A-fluorescent protein" molecular module, breaking through the technical bottleneck that it is difficult to balance the influence of fluorescent protein on the functional characteristics of the target gene and the improvement of screening efficiency in the traditional transgenic system where the "target gene-fluorescent protein" is directly fused.

[0009] In the existing transgenic system, in order to achieve rapid detection of transformed strains, the target gene is often directly linked to a fluorescent protein to construct a "target gene-fluorescent protein" sequence structure. The obtained translated protein is a fusion structure of physical connection between the target gene and the fluorescent protein, which has a certain restrictive effect on the normal exertion of the subsequent regulatory function of the target gene.

[0010] The present invention innovatively introduces the P2A self-cleaving sequence to construct the "target gene - P2A - fluorescent protein" sequence structure. During the protein translation and processing stage, P2A exerts its self-cleaving function to form three independent functional units: the target gene, the P2A polypeptide, and the fluorescent protein, realizing the precise separation of the target protein and the fluorescent protein. It not only retains the rapid screening advantage of fluorescent labeling but also ensures the integrity of the native conformation and regulatory function of the target protein, completely solving the potential interference problem of the fluorescent protein on the function of the target gene. This design synchronously realizes the visual and efficient screening of transgenic materials and the non-destructive expression of the target gene in a single transformation operation, significantly improving the screening efficiency and providing an efficient and reliable solution for transgenic research and molecular breeding that require precise regulation.

[0011] Among them, the P2A sequence is: gatccggagcaaccaactttagcctgctcaagcaagcaggagatgttgaggaaaatcctggccccatggcctcctccga The DsRed2 sequence is: ATGGCCTCCTCCGAGAACGTCATCACCGAGTTCATGCGCTTCAAGGTGCGCATGGAGGGCACCGTGAACGGCCACGAGTTCGAGATCGAGGGCGAGGGCGAGGGCCGCCCCTACGAGGGCCACAACACCGTGAAGCTGAAGGTGACCAAGGGCGGCCCCCTGCCCTTCGCCTGGGACATCCTGTCCCCCCAGTTCCAGTACGGCTCCAAGGTGTACGTGAAGCACCCCGCCGACATCCCCGACTACAAGAAGCTGTCCTTCCCCGAGGGCTTCAAGTGGGAGCGCGTGATGAACTTCGAGGACGGCGGCGTGGCGACCGTGACCCAGGACTCCTCCCTGCAGGACGGCTGCTTCATCTACAAGGTGAAGTTCATCGGCGTGAACTTCCCCTCCGACGGCCCCGTGATGCAGAAGAAAACCATGGGCTGGGAGGCCTCCACCGAGCGCCTGTACCCCCGCGACGGCGTGCTGAAGGGCGAGACCCACAAGGCCCTGAAGCTGAAGGACGGCGGCCACTACCTGGTGGAGTTCAAGTCCATCTACATGGCCAAGAAGCCCGTGCAGCTGCCCGGCTACTACTACGTGGACGCCAAGCTGGACATCACCTCCCACAACGAGGACTACACCATCGTGGAGCAGTACGAGCGCACCGAGGGCCGCCACCACCTGTTCCTGTAG。

[0012] The vector construction process is as follows: Take the full-length coding sequence of the target gene and remove the stop codons (TAG, TAA or TGA). Subsequently, the P2A and DsRed2 sequences are ligated in sequence to form a "target gene - P2A - DsRed2" long sequence structure. In the present invention, the "target gene - P2A - DsRed2" long sequence structure is entrusted to Sangon Biotech (Shanghai) Co., Ltd. for construction. This sequence is directly constructed into the pBI121 plant overexpression vector by the existing artificial synthesis method for subsequent research.

[0013] Furthermore, the target regulatory gene is selected from one or more of ZaMBF1c, ZaAGL19 and ZaARR24.

[0014] Furthermore, the Agrobacterium is selected from the strain GV3101.

[0015] Furthermore, the Zanthoxylum bungeanum seedling tissue is Zanthoxylum bungeanum stem segment tissue.

[0016] Furthermore, in step 4, the OD value of the bacterial solution concentration of the treated bacterial solution is 0.6.

[0017] Furthermore, in the step 4, the dyeing time is 30 minutes.

[0018] Furthermore, in step 4, the dark co-cultivation time is 24 hours.

[0019] Furthermore, in step 5, the concentration of cephalosporin in the rooting medium is screened to be 300 mg / L.

[0020] Compared with the prior art, the present invention has the following beneficial effects: 1) The present invention utilizes the stem segments of Zanthoxylum bungeanum seeding and seedling raising as explants, breaking through the technical limitations of obtaining aseptic seedlings of Zanthoxylum bungeanum in existing reports, and has the advantages of convenient material collection, simple operation, and low cost, greatly reducing the material source requirements for transgenic seedlings, and laying a new technical foundation for the supply of large quantities of seedlings when transgenic technology of Zanthoxylum bungeanum is applied in the future.

[0021] 2) This invention is the first to apply the red protein marker to the genetic transformation technology of Zanthoxylum plants. Compared with the currently reported positive screening markers of antibiotics such as kanamycin (Kan), it reduces the inhibitory effect of antibiotics on the growth and development of transgenic seedlings and significantly improves the growth status of seedlings. At the same time, the red protein marker system has the characteristics of intuitive visualization and high selection efficiency, which significantly improves the accuracy of positive seedling screening of Zanthoxylum bungeanum, and provides a new technical means for the rapid identification of transgenic plants of Zanthoxylum bungeanum.

[0022] 3) The present invention has made a major breakthrough in the transformation efficiency of Zanthoxylum plants. Compared with the average transformation rate of 24.6% of Zanthoxylum asakura reported in existing literature, this method increases the average transformation rate of Zanthoxylum truncatum to 56.37%, an increase of 2.29 times. At the same time, when the three genes are transformed separately for practical application, the transformation efficiency is as high as 80%. This breakthrough provides reliable technical support for the factory-based seedling production of Zanthoxylum plants.

[0023] 4) The present invention closely combines the needs of industrial practice, systematically optimizes the genetic transformation conditions of Zanthoxylum armatum, and constructs a complete and universal genetic transformation technology system for Zanthoxylum armatum. The present invention fully combines the actual scenarios of industrial practice, uses sowing and seedling raising as explants, constructs an efficient genetic transformation system for Zanthoxylum armatum, and successfully applies it to the transformation verification of 3 different genes, successfully creating transgenic seedlings with a 3- to 6-fold increase in the expression level of the target gene, laying a new technical path for the gene function research and molecular directed breeding of Zanthoxylum armatum. BRIEF DESCRIPTION OF THE DRAWINGS

[0024] In order to more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the following will briefly introduce the drawings required for the description of the embodiments or the prior art. Obviously, the following drawings are only some embodiments of the present invention. For those of ordinary skill in the art, without creative efforts, other drawings can also be obtained based on these drawings.

[0025] Figure 1 Results of the effects of different bacterial liquid concentrations on the regeneration of resistant buds.

[0026] Figure 2 Results of the effects of different infection times on the regeneration efficiency of resistant buds.

[0027] Figure 3 Results of the effects of different co-culture times on the regeneration effect of resistant buds.

[0028] Figure 4 Results of the effects of different cefotaxime concentrations on the regeneration of resistant buds.

[0029] Figure 5 Results of the RUBY gene detection of transgenic resistant lines of Zanthoxylum armatum. Among them, M is a 2000 bp DNA Marker; CK is a negative control; WT is an untransformed Zanthoxylum armatum (wild type) control, and 1-5 are randomly selected transgenic materials.

[0030] Figure 6 Results of the PCR amplification detection and analysis of positive seedlings of Zanthoxylum armatum with 3 different genes. a-c Results of the agarose gel electrophoresis detection, protein sequence alignment, and nucleic acid sequence alignment analysis of ZaMBF1c of Zanthoxylum armatum; d-f Results of the sequence amplification detection and alignment analysis of ZaAGL19 of Zanthoxylum armatum; g-h Results of the sequence amplification detection and alignment analysis of ZaARR24 of Zanthoxylum armatum. M is a 5000 bp DNA Marker, CK is a negative control, WT is an untransgenic Zanthoxylum armatum (wild type) sample, 1-3 are 3 transgenic lines of each gene respectively, seq is the template sequence, and PCR is the sequence amplified by the present invention.

[0031] Figure 7 Fluorescence detection results after transformation of 3 genes. WT: Un-transgenic Zanthoxylum armatum (wild type); OE: Transgenic resistant Zanthoxylum armatum lines.

[0032] Figure 8 Rooting culture results of tissue culture seedlings with genetic transformation of 3 different genes.

[0033] Figure 9 Expression level charts of the target gene in transgenic positive plants and wild type. WT is the sample of un-transgenic Zanthoxylum armatum (wild type), and OE is the transgenic positive seedling; the vertical axis is the expression level of each gene relative to WT, and different lowercase letters indicate significant differences. Specific implementation manners

[0034] The present invention discloses a method for obtaining transgenic seedlings of Zanthoxylum armatum. The present invention uses the stem segments of Zanthoxylum armatum seedlings for sowing as transformation receptors to conduct Agrobacterium-mediated genetic transformation, studies suitable transformation conditions, establishes a genetic transformation system for Zanthoxylum armatum, and creates overexpression transformation lines of 3 different genes, laying a solid technical support for the analysis of the genetic regulation mechanism of Zanthoxylum armatum and the cultivation of high-quality and high-yield Zanthoxylum armatum germplasm resources.

[0035] The technical solutions in the present invention will be clearly and completely described below. Obviously, the described ones are only part of the embodiments of the present invention, rather than all embodiments. All other embodiments obtained by those of ordinary skill in the art based on the embodiments in the present invention without making creative efforts belong to the scope protected by the present invention.

[0036] (1) Influence of different bacterial liquid concentrations on the genetic transformation efficiency of resistant buds Expand the GV3101 strain containing the RUBY red protein marker, immerse the pre-sterilized stem segments of Zanthoxylum armatum seedlings in the RUBY bacterial liquid with OD values of 0.4, 0.6, 0.8, and 1.0 respectively, take them out after oscillating and infecting at 200 rpm on a shaker at 28°C for 30 min, co-culture in the dark for 24 h, and then transfer them to a screening rooting medium (1 / 4MS + 0.5 mg / L IBA) supplemented with cephalosporin. After 40 d of inoculation of the explants, take pictures and count the number and growth of resistant buds. The results show that ( Figure 1 , Table 1), too low a bacterial liquid concentration has a poor transformation effect, while too high a bacterial liquid concentration seriously affects the regeneration of adventitious buds. When the bacterial liquid concentration is OD = 0.6, the average regeneration rate of resistant buds reaches 36.01%, and the expression of the RUBY red reporter gene can be observed.

[0037]

[0038] (2) Influence of different infection times on the genetic transformation efficiency of resistant buds According to the results of the foregoing steps, after disinfecting the stem segments for Zanthoxylum armatum DC. seedlings, they were respectively infected in the bacterial solution with an OD value of 0.6 for 20 min, 30 min, and 40 min. After co-culturing in the dark for 24 h, the explants were washed with sterile water and inoculated onto the screening rooting medium for observation and statistics. The results showed ( Figure 2 , Table 2) that 30 min of Agrobacterium infection was the appropriate infection time for the stem segments of Zanthoxylum armatum DC. seedlings, and the average regeneration rate of the explants was 38.47%.

[0039]

[0040] (3) Effect of different co-cultivation times on the genetic transformation efficiency of resistant buds According to the results of the foregoing steps, after disinfecting the stem segments for Zanthoxylum armatum DC. seedlings, they were infected in the bacterial solution with an OD value of 0.6 for 30 min. After co-culturing in the dark for 12 h, 24 h, 36 h, and 48 h, the explants were washed with sterile water and inoculated onto the screening medium for screening culture. The results showed ( Figure 3 , Table 3) that when co-cultured in the dark for 24 h, the regeneration rate of resistant buds reached 32.60%, which was significantly higher than that of co-cultivation at other dark times, and significant expression of the RUBY reporter gene in the whole stem segment and regenerated tissue organs could be observed.

[0041]

[0042] (4) Effect of different cefotaxime concentrations on the genetic transformation efficiency of resistant buds Cefotaxime is an effective agent for inhibiting the growth of Agrobacterium. To further improve the genetic transformation effect, the present invention continued to screen the appropriate concentration of cefotaxime. According to the results of the foregoing steps, after disinfecting the stem segments for Zanthoxylum armatum DC. seedlings, they were infected in the bacterial solution with an OD600 of 0.6 for 30 min. After co-culturing in the dark for 24 h, the explants were washed with sterile water and respectively inoculated in the cefotaxime-resistant media supplemented with 0, 200, 300, and 400 mg / L for screening culture. The results showed ( Figure 4 , Table 4) that 300 mg / L of cefotaxime could effectively inhibit the growth of Agrobacterium and significantly increase the regeneration rate to 56.37%.

[0043]

[0044] (5) Detection of the RUBY gene in transgenic positive lines Randomly select 5 of the above RUBY transgenic resistant lines, extract the genomic DNA of different lines respectively, and perform amplification and agarose gel electrophoresis detection of the RUBY gene. The results showed ( Figure 5), among the 5 resistant lines, 4 lines amplified the RUBY target band, proving that the RUBY gene was successfully introduced into the genome of Zanthoxylum armatum, with a transformation rate of 80%, which can be used for future genetic transformation research of Zanthoxylum armatum.

[0045] (6)Application of the genetic transformation system of Zanthoxylum armatum Clone 3 different regulatory genes, ZaMBF1c (stress resistance), ZaAGL19 (early flowering), and ZaARR24 (stamen fertility), respectively, construct an overexpression vector fused with the self-cleaving peptide P2A and the red fluorescent protein DsRed2, and transfer it into the Agrobacterium tumefaciens strain GV3101. Use the suitable conditions established in the present invention for the genetic transformation of Zanthoxylum armatum, detect the transgenic application effect of the present invention under the condition of replacing the genetic marker, and obtain the transformed lines of each gene. The results show that ( Figure 6 ), the target gene bands were successfully obtained in each line, and the nucleic acid sequence and protein sequence amplified from the transgenic materials were completely identical to the template sequence. In addition, randomly select the transgenic resistant plants obtained in the present invention for DsRed2 fluorescence detection ( Figures 7 - 8 ). Under natural white light conditions, the plants showed normal green color and their growth and development were not affected. However, when irradiated with a green excitation light source of 530 - 550 nm, bright red fluorescence expression could be clearly observed in the transgenic lines, while no red fluorescence could be observed in non-transgenic Zanthoxylum armatum under the same conditions ( Figure 7 ). At the same time, the expression levels of the 3 genes were all significantly higher than those of non-transgenic Zanthoxylum armatum ( Figure 9 ), indicating that the target genes were successfully transcribed and expressed in Zanthoxylum armatum. These results comprehensively show that the present invention has successfully established a genetic transformation system for Zanthoxylum armatum, which can be used to create new materials with excellent traits of Zanthoxylum armatum.

[0046]

[0047] The above content is a further detailed description of the present invention in combination with specific preferred embodiments, and it cannot be determined that the specific implementation of the present invention is only limited to these descriptions. For those of ordinary skill in the technical field to which the present invention belongs, without departing from the concept of the present invention, several simple deductions or substitutions can still be made, which should all be regarded as belonging to the protection scope of the present invention.

Claims

1. A method for obtaining transgenic seedlings of Zanthoxylum bungeanum, characterized in that: The following steps are involved: Step 1: Select an overexpression vector containing the red protein gene and fuse the target regulatory gene into the overexpression vector; Step 2: Transform the overexpression vector into Agrobacterium; Step 3: Propagate Agrobacterium and prepare treated bacterial solution; Step 4: immerse the Zanthoxylum bungeanum seedling tissue into the treated bacterial solution, immerse and incubate in the dark; Step 5: After dark co-cultivation, the Zanthoxylum bungeanum seedling tissue is transferred to a screening rooting medium supplemented with cephalosporin; Step 6: Observe the growth of resistant buds and determine the transfection expression of the target regulatory gene through the expression of red protein.

2. The method for obtaining a transgenic Zanthoxylum bungeanum seedling according to claim 1, characterized in that: The red protein gene is the RUBY red reporter gene and / or the P2A self-splicing body fused DsRed2 red fluorescent protein gene.

3. The method for obtaining a transgenic Zanthoxylum bungeanum seedling according to claim 1, characterized in that: The target regulatory gene is selected from one or more of ZaMBF1c, ZaAGL19 and ZaARR24.

4. The method for obtaining a transgenic Zanthoxylum bungeanum seedling according to claim 1, characterized in that: The Agrobacterium is selected from the strain GV3101.

5. The method for obtaining a transgenic Zanthoxylum bungeanum seedling according to claim 1, characterized in that: The Zanthoxylum bungeanum seedling raising tissue is the Zanthoxylum bungeanum stem segment tissue.

6. The method for obtaining a transgenic Zanthoxylum bungeanum seedling according to claim 1, characterized in that: In the step 4, the OD value of the bacterial solution concentration of the treated bacterial solution is 0.

6.

7. The method for obtaining a transgenic Zanthoxylum bungeanum seedling according to claim 1, characterized in that: In the step 4, the soaking time is 30 minutes.

8. The method for obtaining a transgenic Zanthoxylum bungeanum seedling according to claim 1, characterized in that: In step 4, the dark co-cultivation time is 24 hours.

9. The method for obtaining a transgenic Zanthoxylum bungeanum seedling according to claim 1, characterized in that: In the step 5, the concentration of cephalosporin in the rooting medium is screened to be 300 mg / L.