Manganese magnesium carbonate nanoparticles wrapped by cell membrane vesicles as well as preparation method and application of manganese magnesium carbonate nanoparticles

Through the magnesium manganese carbonate nanoparticles wrapped in cell membrane vesicles, combined with the PD1-high-expressing cell membrane vesicles and complex with MgMn nanoparticles, the targeting and immunogenicity of metal nanoparticles are solved, and radiotherapy sensitization and immunomodulation in the tumor microenvironment is achieved, which significantly improves the effect of cancer treatment.

CN120227357AActive Publication Date: 2025-07-01RENMIN HOSPITAL OF WUHAN UNIVERSITY (HUBEI GENERAL HOSPITAL)

Patent Information

Application Number
CN202510387937.7
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-03-31
Publication Date
2025-07-01
Estimated Expiration
2045-03-31

AI Technical Summary

Technical Problem

In the existing cancer immunotherapy, the poor targeting of metal nanoparticles and the immunogenicity problems have not been effectively solved. Conventional high-dose radiation therapy leads to tumor microenvironment toxicity and immunosuppression, STING agonist delivery efficiency is low and systemic toxicity is high, and the success rate of combined application is low.

Method used

Magnesium manganese carbonate nanoparticles wrapped in cell membrane vesicles were used to construct tumor cell membrane vesicles that express PD1 highly complexed with MgMn nanoparticles through CRISPR technology, and used acid microenvironment to decompose Mn2+, Mg2+,·OH and O2 to achieve targeted delivery, immune checkpoint blockade and STING pathway activation, combining radiotherapy sensitization and immune regulation.

Benefits of technology

Accurate enrichment and radiotherapy sensitization in the tumor microenvironment, activate immune response, significantly prolong the survival time of mice, produce long-lasting immune memory, enhance the therapeutic effect on solid tumors, and have good targeting and immune regulation functions.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120227357A_ABST
    Figure CN120227357A_ABST
Patent Text Reader

Abstract

The invention provides magnesium manganese carbonate nanoparticles wrapped by cell membrane vesicles as well as a preparation method and application of the magnesium manganese carbonate nanoparticles. The nanoparticles comprise tumor cell-derived membrane vesicles highly expressing PD1; the MgMn nano-particle compound is wrapped in the vesicles; the magnesium manganese carbonate nano-particles (CVs (at) MgMn) wrapped by the cell membrane vesicles provided by the invention integrate numerous advantages of Mg < 2 + > and Mn < 2 + > ions, not only have immune regulation and control and tumor killing effects, but also can realize radiotherapy sensitization, have immune regulation and control and microenvironment remodeling effects on any type of solid tumors, and can be used for preparing a medicine for treating tumor tumors. And the nano-particles are universal multifunctional composite nano-particles.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to the technical fields of biology and pharmacy, and particularly relates to a magnesium manganese carbonate nanoparticle encapsulated by a cell membrane vesicle, a preparation method thereof, and an application thereof. Background Art

[0002] Recent breakthroughs in cancer immunotherapy have revolutionized the clinical treatment of many malignancies. However, as an independent treatment method, immunotherapy is rarely associated with durable objective responses. These challenges have made it necessary to develop combination treatment regimens with superior efficacy and acceptable toxicity. Radiotherapy (RT), as the most important means of first-line treatment for tumors, can exert a systemic immune-stimulating effect by stimulating immunogenic cell death (ICD), which has led to the widespread conduct of clinical trials on the combined application of radiotherapy and immunotherapy. However, conventional high-dose RT may cause systemic toxicity or strong immunosuppression in the tumor microenvironment (TME), which at least to some extent reflects the repeated killing of circulating immune effector cells or the impact on surrounding lymph nodes, resulting in a very low success rate of combined application. Moreover, STING agonists have problems of low delivery efficiency and systemic toxicity.

[0003] In summary, there is an urgent need to develop a drug for treating solid tumors that solves the problems of poor targeting and immunogenicity of metal nanoparticles. Summary of the Invention

[0004] The object of the present invention is to provide a magnesium manganese carbonate nanoparticle encapsulated by a cell membrane vesicle, a preparation method thereof, and an application thereof. For the first time, PD1-highly expressed cell membrane vesicles are combined with Mn / Mg nanoparticles to achieve dual functions of targeted delivery and immune checkpoint blockade, and to combine STING pathway activation and metal ion metabolism regulation (Mn 2+ / Mg 2+ synergistic effect), and to achieve spatiotemporally controllable radiotherapy sensitization and immune regulation through acid microenvironment-responsive decomposition.

[0005] To achieve the above object, the present invention adopts the following technical solutions:

[0006] In a first aspect of the present invention, there is provided a magnesium manganese carbonate nanoparticle encapsulated by a cell membrane vesicle, the nanoparticle comprising:

[0007] (a) Tumor cell-derived membrane vesicles highly expressing PD1;

[0008] (b) A MgMn nanoparticle complex encapsulated in the vesicle; wherein, the complex decomposes under acidic conditions in the tumor microenvironment to generate Mn 2+ , Mg 2+ , ·OH and O2.

[0009] The magnesium manganese carbonate encapsulated by cell membrane vesicles (CVs@MnMg) nanoparticles, hereinafter referred to as CVs@MnMg.

[0010] Furthermore, the ratio of the protein concentration (mg / mL) in the tumor cell-derived membrane vesicles with high expression of PD1 to the weight of the MgMn nanoparticles is 1:1.

[0011] In the second aspect of the present invention, a method for preparing magnesium manganese carbonate nanoparticles encapsulated by cell membrane vesicles is provided, and the method includes:

[0012] Construct a PD1-overexpressing tumor cell line through CRISPR technology, and then extract cell membrane vesicles to obtain tumor cell-derived membrane vesicles with high expression of PD1.

[0013] Disperse the MgCO3 nanoparticles in absolute ethanol, and then add an aqueous KMnO4 solution under stirring and ultrasonic conditions, and stir at room temperature for the mineralization reaction. After purification, MgMn nanoparticles are obtained.

[0014] Mix the tumor cell-derived membrane vesicles with high expression of PD1 and the MgMn nanoparticles, and load the nanoparticles into the membrane vesicles by electroporation to obtain magnesium manganese carbonate nanoparticles encapsulated by cell membrane vesicles, hereinafter referred to as CVs@MgMn.

[0015] Furthermore, the mass-volume ratio range of the MgCO3 nanoparticles to the aqueous KMnO4 solution is 20:1 to 50:1, and the concentration of the aqueous KMnO4 solution is (4-6) mg / mL.

[0016] In the third aspect of the present invention, the application of the magnesium manganese carbonate nanoparticles encapsulated by cell membrane vesicles in the preparation of immunotherapeutic drugs or radiotherapy sensitizers for solid tumors is provided.

[0017] Furthermore, the solid tumor is selected from one of melanoma, breast cancer, LLC lung cancer, CT26 or MC38 colorectal cancer.

[0018] In the fourth aspect of the present invention, a combined drug composition is provided, and the combined drug composition includes a PD1 monoclonal antibody and the magnesium manganese carbonate nanoparticles encapsulated by cell membrane vesicles.

[0019] In the fifth aspect of the present invention, the application of the combined drug composition in the preparation of immunotherapeutic drugs or radiotherapy sensitizers is provided.

[0020] One or more technical solutions in the embodiments of the present invention have at least the following technical effects or advantages:

[0021] 1. The present invention has developed an engineered nanoparticle (CVs@MgMn) composed of gene-edited cell membrane vesicles (CVs), MnO2, and MgCO3 nanoparticles for radioimmunotherapy through tumor microenvironment (TME) remodeling and activation of the stimulator of interferon genes (STING) pathway. In the TME, the CVs@MgMn nanoparticles precisely enriched in the tumor microenvironment are decomposed by the acidic microenvironment to generate hydroxyl radicals (·OH) and oxygen (O2) to enhance radiosensitization and tumor killing. Subsequently, Mn reduced by the tumor microenvironment 2+ promotes the maturation of dendritic cells (DCs) in the tumor microenvironment through the activation of the STING pathway, and promotes the maturation and tumor killing of CD8+ T cells; while Mg released by the decomposition of MgCO3 nanoparticles 2+ enhances CD8+ T cell- and macrophage-mediated anti-tumor immunity by regulating the metabolic activity of CD8+ T cells and the M1 polarization of tumor-associated macrophages. More importantly, the cell membrane extracellular vesicles encapsulating magnesium manganese carbonate nanoparticles are derived from tumor cells with high PD1 expression, and a large amount of PD1 protein is expressed on the CVs. Tumor-derived CVs not only increase the targeting effect of magnesium manganese carbonate metal nanoparticles, but the PD1 protein also mediates the competitive blockade of the PD-L1 checkpoint. These synergistic effects trigger a strong anti-tumor immune response. In orthotopic and distant rechallenge melanoma models, radiotherapy combined with the nanocomposite (CVs@MnMg) showed strong radioimmunotherapy effects, prolonged the survival time of mice, and generated long-lasting immune memory. At the same time, MgCO3 nanoparticles produce a synergistic treatment effect on solid tumors where 1 + 1 is much greater than 2 while promoting PD-1mAb immunotherapy. This biomimetic composite magnesium manganese carbonate nanoparticle encapsulated by extracellular vesicles demonstrates a simple and easily translatable strategy to enhance the benefits of radiotherapy and immunotherapy for patients with any type of solid tumor.

[0022] 2. The magnesium manganese carbonate nanoparticles encapsulated by cell membrane vesicles (CVs@MgMn) provided by the present invention combine many advantages of Mg 2+ and Mn 2+ ions. In addition to the composite nanoparticles themselves having the effects of regulating immunity and tumor killing, they can also achieve radiotherapy sensitization, and have immune regulation and microenvironment remodeling effects on any type of solid tumor. It is a universal multifunctional composite nanoparticle. BRIEF DESCRIPTION OF THE DRAWINGS

[0023] In order to more clearly illustrate the technical solutions in the embodiments of the present invention, the following will briefly introduce the drawings required for the description of the embodiments. Obviously, the drawings in the following description are some embodiments of the present invention. For those of ordinary skill in the art, without creative efforts, other drawings can also be obtained based on these drawings.

[0024] Figure 1 This is a schematic diagram of the present invention. Among them, A is a schematic diagram of the synthesis of magnesium carbonate nanoparticles (MgCO3), manganese ion-modified nanoparticles (MnMg), and cell membrane-coated magnesium carbonate-based nanoparticles modified with manganese ions (CVs@MnMg); B is a schematic diagram of the radiotherapy sensitization and immune response regulation of CVs@MnMg nanoparticles in vivo.

[0025] Figure 2 Shows the morphology, particle size, and Zeta potential of magnesium carbonate-based nanoparticles; among them, A is the transmission electron microscopy image of MgCO3 nanoparticles and MnMg nanoparticles; B is the transmission electron microscopy image of cell membrane nanovesicles expressing PD1 protein (PD1-CVs) and CVs@MnMg nanoparticles; C is the particle size statistics of MgCO3 nanoparticles, MnMg nanoparticles, PD1-CVs nanovesicles, and CVs@MnMg nanoparticles; D is the Zeta potential of MgCO3 nanoparticles, MnMg nanoparticles, PD1-CVs nanovesicles, and CVs@MnMg nanoparticles.

[0026] Figure 3 Magnesium carbonate nanoparticles can enhance the killing effect of CD8 + T cells and promote their metabolic energy supply; among them, A is the detection of the killing effect of CD8 + T cells on B16F10 cells when different nanoparticles are used to pretreat B16F10 cells; B is the detection of the glycolytic stress of CD8 + T cells when MgCO3 nanoparticles and PD1-CVs nanovesicles are added to the culture medium.

[0027] Figure 4 Treatment with magnesium carbonate-based nanoparticles can promote the polarization of macrophages into M1 type and increase the secretion of cytotoxic inflammatory factors. Among them, A is the M1 polarization ratio of RAW264.7 macrophages treated with different magnesium carbonate-based nanoparticles compared with LPS and PD1-CVs treatment; B is the M2 polarization ratio of RAW264.7 macrophages induced by IL-4 and treated with different magnesium carbonate-based nanoparticles; C is the level of TNF-α secreted by RAW264.7 macrophages treated with different magnesium carbonate-based nanoparticles compared with LPS and PD1-CVs treatment; D is the level of IFN-γ secreted by RAW264.7 macrophages treated with different magnesium carbonate-based nanoparticles compared with LPS and PD1-CVs treatment.

[0028] Figure 5Magnesium manganate-based nanoparticles and cell membrane-coated magnesium manganate nanoparticles have the effects of killing cancer cells and radiosensitizing radiotherapy; among them, A shows the killing effect of magnesium manganate-based nanoparticles at different concentrations on B16F10 cells; B shows the killing effect of radiotherapy at a dose of 6 Gy on B16F10 cells, and C shows the killing effect of radiotherapy at a dose of 6 Gy combined with magnesium manganate-based nanoparticles at different concentrations on B16F10 cells.

[0029] Figure 6 Cell membrane-coated manganese-containing magnesium-based nanoparticles have an immune activation effect of promoting the maturation of DC cells. Among them, when A shows different magnesium-based nanoparticles are used to treat BMDC cells, the DC polarization ratio of BMDC cells CD80 + CD86 + ; when B shows different magnesium-based nanoparticles are used to treat BMDC cells, the DC polarization ratio of BMDC cells CD40 + CD11c + ; when C shows different magnesium-based nanoparticles are used to treat BMDC cells, the level of IFN-β secreted by BMDC cells; when D shows different magnesium-based nanoparticles are used to treat BMDC cells, the level of IL-12 secreted by BMDC cells; when E shows different magnesium-based nanoparticles are used to treat BMDC cells, the level of CXCL10 secreted by BMDC cells.

[0030] Figure 7 Cell membrane-coated magnesium manganate nanoparticles have good solid tumor targeting effects. Among them, when A shows cell membrane-coated magnesium manganate nanoparticles are compared with free DIR dye by intravenous injection, in the subcutaneous tumor-bearing model of B16F10 cells in C57 mice, the fluorescence enrichment and metabolism in the tumor site in in vivo imaging; when B shows the proportion of cell membrane-coated magnesium manganate nanoparticles in the tumor body compared with free DIR dye in important organs of the whole body 24 hours after tail vein injection; when C shows the fluorescence imaging data of the ratio of the drug proportion in the tumor body of the magnesium manganate nanoparticle group compared with the free DIR group 24 hours after tail vein injection.

[0031] Figure 8 Magnesium carbonate nanoparticles have the effect of enhancing the in vivo immunotherapy of anti-PD1 monoclonal antibody; among them, when A shows magnesium carbonate nanoparticles are compared with anti-PD1 monoclonal antibody alone, MgCl2 and their combination, during intravenous administration of subcutaneous tumors in B16F10 tumor-bearing mice, the tumor growth situation; when B shows magnesium carbonate nanoparticles are compared with anti-PD1 monoclonal antibody alone, MgCl2 and their combination, during intravenous administration of subcutaneous tumors in B16F10 tumor-bearing mice, the survival situation of mice.

[0032] Figure 9Magnesium carbonate-based nanoparticles have the effect of enhancing the in vivo tumor inhibitory effect of radiotherapy. Among them, A shows the tumor growth in the subcutaneous tumors of B16F10 tumor-bearing mice when magnesium carbonate nanoparticles are used alone by intravenous injection and in combination with radiotherapy; B shows the overall survival of the mice in the subcutaneous tumors of B16F10 tumor-bearing mice when magnesium carbonate nanoparticles are used alone by intravenous injection and in combination with radiotherapy.

[0033] Figure 10 Magnesium carbonate-based nanoparticles reshape the inhibitory immune microenvironment in solid tumors and increase the proportion of cytotoxic immune cells. Among them, A shows the change in the proportion of DC cells in the tumor in the subcutaneous tumors of B16F10 tumor-bearing mice when magnesium carbonate nanoparticles are used alone by intravenous injection and in combination with radiotherapy; B shows the change in the proportion of CD8 + T cells in the tumor in the subcutaneous tumors of B16F10 tumor-bearing mice when magnesium carbonate nanoparticles are used alone by intravenous injection and in combination with radiotherapy; C shows the change in the proportion of M1 macrophages in the tumor in the subcutaneous tumors of B16F10 tumor-bearing mice when magnesium carbonate nanoparticles are used alone by intravenous injection and in combination with radiotherapy.

[0034] Figure 11 Magnesium carbonate-based nanoparticles have the effect of enhancing the in vivo tumor inhibitory effect of radiotherapy. Among them, A shows the growth of the in-situ tumor in the subcutaneous bilateral tumor model of B16F10 tumor-bearing mice when magnesium carbonate nanoparticles are used alone by intravenous injection and in combination with radiotherapy; B shows the growth of the contralateral tumor in the subcutaneous bilateral tumor model of B16F10 tumor-bearing mice when magnesium carbonate nanoparticles are used alone by intravenous injection and in combination with radiotherapy.

[0035] Figure 12 Magnesium carbonate-based nanoparticles reshape the inhibitory immune microenvironment in solid tumors and increase the proportion of cytotoxic immune cells. Among them, A shows the proportion of CD8 + T cells in the contralateral tumor in the subcutaneous bilateral tumor model of B16F10 tumor-bearing mice when magnesium carbonate nanoparticles are used alone by intravenous injection and in combination with radiotherapy; B shows the proportion of CD8 + IFN-γ + T cells in the contralateral tumor in the subcutaneous bilateral tumor model of B16F10 tumor-bearing mice when magnesium carbonate nanoparticles are used alone by intravenous injection and in combination with radiotherapy; C shows the proportion of CD8 + GramB +The proportion of T cells; D is the proportion of central memory T cells in the contralateral tumor in the subcutaneous bilateral tumor model of B16F10 tumor-bearing mice when magnesium carbonate nanoparticles are used alone by intravenous injection and in combination with radiotherapy; E is the proportion of peripheral memory T cells in the contralateral tumor in the subcutaneous bilateral tumor model of B16F10 tumor-bearing mice when magnesium carbonate nanoparticles are used alone by intravenous injection and in combination with radiotherapy; F is the proportion of Treg cells in the contralateral tumor in the subcutaneous bilateral tumor model of B16F10 tumor-bearing mice when magnesium carbonate nanoparticles are used alone by intravenous injection and in combination with radiotherapy.

[0036] Figure 13 The intravenous injection of magnesium carbonate-based nanoparticles has significant safety in vivo. Detailed implementation manners

[0037] The present invention will be specifically described below in combination with the detailed implementation manners and examples, and the advantages and various effects of the present invention will be presented more clearly therefrom. Those skilled in the art should understand that these detailed implementation manners and examples are used to illustrate the present invention rather than to limit the present invention.

[0038] Throughout the specification, unless otherwise specifically stated, the terms used herein should be understood as having the meanings commonly used in the art. Therefore, unless otherwise defined, all technical and scientific terms used herein have the same meanings as those generally understood by those skilled in the art to which the present invention belongs. In case of contradiction, this specification shall prevail.

[0039] Unless otherwise specifically stated, various raw materials, reagents, instruments, and equipment used in the present invention can be obtained through market purchase or can be obtained by existing methods.

[0040] The general idea of the present invention is as follows:

[0041] According to a typical implementation manner of the present invention, a magnesium carbonate manganese nanoparticle encapsulated by a cell membrane vesicle is provided, and the nanoparticle includes:

[0042] (a) Tumor cell-derived membrane vesicles with high expression of PD1;

[0043] (b) MgMn nanoparticle complex encapsulated in the vesicle; wherein, the complex decomposes to generate Mn 2+ , Mg 2+ , ·OH and O2 under the acidic conditions of the tumor microenvironment.

[0044] In the above technical solution,

[0045] The magnesium carbonate manganese composite nanoparticle (MnMg) can not only reshape the acidic microenvironment of solid tumors, but also supplement Mg required for T cell metabolism and activation in the TME 2+Ions, Mn required for the activation and maturation of DC cells 2+ Ions, promoting CD8 + T cell-mediated tumor killing effect, a functional enhanced nanomaterial of simple magnesium carbonate nanoparticles;

[0046] By wrapping with cell membranes, magnesium manganese carbonate nanoparticles (CVs@MgMn) are given good solid tumor targeting ability, delivering a large amount of Mg at the solid tumor site 2+ 、Mn 2+ ,promoting CD8 + T cell-mediated tumor killing effect, and reversing the hypoxic microenvironment of solid tumors by catalytic oxygen production to achieve radiotherapy sensitization, a functional enhanced nanomaterial of magnesium manganese carbonate nanoparticles (MnMg).

[0047] According to another typical embodiment of the present invention, a preparation method of cell membrane vesicle-wrapped magnesium manganese carbonate nanoparticles is provided, and the method includes:

[0048] Step S1, constructing a PD1-overexpressing tumor cell line, and then extracting cell membrane vesicles to obtain tumor cell-derived membrane vesicles highly expressing PD1;

[0049] In the step S1,

[0050] Constructing the PD1-overexpressing tumor cell line specifically includes mice and melanoma cells B16F10.

[0051] Step S2, dispersing MgCO3 nanoparticles in absolute ethanol, and then adding an aqueous KMnO4 solution under stirring and ultrasonic conditions, and carrying out a mineralization reaction by stirring at room temperature. After purification, MgMn nanoparticles are obtained;

[0052] In the step S2,

[0053] The mass-volume ratio range of the MgCO3 nanoparticles to the aqueous KMnO4 solution is 30:1 to 50:1, and the concentration of the aqueous KMnO4 solution is (4-6) mg / mL.

[0054] Step S3, mixing the tumor cell-derived membrane vesicles highly expressing PD1 with the MgMn nanoparticles, and loading the nanoparticles into the membrane vesicles by electropermeabilization to obtain cell membrane vesicle-wrapped magnesium manganese carbonate nanoparticles, abbreviated as CVs@MgMn.

[0055] In the step S3,

[0056] The ratio of the protein mass in the tumor cell-derived membrane vesicles highly expressing PD1 to the weight of the MgMn nanoparticles is 1:1; too low or too high a ratio is not conducive to uniformly coating the magnesium carbonate-based nanoparticles.

[0057] Through the above steps, magnesium manganite nanoparticles encapsulated by cell membrane vesicles can be successfully constructed. The magnesium manganite nanoparticles encapsulated by cell membrane vesicles simultaneously integrate three functions: radiotherapy sensitization (·OH / O2 generation), immune microenvironment remodeling (DC maturation / T cell activation / macrophage polarization), and immune checkpoint blockade (PD1-PDL1 competition), and have the application prospect of preparing immune therapy drugs or radiotherapy sensitizers for solid tumors.

[0058] The present application will be described in detail below in conjunction with examples and experimental data.

[0059] Example 1: Synthesis of magnesium carbonate-based nanoparticles and verification of the functions of enhancing CD8+ T cell killing effect, enhancing CD8+ T cell glucose metabolism, and promoting macrophage polarization to the M1 type.

[0060] I. Synthesis of magnesium carbonate (MgCO3), magnesium manganite (MnMg), and magnesium manganite nanoparticles encapsulated by cell membrane vesicles (CVs@MnMg)

[0061] 1. Preparation of MgCO3 nanoparticles

[0062] MgCO3 nanoparticles were prepared by the carbon dioxide bubbling carbonization method. Under vigorous stirring, MgCl2 (1 M) was rapidly added to the NaOH aqueous solution (2 M) in equal volume to form a Mg(OH)2 precipitate. After 10 min, CO2 gas was slowly introduced into the above reaction mixture solution until the pH value of the mixture dropped to -pH 7.4 and terminated. Then the nanoparticles were collected and redissolved in ultrapure water, and purified by repeated centrifugation at 12,000 rpm to obtain MgCO3 nanoparticles.

[0063] 2. Preparation of MgMn nanoparticles

[0064] After separating a part of the above MgCO3 nanoparticles and dispersing them in absolute ethanol, 10 mL of an aqueous solution of KMnO4 (5 mg / mL) was added under stirring and ultrasonic conditions, and the mineralization reaction was stirred at room temperature for 8 h. The black MgMn nanoparticles were collected and purified by repeated centrifugation at 8,000 rpm using ddH2O. Finally, the MgMn nanoparticles were dispersed in ddH2O by ultrasound and stored at 4°C for later use.

[0065] 3. Preparation of tumor cell-derived membrane vesicles highly expressing PD1

[0066] (1) Method for preparing B16F10 cells stably expressing PD-1 membrane protein, specifically including: the construction of the PD-1 overexpression plasmid was entrusted to Hanheng Biotechnology Company. The PD1 sequence was obtained from the NCBI database (accession number: NM_008798.3), and the expression vector was the pDisplay-GRAB_VIP1.0 expression vector from Addgene (Plasmid: #208682); the sequence of the PDGFRβ transmembrane domain was added to the N-terminus of the PD1 sequence to help the PD1 protein cross the cell membrane during translation. The base sequence of the PDGFRβ transmembrane domain is as follows:

[0067] (GCTGTGGGCCAGGACACGCAGGAGGTCATCGTGGTGCCACACTCCTTGCCCTTT AAGGTGGTGGTGATCTCAGCCATCCTGGCCCTGGTGGTGCTCACCATCATCTCCCTTATC ATCCTCATCATGCTTTGGCAGAAGAAGCCACGT, SEQ ID NO.1). The signal peptide Igk leader sequence was inserted into the C-terminus of the PD1 sequence to help the PD1 protein be fixed on the cell membrane after crossing the membrane. The base sequence of the signal peptide Igk leader is as follows:

[0068] (ATGGAGACAGACACACTCCTGCTATGGGTACTGCTGCTCTGGGTTCCAGGTTCCACT GGTGAC, SEQID NO.2). The pDisplay-GRAB_VIP1.0 expression vector was digested with AjiI and Eco47III enzymes, and then the PD1 composite base sequence containing the PDGFRβ transmembrane domain and the Igk leader fixed peptide was recombined onto the pDisplay-GRAB_VIP1.0 vector under the action of DNA ligase to construct a complete PD1 overexpression plasmid (named: pcDNA3.4-PD-1).

[0069] Transfection of PD1 plasmid was performed using PEI according to the manufacturer's instructions. The composite plasmid of 0.75 μg psPAX2 (Biyuntian Bio: JY03062), 0.25 μg pMD2 auxiliary plasmid (Biyuntian Bio: JY03061) and 1 μg PD1 recombinant plasmid (pcDNA3.4-PD-1) was transiently transfected into HEK293T cells using PEI reagent. After 48 h, the viral supernatant of HEK293T cells was collected and filtered with a 0.45 μm filter. The filtrate was diluted into fresh RPMI 1640 containing 10 μg / mL polybrene and mixed to infect B16F10 cells. After 48 h of infection, the cells were collected and resuspended in fresh culture medium. CytoFLEX SRT was used to sort mcherry-positive cells.

[0070] (2) B16F10 cells stably expressing PD-1 membrane protein were suspended in ultrapure water after autoclaving and destroyed by repeated freezing and thawing with liquid nitrogen. DNA and RNA were removed using DNase and RNase treatment solutions, and then centrifuged at 3200g for 5 min. The supernatant was collected and further centrifuged at 20,000g for 30 min. The supernatant was then centrifuged again at 100,000g for 2 h to obtain cell membranes, which were resuspended in sterile PBS and squeezed through polycarbonate membranes with 800nm, 400nm and 200nm nanopores using a micro extruder (Avanti Polar Lipids, USA) to obtain nanoscale PD1-CVs cell membrane nanovesicles expressing PD1 protein.

[0071] 4. Cell membrane vesicle-encapsulated magnesium manganese carbonate (CVs@MnMg) nanoparticles

[0072] Membrane vesicles (CVs) derived from B16F10 cells with high expression of PD1 and MgMn nanoparticles were mixed in a 1:1 ratio of total protein concentration (mg / mL) on CVs to the weight of MgMn nanoparticles, and then squeezed back and forth for more than 20 times using a 400nm polycarbonate porous membrane to obtain CVs@MgMn nanomaterials.

[0073] 2. Characterization of magnesium carbonate (MgCO3), magnesium manganese carbonate (MnMg), and cell membrane vesicle-encapsulated magnesium manganese carbonate (CVs@MnMg) nanoparticles.

[0074] The appearance of the nanoparticles was observed by transmission electron microscopy, and the particle size and potential of MgCO3, CVs, MgMn and CVs@MgMn were determined under dynamic light scattering.

[0075] The results showed that the particle size of magnesium carbonate and magnesium manganese carbonate nanoparticles was about 100nm and was semi-regular elliptical ( Figure 2A), The PD1-CVs are lipid cell membranes with a particle size of about 150 nm Figure 2 B), CVs-MgMn are composite nanoparticles encapsulated by membrane vesicles, with a particle size of about 170 nm Figure 2 C); The Zeta potential changes significantly with the combination of composite nanoparticle sizes Figure 2 D), The potential of CVs-MgMn nanoparticles is about -30 mV. According to the potential change, it can be inferred that the carbonate nanoparticles have good dispersibility.

[0076] Example 2: Pretreating cancer cells with magnesium carbonate nanoparticles or MgMn or CVs@MgMn and supplementing Mg 2+ ions in the culture medium can promote the metabolic function of CD8+ T cells and enhance the killing effect of CD8 + T cells on cancer cells

[0077] We isolated and extracted naive T cells from the spleens of C57 mice. The above cells were activated with phorbol 12-myristate 13-acetate (PMA) (50 ng / mL) and ionomycin (500 ng / mL) for 12 h to induce them into primary mouse CD8 + T; Then, 5×10 3 B16F10-luc cells were incubated in black 96-well plates and treated with 40 μg / mL of MgCO3, PD1-CVs, MgMn, and CVs@MgMn for 4 h. Then, 1×10 5 activated CD8 + T cells were co-cultured with B16-luc cells for 24 h. The cytotoxicity of CD8+ T cells was detected using a luciferase detection system (Promega, E2610), and the luminescence of each group of B16F10 cancer cells was quantitatively analyzed in the presence of D-luciferin sodium substrate. After removing the cytotoxic effects caused by the nanomaterials themselves, the cytotoxicity (%) of sample X was calculated as (1 - luminescence of X / 'luminescence of only target cells') × 100% Figure 3 A). The Seahorse XF Cell Mito Stress Test Kit and the Agilent Seahorse Glycolysis Stress Test Kit were used to analyze the glycolytic metabolic activity of CD8 + T cells in the presence of Mg 2+ ions. + The glycolytic metabolic activity of CD8

[0078] As shown in the results Figure 3 , it can be seen that: Pretreating cancer cells with magnesium carbonate nanoparticles or MgMn or CVs@MgMn can reverse the microenvironment of B16F10 cells and enhance the killing effect of CD8 + T cells on B16F10 cancer cells Figure 3A); Mg ions in the supplemented medium 2+ can promote the glycolytic metabolism of CD8 + T cells and increase the ATP supply for CD8 + T ([[]] Figure 3 B).

[0079] Example 3: Pretreatment of cancer cells with magnesium carbonate nanoparticles or MgMn or CVs@MgMn, and Mg 2+ ions in the supplemented medium can promote the polarization of Raw264.7 macrophages into the M1 type and enhance the secretion of killer inflammatory factors

[0080] We treated B16F10 cancer cells with 50 μg / mL of magnesium carbonate nanoparticles, PD1-CVs nanovesicles, MgMn nanoparticles, and CVs@MgMn nanoparticles for 12 h respectively, and then separated the culture medium of the above cancer cells to culture RAW264.7 macrophages for 24 h. The positive control group of RAW264.7 cells was added with 50 ng / ml LPS. For inducing the polarization of RAW264.7 macrophages into the M2 type, 50 ng / ml of IL-4 was additionally added to the supernatant containing nanoparticles. Flow cytometry was used to detect the polarization of RAW264.7 cells, and the Elisa method was used to detect the secretion of cytokines in the cell supernatant.

[0081] The results are as Figure 4 shown. It can be seen that pretreatment of cancer cells with magnesium carbonate nanoparticles or MgMn or CVs@MgMn, and Mg 2+ ions in the supplemented medium can promote the polarization of Raw264.7 macrophages into the M1 type( Figure 4 A), reverse the M2 polarization of macrophages mediated by IL-4( Figure 4 B), and enhance the secretion of killer inflammatory factors TNF-α and INF-γ( Figure 4 C,[[]] Figure 4 D).

[0082] Example 4: Magnesium carbonate manganese nanoparticles and cell membrane-coated magnesium carbonate manganese nanoparticles have direct killing effects on cancer cells, radiotherapy-sensitizing killing effects, and immune activation effects that promote the maturation of DC cells.

[0083] 1. Magnesium carbonate manganese-based nanoparticles and cell membrane-coated magnesium carbonate manganese nanoparticles have killing effects on cancer cells.

[0084] 1×10 31×10⁶ B16F10 cells were seeded in 96-well plates and cultured. After 12 h, the cells were treated with media containing different concentrations of MgCO₃, MgMn, and CVs@MgMn for 24 h. 10 μL of CCK-8 solution was added to each well, and the incubation was continued for 2 h. Then, the optical density (OD) at 450 nm was measured using a microplate reader (Synergy H1, Biotek) to evaluate cell viability. For the radiosensitization experiment, 1×10 3 ⁶ B16F10 cells were seeded in 96-well plates and cultured. After 12 h, the cells were treated with media containing different concentrations of MgCO₃, MgMn, and CVs@MgMn for 12 h. Then, half of the cells were irradiated with a 6 Gy irradiator, and the culture was continued for 24 h. 10 μL of CCK-8 solution was added to each well, and the incubation was continued for 2 h. Then, the optical density (OD) at 450 nm was measured using a microplate reader to evaluate cell viability.

[0085] The results showed that magnesium manganese carbonate nanoparticles and cell membrane-coated magnesium manganese carbonate nanoparticles had a direct killing effect on cancer cells ( Figure 5 A) and a radiosensitizing killing effect ( Figure 5 C).

[0086] 2. Cell membrane-coated magnesium manganese carbonate-based nanoparticles had an immune activation effect in promoting the maturation of DC cells.

[0087] BMDC cells derived from the bone marrow of C57 mice were seeded in 6 cm cell culture plates, and PD1-CVs, MnMg, and cell membrane-coated magnesium manganese carbonate (CVs@MnMg) nanoparticles derived from B16F10 cells were added for co-culture of the cells for 48 h. Flow cytometry was used to detect the maturation of BMDC cells and the secretion of inflammatory factors;

[0088] The results showed that cell membrane-coated magnesium manganese carbonate nanoparticles had an immune activation effect in promoting the maturation of DC cells ( Figure 6 A and Figure 6 B), and promoted the secretion of maturation-related inflammatory factors by BMDC cells ( Figure 6 C to Figure 6 E).

[0089] 3. Cell membrane-coated magnesium manganese carbonate nanoparticles had good solid tumor targeting effects in vivo.

[0090] To confirm whether cell membrane coating modification conferred solid tumor targeting effects on magnesium manganese carbonate nanoparticles in vivo, we established solid tumors in C57 mice using B16F10 mouse melanoma cancer cells and intravenously administered DIR-modified cell membrane-coated magnesium manganese carbonate nanoparticles, and the enrichment of fluorescence signals in the tumors was monitored in real time using a small animal in vivo imaging system.

[0091] The experimental results show that, compared with the simple DIR dye, the cell membrane coating modification significantly enhances the targeting effect of magnesium manganese carbonate nanoparticles at the site of solid tumors in vivo ( Figure 7 A); it can be clearly seen from the fluorescence distribution statistics of the main organs that the nanoparticles modified with cell membrane coating account for about 13% of the main organs ( Figure 7 B); from the comparison within the excised tumor, it can be seen that the enrichment of the nanoparticles coated with cell membrane in the tumor is about 10 times higher than that of the simple DIR fluorescent dye in the tumor ( Figure 7 C).

[0092] Example 5: Magnesium carbonate-based nanoparticles and cell membrane-coated magnesium carbonate-based nanoparticles have good immune regulation and radiotherapy sensitization effects in vivo

[0093] 1. Magnesium carbonate nanoparticles have the effect of enhancing the in vivo immunotherapy of anti-PD1 monoclonal antibody.

[0094] We established a solid tumor model of C57 mice using B16F10 mouse melanoma cancer cells, and intravenously administered magnesium carbonate nanoparticles (150 μg / mouse), MgCl2, anti-PD-1 mAb (200 μg) or their combination. The control group was intravenously injected with an equal volume of PBS, and the drug was administered once every other day. The growth of the tumor mass and the survival of the mice were monitored. When the tumor mass of the control group approached 1500 mm 3 the experiment was terminated and the death of the mice was recorded.

[0095] The experimental results show that magnesium carbonate nanoparticles significantly enhance the in vivo immunotherapy effect of anti-PD1 monoclonal antibody ( Figure 8 A), and significantly prolong the survival period of tumor-bearing mice ( Figure 8 B);

[0096] 2. Magnesium carbonate-based nanoparticles have the effect of enhancing the tumor suppression effect of radiotherapy in vivo.

[0097] We established a solid tumor model of C57 mice using B16F10 mouse melanoma cancer cells, and intravenously administered MnMg nanoparticles, CVs nanovesicles, and CVs@MnMg nanoparticles. 24 hours after administration, some mice were given 6 Gy irradiation to the tumor mass. The control group was intravenously injected with an equal volume of PBS, and the drug or radiotherapy was administered once every other day, for a total of 3 times of drug administration and radiotherapy. The growth of the tumor mass and the survival of the mice were monitored. When the tumor mass of the control group approached 1500 mm 3 the experiment was terminated and the death of the mice was recorded.

[0098] The experimental results showed that magnesium carbonate-based nanoparticles (MnMg nanoparticles and CVs@MnMg nanoparticles) and PD1-CVs nanoparticles significantly enhanced the in vivo immunotherapeutic effect of radiotherapy, while the group of cell membrane-coated magnesium carbonate-based nanoparticles (CVs@MnMg) combined with radiotherapy almost completely inhibited the growth of solid tumors ( Figure 9 A), and this group also significantly prolonged the survival time of tumor-bearing mice ( Figure 9 B);

[0099] 3. Magnesium carbonate-based nanoparticles reshaped the inhibitory immune microenvironment in solid tumors.

[0100] We established a solid tumor model of C57 mice using B16F10 mouse melanoma cancer cells, and intravenously administered magnesium carbonate nanoparticles, MnMg nanoparticles, CVs nanovesicles, and CVs@MnMg nanoparticles. Twelve hours after administration, some mice were given 6 Gy irradiation to the tumor. The control group was intravenously injected with an equal volume of PBS, and the drug or radiotherapy was given once every other day, for a total of 3 times of drug administration and radiotherapy. Twenty-four hours after the last radiotherapy, the mice were euthanized and the tumors were removed and prepared into single-cell suspensions. After antibody labeling, the immune cell subsets in the tumors were detected by flow cytometry. The experimental results showed that the treatment with magnesium carbonate-based nanoparticles significantly increased the proportions of CD8 + T cells, M1 macrophages, and DC cells in solid tumors ( Figure 10 A to Figure 10 C);

[0101] Example 7: Cell membrane-coated magnesium carbonate-based nanoparticles have radiosensitization and long-term memory vaccine effects in vivo

[0102] 1. Cell membrane-coated magnesium carbonate-based nanoparticles have radiosensitization and enhance the long-term vaccine memory effect of radiotherapy in vivo.

[0103] We established an orthotopic solid tumor model in the right subcutaneous region of C57 mice using B16F10 mouse melanoma cancer cells. Five days later, a distal solid tumor model was established in the left subcutaneous region of C57 mice using B16F10 cells again. When the tumor volume of the right solid tumor grew to 50 mm 3 3, magnesium carbonate nanoparticles, MnMg nanoparticles, CVs nanovesicles, and CVs@MnMg nanoparticles were intravenously administered. Twelve hours after administration, some mice were given 6 Gy irradiation to the right tumor. The control group was intravenously injected with an equal volume of PBS, and the drug or radiotherapy was given once every other day, for a total of 3 times of drug administration and radiotherapy. The growth of the right orthotopic tumor and the distal left tumor was monitored. The experimental results showed that magnesium carbonate-based nanoparticles not only significantly enhanced the in vivo immunotherapeutic effect of radiotherapy and inhibited the growth of the right tumor ( Figure 11A), significantly inhibited the growth of the distal left tumor, and CVs@MnMg and radiotherapy also had a synergistic anti-tumor effect on the left tumor mass ( Figure 11 B);

[0104] 2. Treatment with cell membrane-coated magnesium carbonate-based nanoparticles increased the distal tumor memory effect of radiotherapy and the proportion of anti-tumor immune cells.

[0105] We used B16F10 mouse melanoma cancer cells to establish an orthotopic solid tumor model subcutaneously on the right side of C57 mice. On the fifth day, B16F10 cells were used again on the left side to establish a distal solid tumor model subcutaneously on the left side of C57 mice. When the tumor volume of the right solid tumor grew to 50 mm 3 After that, magnesium carbonate nanoparticles, MnMg nanoparticles, CVs nanovesicles, and CVs@MnMg nanoparticles were administered intravenously. 12 hours after administration, some mice were given 6 Gy irradiation to the right tumor mass. The control group was intravenously injected with an equal volume of PBS, and the drug or radiotherapy was given once every other day, for a total of 3 times of drug administration and radiotherapy. 24 h after the last radiotherapy, the mice were euthanized and the tumor mass of the distal tumor (left side) was removed, prepared into a single-cell suspension, and the immune cell subsets in the tumor mass were detected by flow cytometry after antibody labeling; the experimental results showed that treatment with cell membrane-coated magnesium carbonate-based nanoparticles significantly increased the proportion of CD8 + T, IFN-γ + T cells and GramB + T cells ( Figure 12 A to Figure 12 C), the proportion of memory T cells ( Figure 12 D, Figure 12 E), and decreased the proportion of Treg cells ( Figure 12 F);

[0106] 3. Intravenous injection of magnesium carbonate-based nanoparticles has significant safety in vivo.

[0107] We continuously intravenously administered magnesium carbonate manganese nanoparticles, CVs cell membrane nanovesicles, and cell membrane-coated magnesium carbonate manganese nanoparticles CVs@MnMg to C57 mice for 7 consecutive days. After anesthetizing the mice, abdominal vena cava blood was drawn to detect the main organ function indexes; the experimental results showed that long-term intravenous injection of magnesium carbonate-based nanoparticles had significant safety in vivo and did not change the organ functions such as liver function (ALT, AST), kidney function (UA, CREA), and myocardial enzyme spectrum (CK, LDH) of mice;

[0108] Finally, it should also be noted that the term "comprising", "including" or any other variant thereof is intended to cover non-exclusive inclusion, such that a process, method, article or apparatus comprising a series of elements not only includes those elements but also includes other elements not expressly listed, or elements inherent to such process, method, article or apparatus.

[0109] Although the preferred embodiments of the present invention have been described, additional changes and modifications can be made by those skilled in the art once they learn the basic inventive concept. Therefore, the appended claims are intended to be construed to include the preferred embodiments as well as all changes and modifications falling within the scope of the present invention.

[0110] Obviously, those skilled in the art can make various changes and modifications to the present invention without departing from the spirit and scope of the present invention. Thus, if these modifications and variations of the present invention fall within the scope of the claims of the present invention and their equivalent technologies, the present invention is also intended to include these modifications and variations.

Claims

1. A magnesium manganese carbonate nanoparticle wrapped in a cell membrane vesicle, characterized in that: The nanoparticles comprise: Membrane vesicles derived from tumor cells that highly express PD1; MgMn nanoparticle complex encapsulated in vesicles.

2. The cell membrane vesicle-encapsulated magnesium manganese carbonate nanoparticles according to claim 1, characterized in that: The mixing ratio of the membrane vesicles derived from tumor cells that highly express PD1 and the MgMn nanoparticle complex encapsulated in the vesicles is 1:1 in terms of the concentration of cell membrane vesicle protein (mg / mL) to the mass of MgMn nanoparticles (mg).

3. A method for preparing magnesium manganese carbonate nanoparticles encapsulated by cell membrane vesicles according to any one of claims 1-2, characterized in that: The method comprises: A PD1-overexpressing tumor cell line was constructed, and then cell membrane vesicles were extracted to obtain membrane vesicles derived from tumor cells that highly expressed PD1; After dispersing MgCO3 nanoparticles in anhydrous ethanol, KMnO4 aqueous solution was added under stirring and ultrasonic conditions, and the mineralization reaction was stirred at room temperature. After purification, MgMn nanoparticles were obtained; The membrane vesicles derived from tumor cells that highly express PD1 are mixed with the MgMn nanoparticles, and the nanoparticles are loaded into the membrane vesicles by electroporation to obtain cell membrane vesicle-wrapped magnesium manganese carbonate nanoparticles, referred to as CVs@MgMn.

4. The preparation method according to claim 3, characterized in that: The extracting of cell membrane vesicles specifically comprises: Tumor cell-derived membrane vesicles with high expression of PD1 were obtained by differential centrifugation or membrane separation.

5. The preparation method according to claim 3, characterized in that: The mass volume ratio of the MgCO3 nanoparticles to the KMnO4 aqueous solution ranges from 30:1 to 50:1, and the concentration of the KMnO4 aqueous solution is (4-6) mg / mL.

6. The preparation method according to claim 3, characterized in that: The ratio of the protein amount in the membrane vesicles derived from tumor cells that highly express PD1 to the weight of the MgMn nanoparticles is 1:

1.

7. Use of the magnesium manganese carbonate nanoparticles encapsulated by the cell membrane vesicles according to any one of claims 1-2 in the preparation of immunotherapeutic drugs or radiosensitizers for solid tumors.

8. The use according to claim 7, characterized in that: The solid tumor is selected from one of melanoma, breast cancer, LLC lung cancer, CT26 or MC38 colorectal cancer.

9. A combination pharmaceutical composition, characterized in that: The combination pharmaceutical composition comprises PD1 monoclonal antibody and magnesium manganese carbonate nanoparticles encapsulated by cell membrane vesicles as described in any one of claims 1-2.

10. Use of the combined pharmaceutical composition according to claim 9 in the preparation of immunotherapy drugs or radiotherapy sensitizers.

Citation Information

Patent Citations

  • Bionic cell membrane nanoparticle as well as preparation method and application thereof

    CN112972420A

  • Nano-drug with tumor immune microenvironment regulation function as well as preparation method and application of nano-drug

    CN115702889A

  • Bionic nano-particles for targeting tumors as well as preparation method and application of bionic nano-particles

    CN116172972A

  • Bispecific nanoparticle systems for targeting cancer cells

    US20240148899A1

  • Application of divalent manganese in preparing immunity enhancing drug or antitumor drug

    WO2021077566A1

Cited By

  • ROS (reactive oxygen species) response type nano vesicle medicine as well as preparation method and application thereof

    CN120827630A