Soybean internode spacing-related SNP (Single Nucleotide Polymorphism) and development and application of KASP primer thereof

Abstract

The invention relates to the technical field of agricultural biology, in particular to SNP related to soybean node spacing and development and application of a KASP primer of the SNP, S121140167 remarkably related to the soybean node spacing is located at the 12th chromosome 1140167 bp position of a soybean genome Wm82. A4. V1, the site polymorphism is C or T, and the TT genotype is used for providing technical support for molecular marker-assisted breeding of the soybean node spacing character. The invention further develops a KASP molecular marker which can directly perform specific distinguishing and detection on the C or T basic group of the SNP mutation site, and the marker can quickly and accurately identify the soybean internode spacing, reduce the influence of the environment on the identification of the soybean internode spacing character, shorten the breeding cycle and accelerate the selection and improvement of the soybean internode spacing character.

Description

Technical Field

[0001] The present invention belongs to the field of agricultural biotechnology, and particularly relates to SNPs related to soybean internode length, KASP primers thereof, and applications thereof. Background Art

[0002] Soybean is an important food and cash crop and has an important strategic position in the development of the national economy. Internode length is an important trait related to soybean yield. Under specific conditions, selecting an appropriate type of internode length can increase soybean yield.

[0003] Genome-wide association study (GWAS) is one of the main methods for detecting quantitative trait loci. GWAS can utilize the abundant mutations and recombinations existing in different materials to conduct control analysis or correlation analysis at the genome-wide level, and can identify genes or loci significantly related to target traits, and is widely used in genetic analysis of main traits of crops. KASP marker is a genotyping technology based on terminal fluorescence reading, which accurately genotypes bialleles by matching SNPs with specific sites carried at the primer terminals. Due to its advantages such as high throughput, low error rate, and low cost, KASP marker has become a popular technology for the new generation of SNP genotyping.

[0004] The soybean internode length trait is not only controlled by genotype, but is also easily affected by the environment, resulting in errors in internode length measurement and affecting the identification of internode length traits. Therefore, molecular marker-assisted selection can save breeding time, reduce the influence of the environment on the identification of internode length traits, and accelerate the selection and improvement of soybean internode length traits. Summary of the Invention

[0005] The purpose of the present invention is to identify or assist in identifying single nucleotide mutation sites (SNPs) significantly related to soybean internode length traits, and to develop KASP molecular markers and primer compositions thereof based on the SNP site information, so as to provide a molecular-assisted selection technical support for the early identification and screening of this trait. The technical problems to be solved are not limited to the described technical topics, and those skilled in the art can clearly understand other technical topics not mentioned herein through the following description.

[0006] To achieve the above purpose, the present invention provides an application of a substance for detecting SNP site polymorphism or genotype, wherein the SNP site corresponds to the 101st nucleotide of SEQ ID NO: 4, and the SNP site polymorphism is C or T; the application is any one of the following: A1) Application in identifying or assisting in identifying soybean internode length, A2) Application in preparing a product for identifying or assisting in identifying soybean internode length, A3) Application in molecular marker-assisted breeding or germplasm resource identification according to soybean internode length traits, A4) Use in the preparation of products for molecular marker-assisted breeding or germplasm resource identification based on soybean internode distance traits, A5) Use in soybean breeding or assisting soybean breeding, A6) Use in the preparation of products for soybean breeding or assisting soybean breeding.

[0007] In the above applications, the genomic position of the SNP locus is at 1,140,167 bp on chromosome 12 of soybean, and the version number of the soybean genomic sequence is Wm82.a4.v1.

[0008] In the above applications, the indicators of the soybean breeding include soybean internode distance. The purpose of the soybean breeding includes screening soybean germplasm resources according to the soybean internode distance.

[0009] In the above applications, the soybean can be the hybrid offspring of soybean A and soybean B. Both soybean A and soybean B can be soybean varieties carrying the SNP. Specifically, soybean A can be the soybean line Suinong 111, and soybean B can be the soybean variety Longken 317. The hybrid offspring can be the F1 generation, F2 generation or generations above, such as the F2 generation, BC1F2, etc.

[0010] The internode distance is obtained by the ratio of plant height at maturity to the number of nodes. The method for measuring plant height is the length from the cotyledon node to the apical growing point after the plant matures. The number of nodes is measured as follows: the section between the cotyledon and the true leaf is the 1st node, the section between the true leaf and the first trifoliate leaf is the 2nd node, and so on. The SNP locus is significantly associated with the soybean internode distance.

[0011] Further, the polymorphism of the SNP locus can be detected by direct sequencing, or primers for amplifying molecular markers containing the SNP locus can be designed, and the primers are used to amplify the genomic DNA of the soybean to be tested, and the amplified product is subjected to genotyping detection.

[0012] In the above applications, the substance can be any of the following B1), B2) or B3): B1) The substance is a primer composition for amplifying a soybean genomic DNA fragment including the SNP locus, B2) The substance is a PCR reagent containing the primer composition described in B1), B3) The substance is a kit containing the primer composition described in B1) or the PCR reagent described in B2).

[0013] In the above applications, the substance can also be a reagent, kit or instrument for detecting the SNP locus described herein by direct sequencing.

[0014] The present invention also provides a method for identifying or assisting in the identification of soybean internode length. The method includes detecting the genotype of SNP loci in the genome of the soybean to be tested, and identifying or assisting in the identification of the internode length of the soybean to be tested according to the genotype.

[0015] Further, the method includes the following steps: (1) Extract genomic DNA of the soybean to be tested; (2) Using the genomic DNA as a template, perform PCR amplification with any of the primer compositions herein, and collect fluorescence signals; (3) Determine the genotype of the soybean to be tested according to the fluorescence signal, and identify or assist in the identification of the internode length trait of the soybean according to the genotype.

[0016] Further, the PCR amplification in step B2) can be Kompetitive Allele Specific PCR (KASP).

[0017] Further, the PCR reaction system is: 2.6 μL of template DNA, 0.07 μL of KASP primer mixture (primer composition), and 2.53 μL of 2×KASP Master mix.

[0018] Further, the PCR reaction program is: pre-denaturation at 95°C for 10 min; denaturation at 95°C for 20 s, gradient PCR at 61°C - 55°C for 40 s, with a decrease of 0.6°C per cycle, for a total of 10 cycles; denaturation at 95°C for 20 s, annealing and amplification at 55°C for 40 s, for a total of 30 cycles.

[0019] Further, in the KASP primer mixture (primer composition), the molar ratio of forward primer F1 (SEQ ID NO: 1), forward primer F2 (SEQ ID NO: 2), and reverse primer R (SEQ ID NO: 3) can be: 2:2:5.

[0020] Further, the KASP primer mixture can be prepared by mixing forward primer F1 (SEQ ID NO: 1), forward primer F2 (SEQ ID NO: 2), reverse primer R (SEQ ID NO: 3) with a concentration of 100 μM each and pure water in a volume ratio of 6:6:15:23.

[0021] The present invention also provides the application of the above method in soybean breeding. The method includes that selecting the TT genotype can be used for the breeding of soybean internode length traits, and the TT genotype is the homozygous type in which the nucleotide type of the SNP locus in the soybean genome is T.

[0022] The present invention also provides a method for soybean breeding, the method comprising detecting the genotype of the SNP locus as described in claim 1 in the soybean genome, and selecting soybeans with the genotype of CC or TT at the SNP locus as parents for breeding, wherein CC is the homozygous type with the SNP locus being C, and TT is the homozygous type with the SNP locus being T.

[0023] The present invention also provides a product for detecting the polymorphism or genotype of the SNP locus in the soybean genome, the product containing the above substances, and the product being any one of the following: C1) A product for detecting or assisting in detecting the single nucleotide polymorphism or genotype of the soybean internode length. C2) A product for identifying or assisting in identifying the soybean internode length. C3) A product for soybean breeding. C4) A product for screening or breeding soybean individual plants or lines or strains or varieties according to the soybean internode length trait.

[0024] The above product may be any of the following D1), D2) or D3): D1) The product is a primer composition for amplifying a soybean genomic DNA fragment including the SNP locus. D2) The product is a PCR reagent containing the primer composition described in D1). D3) The product is a kit containing the primer composition described in D1) or the PCR reagent described in D2).

[0025] The product described herein may be a reagent, a kit, a chip or a test strip.

[0026] Further, the various reagent components of the kit may be present in separate containers, or may be pre-combined into a reagent mixture in whole or in part.

[0027] In the above application or product, the primer composition may include the following primers: E1) A forward primer F1 with a nucleotide sequence of SEQ ID NO: 1 or the 22nd - 45th positions of SEQ ID NO: 1. E2) A forward primer F2 with a nucleotide sequence of SEQ ID NO: 2 or the 22nd - 45th positions of SEQ ID NO: 2. E3) A reverse primer R3 with a nucleotide sequence of SEQ ID NO: 3.

[0028] In the above application, different fluorescent tag sequences are connected to the 5' ends of the forward primer F1 and the forward primer F2.

[0029] Further, the 5'-end of the forward primer F1 may be linked with a FAM fluorescent label sequence, and the 5'-end of the forward primer F2 may be linked with a VIC fluorescent label sequence.

[0030] Further, the FAM fluorescent label sequence may be the 1st to 21st positions of SEQ ID NO: 1.

[0031] Further, the VIC fluorescent label sequence may be the 1st to 21st positions of SEQ ID NO: 2.

[0032] Further, the primer composition may include the forward primer F1 with the nucleotide sequence of SEQ ID NO: 1, the forward primer F2 with the nucleotide sequence of SEQ ID NO: 2, and the reverse primer R with the nucleotide sequence of SEQ ID NO: 3.

[0033] The present invention also provides a DNA molecule, and the nucleotide sequence of the molecular marker is shown as SEQ ID NO: 4.

[0034] Further, the molecular marker may be a KASP molecular marker.

[0035] Further, in the sequence of the molecular marker (SEQ ID NO: 4), the nucleotide at the 101st position is C or T. The SEQ ID NO: 4 may specifically be: 5’-ATCAATGTTAGTACCAAATAGTACACCATGAATGAAGTTGCATCCTAATGGTTACTAACAACTGCTGGTTCATTTTCCATAACCCTCTCAGGTAATTTCCYTTTGCCACCTCTCTCACCCCTTCTATTTCACAGTTCACACATGTTTATTAGGTTTCCCTTTGTGTTTAAACTGTGATCCACAACCACAAATCTGCAATA-3’.

[0036] The present invention also provides the application of the above DNA molecule, and the application may be any one of the following: E1) Application in identifying or assisting in identifying the internode length of soybean; E2) Application in preparing a product for identifying or assisting in identifying the internode length of soybean; E3) Application in molecular marker-assisted breeding or germplasm resource identification according to the internode length trait of soybean; E4) Application in preparing a product for molecular marker-assisted breeding or germplasm resource identification according to the internode length trait of soybean; E5) Application in soybean breeding or assisting soybean breeding; Use in the preparation of products for soybean breeding or assisting soybean breeding E7) Use in the products for screening or breeding individual soybean plants or lines or strains or varieties according to the soybean internode spacing trait E8) Use in the products for assisting in screening or breeding individual soybean plants or lines or strains or varieties according to the soybean internode spacing trait

[0037] Compared with the existing technologies, the present invention has the following beneficial effects (1) The present invention provides an SNP significantly associated with the soybean internode spacing trait. Through 765 representative soybean germplasm resources in Northeast China, SoySNP180K BeadChips were used for genotyping, and after excluding and filtering, a high-density SNP molecular marker map covering the whole genome was obtained. Then, by investigating the phenotypic traits of soybean internode spacing with 3 replicates in Yanjia Gang Farm in 2023, the SNP locus S12_1140167 significantly associated with the soybean internode spacing trait was detected by using the MLM model. The phenotypic variation explanation rate reached 12.65%, located at the position of 1140167 bp on chromosome 12 of the soybean genome Wm82.a4.v1

[0038] (2) The present invention identified an SNP locus on chromosome 12 of soybean that controls the soybean internode spacing trait. The developed KASP molecular marker can directly distinguish and detect the specific C or T bases at the SNP mutation site. This KASP molecular marker has good application value, can save breeding time through marker-assisted selection, reduce the influence of the environment on the identification of internode spacing traits, and accelerate the selection and improvement of soybean internode spacing traits

[0039] (3) The F4 generation soybean materials obtained by crossing Suinong 111 and Longken 317 with 526 parents were amplified and genotyped with the KASP molecular marker primers on a real-time fluorescence quantitative PCR instrument. The results showed that: the two genotypes could be clearly separated by this molecular marker primer. Among them, the dots close to the Y-axis were those carrying the C allele variant site, with a genotype of CC, there were 264, among which there were 77 internode-long materials, accounting for 29.17%, and 187 internode-short materials, accounting for 70.83%; the dots close to the X-axis were those carrying the T allele variant site, with a genotype of TT, there were 262, among which there were 9 internode-long materials, accounting for 3.44%, and 253 internode-short materials, accounting for 96.56%; the dots close to the origin of the XY-axis were blank controls. The KASP marker of the present invention can be used for the breeding of soybean internode spacing germplasm, and using the KASP marker of the present invention for early breeding selection can reduce the workload of soybean breeding, which is of great significance for accelerating the soybean breeding process Description of the Drawings

[0040] Figure 1 Manhattan plot and QQ scatter plot of the genome-wide association analysis results of the internode distance trait for 765 soybean germplasm resources.

[0041] Figure 2 KASP markers were used for genotyping different soybean germplasm resources. Among them, the black dots close to the origin represent the blank controls without template DNA; the blue dots close to the Y-axis and the red dots close to the X-axis represent soybean varieties carrying the C allele variant site and soybean varieties carrying the T allele variant site, respectively.

[0042] Figure 3 Box plot of the difference in internode distance trait for 526 soybean progeny materials corresponding to the S12_1140167 molecular marker. Specific implementation mode

[0043] The present invention will be further described in detail below in conjunction with specific implementation modes. The provided examples are only for clarifying the present invention and not for limiting the scope of the present invention. The following examples can be used as a guide for those of ordinary skill in the art to make further improvements and do not constitute any limitation to the present invention in any way.

[0044] The experimental methods in the following examples are all conventional methods unless otherwise specified, and are carried out according to the techniques or conditions described in the literature in this field or according to the product instructions. The materials, reagents, etc. used in the following examples can be obtained from commercial channels unless otherwise specified.

[0045] The variety registration number of Suinong 111 is Hei Shen Dou 20220022. It was sexually hybridized with Suinong 22 as the female parent and Ha 09-033 as the male parent, and was selected by the pedigree method through sexual hybridization.

[0046] The variety registration number of Longken 317 is Hei Ken Shen Dou 2015004. It was sexually hybridized with Hefeng 55 as the female parent and Hefeng 51 as the male parent, and was selected by the pedigree method through sexual hybridization.

[0047] The above biological materials can be obtained from Beidahuang Kenfeng Seed Industry Co., Ltd. by the public. These biological materials are only used for repeating the relevant experiments of the present invention and cannot be used for other purposes.

[0048] In the following examples, SPSS 11.5 statistical software was used to process the data. The experimental results were expressed as mean ± standard deviation, and One-way ANOVA test was used. P < 0.05 (*) indicates significant difference, P < 0.01 (**) indicates extremely significant difference, and P < 0.001 (***) indicates extremely significant difference.

[0049] Example 1: Obtaining and marker selection of nucleotide mutation sites SNP significantly associated with soybean internode distance trait 1. Obtaining of Nucleotide Mutation Site SNP Significantly Associated with Soybean Node Spacing Trait 1.1 Association Population and Field Identification of Node Spacing Trait: 765 soybean germplasm resources were provided by Beidahuang Kenfeng Seed Industry Co., Ltd. and planted in Yanjia Gang Farm in May 2023 (temperature 15 - 18 °C, humidity 60 - 70%). A completely randomized block design was adopted with 3 replicates, a total of 6 rows, row length 1.5 m, row spacing 0.65 m, and 25 seeds per row. For each replicate, 3 plants were randomly selected to investigate the soybean node spacing trait and phenotypic data were obtained.

[0050] 1.2 Genome-Wide Association Analysis of Soybean Node Spacing: 765 soybean materials were genotyped using SoySNP180K BeadChips, which contains a total of 180,961 SNP markers. Using TASSEL 5.0 software, genotype data were quality controlled with the minimum allele variant frequency of SNP markers ≥ 0.01 and the missing data ratio < 0.05, and 40,577 high-quality SNPs were obtained. Combining the phenotypic information of node spacing, the mixed linear model (MLM) in TASSEL software was used for genome-wide association analysis. The results are as Figure 1 shown. A significantly associated SNP locus S12_1140167 was mapped on chromosome 12, with a physical position of 1,140,167, and the phenotypic variation explanation rate reached 12.65%.

[0051] The genomic position of the above SNP locus S12_1140167 is at the 1,140,167th bp on chromosome 12. The physical position of the SNP locus S12_1140167 is determined based on the whole genome sequence of soybean ( Glycine max ), and the version number of this soybean whole genome sequence is Wm82.a4.v1. The nucleotide polymorphism at the SNP locus S12_1140167 is C or T.

[0052] 2. Development of Specific Primers for KASP Molecular Markers Based on the SNP locus found in 1, the PrimerBLAST function of NCBI (https: / / www.ncbi.nlm.nih.gov / ) was used to design specific primers for KASP molecular markers. Among them, F1 and F2 respectively contain FAM and VIC fluorescence adapter sequences (underlined), and the sequences are as follows: The upstream primer F1 sequence of the KASP marker is SEQ ID NO: 1: 5’- GAAGGTGACCAAGTTCATGCT CATAACCCTCTCAGGTAATTTCCC-3’; The upstream primer F2 sequence of the KASP marker is SEQ ID NO: 2: 5'- GAAGGTCGGAGTCAACGGATT CATAACCCTCTCAGGTAATTTCCT-3'; The R sequence of the downstream primer of the KASP marker is SEQ ID NO: 3: 5'-GATTTGTGGTTGTGGATCACAGTT-3'; The nucleotide sequence of the KASP molecular marker containing the SNP site S12_1140167 developed by the present invention is shown in SEQ ID NO: 4 (200 bp). The 101st nucleotide of this sequence is C or T, represented by Y.

[0053] 5'-ATCAATGTTAGTACCAAATAGTACACCATGAATGAAGTTGCATCCTAATGGTTACTAACAACTGCTGGTTCATTTTCCATAACCCTCTCAGGTAATTTCCYTTTGCCACCTCTCTCACCCCTTCTATTTCACAGTTCACACATGTTTATTAGGTTTCCCTTTGTGTTTAAACTGTGATCCACAACCACAAATCTGCAATA-3'.

[0054] Example 2. Genotyping of SNP sites in different soybean varieties and its application To verify the reliability and accuracy of the KASP marker, 496 F4 generation materials with parents of Suinong 111 × Longken 317 were selected for verification (partial data is shown in Table 1). The steps are as follows: 1. Extract the genomic DNA of the soybean to be tested: The total DNA of the material to be tested was extracted by the SDS method. The specific method is as follows: Extract the DNA of soybean seeds and leaves by the SDS method. The specific steps are as follows: 1) Take out the verified sample plate from the -80°C refrigerator, then press the rubber cover with a presser, and then shake it at 1100 rpm for 90 s with a high-throughput tissue grinder; 2) Centrifuge at 4000 rpm at 4°C for about 3 min, add 300 μL of BGⅠ solution to each well with an automatic liquid dispensing system. Pay attention to avoid contamination between wells when opening the rubber cover. After covering the rubber cover, shake it at 1100 rpm for 40 s; 3) Centrifuge at 4000 rpm at 4°C for about 2 min, add 150 μL of BGⅡ solution to each well. After covering the rubber cover, shake it at 1100 rpm for 20 s. (Shake it on a 37°C constant temperature shaker for 15 min); 4) Centrifuge at 4000 rpm at 4 °C for 15 min. Take 300 μL of the supernatant from each well and transfer it to a new 96-well plate. Then add 200 μL of isopropanol to each well, cover the plate with a rubber lid, and shake it by hand for 1 min. 5) Centrifuge at 4000 rpm at 4 °C for 15 min. After pouring off the supernatant, add 600 μL of 75% ethanol solution, cover the plate with a rubber lid, and shake it by hand for 1 min. 6) Centrifuge at 4000 rpm at 4 °C for 15 min. After pouring off the supernatant, let it stand to dry. 7) After the 96-well plate is dried, add 80 μL of preheated Low TE at 65 °C to each well. Cover the plate with a rubber lid, mix it with a vortex mixer for 15 - 20 min, and store it in a 4 °C refrigerator. 2. PCR amplification method: Using the extracted soybean genomic DNA as a template, the KASP primer mixture includes forward primer F1 (SEQ ID NO: 1), forward primer F2 (SEQ ID NO: 2), reverse primer R (SEQ ID NO: 3), and pure water. The KASP primer mixture is prepared by mixing forward primer F1, forward primer F2, reverse primer R, and pure water with a concentration of 100 μM each in a volume ratio of 6:6:15:23.

[0055] ① Perform PCR amplification with primers F1, F2, and R. The reaction is carried out in a QuantStudio5 real-time fluorescence quantitative PCR instrument. The PCR reaction system: 2.6 μL of DNA, 0.07 μL of KASP primer mixture, and 2.53 μL of 2×KASP Master mix.

[0056] ② Amplification program: Pre-denature at 94 °C for 5 min; denature at 94 °C for 20 s, anneal at an annealing temperature of 65 °C - 57 °C for 60 s, with a decrease of 0.8 °C in each of the 10 cycles; denature at 94 °C for 20 s, anneal at an annealing temperature of 57 °C for 60 s, and set 35 cycles.

[0057] After the reaction ended, the fluorescence data of the reaction products were read on a QuantStudio 5 real-time fluorescence quantitative PCR instrument. Using KASP molecular marker primers, 526 soybean germplasm resources (partial data are shown in Table 1) were amplified and genotyped on the real-time fluorescence quantitative PCR instrument to determine the genotype of the SNP locus S12_1140167 in the soybean genome to be tested, that is, to detect whether the nucleotide at position 1140167 on chromosome 12 of the soybean genome is C or T. The specific judgment principle is as follows: If the fluorescence signal data of the amplification product of the soybean to be tested are read and analyzed by the QuantStudio 5 real-time fluorescence quantitative PCR instrument and are close to the X-axis (VIC signal), then the genotype of the SNP locus S12_1140167 in the soybean genome to be tested is the TT homozygous type; if the fluorescence signal data of the amplification product of the soybean to be tested are read and analyzed by the QuantStudio 5 real-time fluorescence quantitative PCR instrument and are close to the Y-axis (FAM signal), then the genotype of the SNP locus S12_1140167 in the soybean genome to be tested is the CC homozygous type; the point close to the origin of the XY-axis is the blank control.

[0058] The internode length was obtained by the ratio of the plant height at maturity to the number of nodes. The method for measuring the plant height was the length from the cotyledon node to the apical growing point after the plant matured. The number of nodes was measured as follows: The first node was between the cotyledon and the true leaf, the second node was between the true leaf and the first trifoliate leaf, and so on.

[0059] The TT genotype represents the homozygous type with the nucleotide type T at the SNP locus S12_1140167 in the soybean genome; the CC genotype represents the homozygous type with the nucleotide type C at the SNP locus S12_1140167 in the soybean genome.

[0060] The genotyping results of different soybean germplasm resources by KASP markers are shown in Figure 2 . The results showed that: This molecular marker primer could clearly separate the two genotypes. Among them, the round dots close to the Y-axis were those carrying the C allele variation site, with a homozygous genotype of CC, there were 264 copies, among which there were 77 internode-long materials, accounting for 29.17%, and 187 internode-short materials, accounting for 70.83%; the round dots close to the X-axis were those carrying the T allele variation site, with a homozygous genotype of TT, there were 262 copies, among which there were 9 internode-long materials, accounting for 3.44%, and 253 internode-short materials, accounting for 96.56%; the point close to the origin of the XY-axis was the blank control. As Figure 3 . As shown in Table 2, the phenotypic difference in internode length between soybean materials with the CC genotype and those with the TT genotype was extremely significant (P < 0.001). Therefore, the KASP marker of the present invention can be used for the breeding of soybean germplasm with internode length traits, and the present invention accurately genotypes the soybean internode length traits. This molecular marker can be applied to the early large-scale germplasm screening to assist in the functional soybean molecular breeding.

[0061] Table 1 Detection Results of Molecular Markers for 633 Soybean Progeny Materials (Partial Results)

[0062] Table 2 Variance Analysis of Two Genotype Materials for Internode Spacing

[0063] The present invention has been described in detail above. For those skilled in the art, without departing from the gist and scope of the present invention and without unnecessary experiments, the present invention can be implemented within a relatively wide range under equivalent parameters, concentrations and conditions. Although specific embodiments of the present invention are given, it should be understood that the present invention can be further improved. In short, according to the principle of the present invention, this application intends to cover any modification, use or improvement of the present invention, including changes made by using conventional techniques known in the art that depart from the scope disclosed in this application.

Claims

1. Application of a substance for detecting SNP site polymorphism or genotype, characterized in that: The SNP site corresponds to the 101st nucleotide of SEQ ID NO: 4, and the polymorphism of the SNP site is C or T; and the application is any one of the following: A1) Application in identification or auxiliary identification of soybean internode distance, A2) Application in the preparation of products for identifying or assisting in identifying soybean internode distance, A3) Application in molecular marker-assisted breeding or germplasm resource identification based on soybean internode spacing traits, A4) Application in the preparation of products for molecular marker-assisted breeding or germplasm resource identification based on soybean internode spacing traits, A5) Application in soybean breeding or assisted soybean breeding, A6) Use in preparing products for soybean breeding or assisting soybean breeding.

2. The use according to claim 1, characterized in that: The substance is as follows (B1), B2) or B3): B1) the substance is a primer composition for amplifying a soybean genomic DNA fragment including the SNP site, B2) The substance is a PCR reagent containing the primer combination described in B1), B3) The substance is a kit containing the primer composition described in B1) or the PCR reagent described in B2).

3. A method for identifying or assisting in identifying soybean internode distance, characterized in that: The method comprises detecting the genotype of the SNP site in the soybean genome to be tested, and identifying or assisting in identifying the internode distance of the soybean to be tested according to the genotype, wherein the SNP site is the SNP site described in claim 1.

4. Application of the method according to claim 3 in soybean breeding.

5. A soybean breeding method, characterized in that: The method comprises detecting the genotype of the SNP site in claim 1 in the soybean genome, and selecting soybeans whose genotype of the SNP site is CC or TT as parents for breeding, wherein CC is the homozygous type of the SNP site being C, and TT is the homozygous type of the SNP site being T.

6. A product for detecting polymorphism or genotype of SNP sites in soybean genome, characterized in that: The SNP site is the SNP site described in claim 1, the product contains the substance described in claim 1, and the product is any one of the following: C1) Products for detecting or assisting in detecting single nucleotide polymorphism or genotype of soybean internode spacing, C2) Products that identify or assist in identifying soybean internode spacing, C3) Products used in soybean breeding, C4) Products that screen or breed soybean plants, plant lines, strains or varieties according to the soybean internode spacing characteristics.

7. The product according to claim 6, characterized in that The product is as follows (D1), D2) or D3): D1) The product is a primer combination for amplifying a soybean genomic DNA fragment including the SNP site, D2) The product is a PCR reagent containing the primer combination described in D1), D3) The product is a kit containing the primer combination described in D1) or the PCR reagent described in D2).

8. The use according to claim 2 or the product according to claim 7, characterized in that: The primer composition comprises the following primers: E1) a forward primer F1 having a nucleotide sequence of SEQ ID NO: 1 or positions 22 to 45 of SEQ ID NO: 1, E2) a forward primer F2 having a nucleotide sequence of SEQ ID NO: 2 or positions 22 to 45 of SEQ ID NO: 2, E3) Reverse primer R3 having a nucleotide sequence of SEQ ID NO:

3.

9. A DNA molecule, characterized in that The nucleotide sequence of the molecular marker is shown in SEQ ID NO:

4.

10. The use of the DNA molecule according to claim 9, wherein the use is any of the following: E1) Application in identification or auxiliary identification of soybean internode distance, E2) Application in the preparation of products for identifying or assisting in identifying soybean internode distance, E3) Application of molecular marker-assisted breeding or germplasm resource identification based on soybean internode spacing traits, E4) Application in the preparation of products for molecular marker-assisted breeding or germplasm resource identification based on soybean internode spacing traits, E5) Application in soybean breeding or assisted soybean breeding, E6) Use in the preparation of products for soybean breeding or assisting soybean breeding, E7) Application in screening or breeding soybean plants, plant lines, strains or varieties according to soybean internode spacing traits, E8) Application in products for assisting the screening or breeding of soybean individual plants, plant lines, strains or varieties according to soybean internode spacing traits.

Images