Molecular marker linked with yellow peel of bitter gourd and application of molecular marker

Abstract

The invention discloses a molecular marker linked with yellow peel of bitter gourd and application of the molecular marker. It is found through analysis that mutation of a base G at the 199th site of SEQ ID NO.1 into A is a reason for formation of bitter gourd yellow peel. A specific primer is designed aiming at the mutation site, a bitter gourd genome is amplified by utilizing the primer, a PCR amplification product is subjected to incision enzyme XhoI enzyme digestion, and the bitter gourd variety with yellow peel can be identified according to the size of an enzyme digestion product. The method can accurately identify the peel color in the early growth stage of the bitter gourd, improves the breeding efficiency of the yellow peel variety of the bitter gourd, and has the advantages of high accuracy, simplicity and convenience in operation and the like.

Description

Technical Field

[0001] The present invention relates to the technical field of molecular breeding, and particularly relates to a molecular marker linked to the yellow pericarp of bitter gourd and its application. Background Art

[0002] Bitter gourd ( Momordica charantia L.), also known as balsam pear and bitter melon, is an annual vine plant of the genus Momordica in the gourd family, mainly planted in tropical and subtropical regions. Bitter gourd is not only rich in vitamins and amino acids, but also contains a variety of active chemical components with high medicinal value, and is known as the "medicinal vegetable". Bitter gourd has various effects such as antiviral, anti-tumor and hypoglycemic. With the widespread attention of people to healthy diet, the market demand and planting area of bitter gourd have increased significantly.

[0003] Pericarp color is one of the key traits of the appearance quality of bitter gourd, and is also an important factor affecting consumers' purchase and breeders' decisions. The pericarp color of bitter gourd is mainly divided into white, light green and green. The pericarp of bitter gourd in South Asia is usually green, while the pericarp of bitter gourd in Southeast Asia mostly shows white or light green. Different consumers have different preferences for the pericarp color of bitter gourd.

[0004] The traditional method for identifying the fruit color of bitter gourd mainly relies on phenotypic selection, which requires observation and screening at the stage of bitter gourd fruiting or even fruit maturity. This not only consumes a large amount of time and manpower, but also has low efficiency. In recent years, molecular marker technology has been widely used in crop genetic breeding. CAPS (Cleaved Amplified Polymorphic Sequence) marker, that is, restriction fragment length polymorphism marker, is a molecular marker method based on PCR technology and restriction endonuclease digestion. It has the advantages of simple operation, good stability, high repeatability, and easy result analysis, and has been applied in the genetic breeding of various crops. By searching for CAPS molecular markers closely linked to the yellow pericarp trait of bitter gourd, breeders can accurately predict and screen the pericarp color trait of bitter gourd plants at the early growth stage, or even at the seed stage, thereby greatly improving the breeding efficiency and shortening the breeding cycle.

[0005] At present, there is no report on CAPS molecular markers closely linked to the yellow pericarp trait of bitter gourd. Therefore, developing CAPS molecular markers closely linked to the yellow pericarp of bitter gourd with high accuracy and clarifying their application methods in bitter gourd breeding have important practical significance for the screening, improvement and innovation of bitter gourd varieties. Summary of the Invention

[0006] In view of the deficiencies of the prior art, the present invention aims to provide molecular markers linked to the yellow pericarp of bitter gourd, as well as the application of these molecular markers in the early identification of the yellow pericarp trait of bitter gourd and assisted breeding, so as to solve the problems of low efficiency and poor accuracy in the selection of pericarp color in traditional bitter gourd breeding and improve the breeding efficiency of bitter gourd varieties with yellow pericarp.

[0007] The technical solution of the present invention is as follows: The application of a molecular marker or a detection reagent for the molecular marker or a detection kit for the molecular marker in identifying the yellow pericarp of bitter gourd, wherein the nucleotide sequence of the molecular marker is as shown in SEQ ID NO.1, the 199th base of the sequence shown in SEQ ID NO.1 is a SNP locus, and there is a base mutation of G / A at this SNP locus. At this SNP locus in the yellow pericarp, it is A. This nucleotide sequence has a specific restriction endonuclease XhoI recognition site CTCGAG.

[0008] Further, the detection reagent includes primers for amplifying the molecular marker and the restriction endonuclease XhoI.

[0009] Further, the detection reagent also includes 2×Hieff ® PCR Master Mix, ddH2O.

[0010] Further, the nucleotide sequence of the upstream primer of the primer is as shown in SEQ ID NO.3, and the nucleotide sequence of the downstream primer of the primer is as shown in SEQ ID NO.4.

[0011] Further, the application is as follows: Using the genomic DNA of bitter gourd as a template, performing PCR amplification with the primers, digesting the PCR product with the restriction endonuclease XhoI, and performing electrophoresis. When a 460 bp band is generated, it is a bitter gourd with non-yellow pericarp. When only 195 bp and 265 bp bands are generated simultaneously, it is a bitter gourd with yellow pericarp.

[0012] On the other hand, the present invention also provides a method for identifying the yellow pericarp trait of bitter gourd, and the method includes the following steps: Using the genomic DNA of bitter gourd as a template, performing PCR amplification with the primers for amplifying the molecular marker, digesting the PCR amplification product with the restriction endonuclease XhoI, and then performing electrophoresis; When a 460 bp band is generated, it is a bitter gourd with non-yellow pericarp. When only 195 bp and 265 bp bands are generated simultaneously, it is a bitter gourd with yellow pericarp.

[0013] Further, the genomic DNA of bitter gourd is derived from bitter gourd seeds, bitter gourd plants, and / or bitter gourd fruits.

[0014] Furthermore, each 20 μL PCR reaction system contains: 10 μL 2×Hieff ® PCR Master Mix, 0.5 μL each of forward and reverse primers, 1 μL DNA, and 8 μL ddH2O.

[0015] Furthermore, the PCR amplification program: pre-denaturation at 95 °C for 5 min; denaturation at 95 °C for 20 S, annealing at 55 °C for 40 S, extension at 72 °C for 30 S, for 35 cycles; extension at 72 °C for 5 min, hold at 12 °C for 5 min.

[0016] Furthermore, the digestion temperature is 37 °C and digestion is carried out overnight.

[0017] On the other hand, the present invention provides a molecular-assisted breeding method for bitter gourd yellow pericarp varieties, including screening bitter gourd breeding materials using the aforementioned method for identifying bitter gourd yellow pericarp traits, and selecting materials with yellow pericarp traits for subsequent breeding.

[0018] Compared with the prior art, the beneficial effects of the present invention are as follows: Molecular markers are detected based on DNA-level differences, are not interfered by environmental factors, can accurately identify the yellow pericarp traits of bitter gourd, avoid misjudgment caused by environmental influence in traditional phenotypic identification, and improve the accuracy and reliability of selection.

[0019] Using this molecular marker, it is possible to detect by extracting DNA at the seedling stage after bitter gourd seeds germinate, or even at the seed stage, to pre-judge the pericarp color traits of bitter gourd without waiting for the fruit to mature, greatly shortening the breeding cycle, improving breeding efficiency, and saving land and resource costs.

[0020] The operation process of CAPS molecular markers is relatively simple, the required experimental equipment and reagents are easily available in general molecular biology laboratories, and the results can be visually presented through conventional electrophoresis analysis, making it easy to promote and apply in breeding practice, and contributing to the breeding work of bitter gourd yellow pericarp varieties. Description of the Drawings

[0021] Figure 1 : Fruit photos of Y52 and M2750.

[0022] Figure 2 : Electrophoresis diagram of the F2 generation of the cross between Y45, Y45 and M2750 after PCR and digestion. 2kb DNA Marker is the "2kb DNA standard reference".

[0023] Figure 3: Electrophoresis patterns of Y52 and the F2 generation of the Y52×M2750 hybrid after PCR and enzyme digestion. Detailed implementation mode

[0024] To better understand the technical content of the present invention, the present invention will be further described below in conjunction with specific embodiments and drawings.

[0025] Example 1 Y52 is a germplasm resource collected by the bitter gourd research group of the Chinese Academy of Tropical Agricultural Sciences and is a high-generation inbred pure line obtained through 8 generations of single-seed descent. Using ethyl methyl sulfonate (EMS) as a mutagen (for the specific method, refer to "A Method for Inducing Mutants of Bitter Gourd", Patent No.: ZL 2022 1 0762651.9), bitter gourd Y52 seeds were mutagenized to screen a bitter gourd mutant M2750 with yellow fruit peel ( Figure 1 ). Through MutMap analysis, it was found that the mutation of G at the 199th position of the SEQ ID NO.2 sequence to A was the reason for the formation of the yellow fruit peel of bitter gourd. Further analyzing this mutation site, it was found that the mutant M2750 had an XhoI restriction enzyme site (CTCGAG, and the sequence containing this site is shown in SEQ ID NO.1) at this site, while Y52 had (CTCGGG, and the sequence containing this site is shown in SEQ ID NO.2) at this site and did not have an XhoI restriction enzyme site. Primers McEGY1-371F: CGCCGAATTTGTCTCCAATTG (SEQ ID NO.3) and McEGY1-806R: GACGCAATTCCTAACTCCACAGAGG (SEQ ID NO.4) were designed respectively upstream and downstream of this site. Using Y52 and M2750 as amplification templates, a 460 bp PCR product could be amplified. The amplification product was added with the restriction enzyme XhoI. The amplification product using Y52 as the template could not be digested by XhoI, while the amplification product using M2750 as the template was digested by XhoI into two segments with sizes of 195 bp and 265 bp respectively. Therefore, the present invention developed a CAPS molecular marker CAPS based on the restriction enzyme XhoI M2750 .

[0026] SEQ ID NO.1: CGCCGAATTTGTCTCCAATTGGACCAGCTTACAATAACTTCCAAGTCGATTCTTTCAAACTGATGGAACTTCTTGGGCCCGAGAAGGTTGATCCTTCTGACGTCAAACTTATAAAGGACAAGCTTTTTGGCTATTCTACCTTCTGGGTAACCAAAGAAGAACCATTTGGAGATCTTGGGGAGGGCATTCTCTTCCTCG A GAATTTAAGAGGAAACAGAGAAGAGGTATTCTCCAAACTCCAAGGCCAGTTGGTTGAAGCCACAGGTGATAAATACAACCTTTTTATGGTGGAGGAACCAAATTCAGAAGGTCCAGATCCACGCGGTGGCCCACGTATCAGTTTTGGTCTGTTGCGAAAAGAGGTCTCAGAACCTGGTCCAACAACACTTTGGCAATATGTTATTGCTCTGTTGTTGTTCCTTTTAACAATTGGCTCCTCTGTGGAGTTAGGAATTGCGTC SEQ ID NO.2: CGCCGAATTTGTCTCCAATTGGACCAGCTTACAATAACTTCCAAGTCGATTCTTTCAAACTGATGGAACTTCTTGGGCCCGAGAAGGTTGATCCTTCTGACGTCAAACTTATAAAGGACAAGCTTTTTGGCTATTCTACCTTCTGGGTAACCAAAGAAGAACCATTTGGAGATCTTGGGGAGGGCATTCTCTTCCTCG G GAATTTAAGAGGAAACAGAGAAGAGGTATTCTCCAAACTCCAAGGCCAGTTGGTTGAAGCCACAGGTGATAAATACAACCTTTTTATGGTGGAGGAACCAAATTCAGAAGGTCCAGATCCACGCGGTGGCCCACGTATCAGTTTTGGTCTGTTGCGAAAAGAGGTCTCAGAACCTGGTCCAACAACACTTTGGCAATATGTTATTGCTCTGTTGTTGTTCCTTTTAACAATTGGCTCCTCTGTGGAGTTAGGAATTGCGTC Example 2 Y52 and Y45 are advanced inbred pure lines obtained by single-seed descent for 8 generations from germplasm resources collected by the Momordica charantia research group of the Chinese Academy of Tropical Agricultural Sciences, and have green fruit peels. The mutant M2750 was crossed with Y52 and Y45. The fruit peel color of the F1 generation was all green, and the single plants with yellow fruit peels in the F2 generation accounted for 1 / 4 of the total number of plants. Twenty-three single plants with yellow fruit peels were selected from each of the two F2 generation populations, and the DNA of Y52, Y45, and the F2 generation population was extracted respectively, and PCR amplification and enzyme digestion were performed (the specific method refers to Example 3). The results showed that except for Y52 and Y45, the amplification products of the yellow single plants in the F2 generation population could all be digested by XhoI into fragments of 265 bp and 195 bp, and the consistency rate of genotype and phenotype was 100% ( Figure 2 and Figure 3 ), indicating that CAPS M2750 is a molecular marker linked to the yellow fruit peel of Momordica charantia, and this molecular marker can be used to identify Momordica charantia with yellow fruit peels.

[0027] Example 3 Method for identifying yellow-skinned Momordica charantia: (1) Extract Momordica charantia DNA (DNA of Momordica charantia plants, seeds or fruits) using the CTAB method, and adjust the DNA concentration to 50 ng / μL.

[0028] (2) Synthesize primers McEGY1-371F: CGCCGAATTTGTCTCCAATTG and McEGY1-806R: GACGCAATTCCTAACTCCACAGAGG from Sangon Biotech (Shanghai) Co., Ltd., and dilute the primers to 10 μM. Using genomic DNA as a template, perform PCR amplification using the above primer pairs respectively.

[0029] (3) The PCR reaction system is 20 μL: 10 μL of 2×Hieff ® PCR Master Mix (Yeasen Biotech Co., Ltd.), 0.5 μL of forward and reverse primers respectively, 1 μL of DNA, and 8 μL of ddH2O.

[0030] (4) PCR amplification program: pre-denaturation at 95 °C for 5 min; denaturation at 95 °C for 20 s, annealing at 55 °C for 40 s, extension at 72 °C for 30 s, 35 cycles; extension at 72 °C for 5 min, 12 °C for 5 min.

[0031] (5) Add 0.5 μL of the restriction enzyme XhoI to the PCR product and digest overnight at 37 °C.

[0032] (6) Perform agarose gel electrophoresis analysis on the enzyme digestion products, and distinguish whether the test sample has yellow peel according to the electrophoresis bands. If only the 265 bp and 195 bp bands appear simultaneously, then the bitter gourd has yellow peel. If the 460 bp band appears, then the bitter gourd does not have yellow peel.

[0033] The above are only partial embodiments of the present invention and are not intended to limit the present invention. Any modifications, equivalent substitutions, improvements, etc. made within the spirit and principle of the present invention shall fall within the protection scope of the present invention.

Claims

1. Use of molecular markers in identifying the yellow pericarp of Momordica charantia, characterized in that, The nucleotide sequence of the molecular marker is shown as SEQ ID NO.

1.

2. Use of a detection reagent for molecular markers in identifying the yellow pericarp of Momordica charantia, characterized in that, The nucleotide sequence of the molecular marker is shown as SEQ ID NO.

1.

3. The application according to claim 2, characterized in that, The detection reagent includes primers for amplifying the molecular marker and the restriction endonuclease XhoI.

4. The application according to claim 3, characterized in that The nucleotide sequence of the upstream primer of the primers is shown as SEQ ID NO.3, and the nucleotide sequence of the downstream primer of the primers is shown as SEQ ID NO.

4.

5. The application according to claim 3, characterized in that Using Momordica charantia genomic DNA as a template, PCR amplification is carried out with the primers, the PCR product is digested with the restriction endonuclease XhoI, and electrophoresis is carried out. When a 460 bp band is generated, it is Momordica charantia with non-yellow peel. When only 195 bp and 265 bp bands are generated simultaneously, it is Momordica charantia with yellow peel.

6. A method for identifying the yellow pericarp trait of Momordica charantia, characterized in that, It includes the following steps: Using Momordica charantia genomic DNA as a template, PCR amplification is carried out with the primers for amplifying the molecular marker recited in claim 1, and after digesting the PCR amplification product with the restriction endonuclease XhoI, electrophoresis is carried out; the nucleotide sequence of the upstream primer of the primers is shown as SEQ ID NO.3, and the nucleotide sequence of the downstream primer of the primers is shown as SEQ ID NO.4; When a 460 bp band is generated, it is Momordica charantia with non-yellow peel. When only 195 bp and 265 bp bands are generated simultaneously, it is Momordica charantia with yellow peel.

7. The method according to claim 6, wherein The Momordica charantia genomic DNA is derived from Momordica charantia seeds, Momordica charantia plants, and / or Momordica charantia fruits.

8. The method according to claim 6, wherein Each 20 μL PCR reaction system contains: 10 μL 2×Hieff ® PCR Master Mix, 0.5 μL each of forward and reverse primers, 1 μL DNA, and 8 μL ddH2O.

9. The method according to claim 6, characterized in that, PCR amplification program: pre-denaturation at 95 °C for 5 min; denaturation at 95 °C for 20 s, annealing at 55 °C for 40 s, extension at 72 °C for 30 s, 35 cycles; extension at 72 °C for 5 min, hold at 12 °C for 5 min.

10. A molecular-assisted breeding method for a bitter gourd variety with yellow peel, characterized in that, It includes screening Momordica charantia breeding materials by using the method for identifying the yellow peel trait of Momordica charantia recited in any one of claims 6-9, and selecting materials with the yellow peel trait for subsequent breeding.

Images