Application of TRIM16 / NFKBIZ / NF-kappa B axis in hepatocellular carcinoma

Through the application of TRIM16/NFKBIZ/NF-κB axis, NF-κB signaling is regulated, and the problem of resistance to sorafenib is solved, and the treatment effect of hepatocellular carcinoma is improved.

CN120230842APending Publication Date: 2025-07-01THE FIRST AFFILIATED HOSPITAL OF ZHENGZHOU UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202311845417.3
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2023-12-29
Publication Date
2025-07-01

AI Technical Summary

Technical Problem

In the prior art, the treatment methods for hepatocellular carcinoma have individual variability and resistance to chemotherapy and radiotherapy, resulting in limited overall therapeutic effects, especially the issue of sorafenib resistance has not been fully understood.

Method used

Through the application of the TRIM16/NFKBIZ/NF-κB axis, TRIM16 regulates NF-κB signaling through interaction with NFKBIZ, affecting the growth, migration and sensitivity to sorafenib in hepatocellular carcinoma.

Benefits of technology

The application of TRIM16/NFKBIZ/NF-κB axis can regulate the apoptosis rate and sensitivity to sorafenib, providing new therapeutic and prognostic targets, and improving the therapeutic effect of hepatocellular carcinoma.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120230842A_ABST
    Figure CN120230842A_ABST
Patent Text Reader

Abstract

The invention belongs to the field of biological medicine, and particularly relates to application of NFKBIZ and TRIM16 in hepatocellular carcinoma. The invention relates to an application of a TRIM16 / NFKBIZ / NF-kappa B axis in preparation of a hepatocellular carcinoma diagnosis product or a hepatocellular carcinoma treatment drug. NFKBIZ regulates and controls conduction of a downstream NF-kappa B signal through interaction with TRIM16. The application finds that the prognosis of an HCC (hepatocellular carcinoma) patient with low NFKBIZ expression is poor, and NFKBIZ regulates and controls the proliferation and metastasis of HCC cells by regulating an NF [kappa] B pathway. The application also finds that the inhibition effect of the NFKBIZ on the HCC cells is weakened by the TRIM16 by increasing the ubiquitination of the NFKBIZ. The overexpression of the NFKBIZ enhances the apoptosis rate of the HCC cells, and under the treatment of sorafenib, the TRIM16 relieves the effect by promoting the degradation of the NFKBIZ. These findings prompt the potential effect of NFKBIZ as a new target for HCC treatment and prognosis, and it as a key target for protecting the sensitivity of HCC to sorafenib.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention belongs to the field of biomedicine, and particularly relates to the application of the TRIM16 / NFKBIZ / NF-κB axis in hepatocellular carcinoma. Background Art

[0002] Hepatocellular carcinoma (HCC) is the most common primary liver cancer, accounting for about 70-80% of liver cancer cases. Among cancer incidences, HCC ranks sixth and is the third leading cause of cancer-related deaths. Current treatment methods for HCC include surgical resection, liver transplantation, radiotherapy, and chemotherapy. However, these treatment methods still face challenges such as individual variability and resistance to chemotherapy and radiotherapy, resulting in limited overall treatment effects. Therefore, it is of great significance to explore and improve the current treatment methods for HCC.

[0003] NFKBIZ belongs to the inhibitor of nuclear factor kappa B (IκB) family and plays an important role in various biological activities including individual immunity and inflammatory responses. Generally, IκB proteins inhibit the nuclear translocation of NF-κB in the nucleus, while NFKBIZ inhibits the activated NF-κB signaling by binding to NF-κB in the nucleus, ultimately leading to the inactivation of NF-κB downstream genes. NFKBIZ plays a bidirectional role in the progression of different tumors. Studies on diffuse large B-cell lymphoma (DLBCL) have found that about 40% of patients with primary testicular DLBCL (PT-DLBCL) have somatic mutations in NFKBIZ, and the abnormal expression of NFKBIZ promotes the progression of PT-DLBCL. However, in the context of ulcerative colitis, the mutation rate of NFKBIZ is higher in intestinal epithelial cells and lower in tumor cells caused by colitis, indicating that intestinal epithelial cells may resist tumor transformation through selective NFKBIZ mutations. The potential effects and mechanisms of NFKBIZ in HCC are still unclear.

[0004] Sorafenib is a multi-target tyrosine kinase inhibitor and is currently used for first-line treatment of advanced hepatocellular carcinoma. Sorafenib is considered beneficial for the overall survival (OS) of patients with hepatocellular carcinoma, but there are still unresolved limitations. Currently, drug resistance and insensitivity to sorafenib are increasingly prominent major problems, resulting in unsatisfactory treatment effects for patients with hepatocellular carcinoma. Mechanistically, sorafenib inhibits the signal transduction of the Raf / MAPK / ERK pathway by binding to receptor tyrosine kinases. The development of sorafenib resistance involves bypass pathways that mediate the activation of downstream targets of the MAPK signaling pathway. Studies have shown that when hepatocellular carcinoma cells acquire resistance to sorafenib, the p38-MAPK, PI3K / AKT, and NF-κB signaling pathways are abnormally activated. Since the mechanism of sorafenib insensitivity is complex and not fully understood, finding the key targets to solve this problem is of great significance for patients with hepatocellular carcinoma. Summary of the Invention

[0005] Aiming at the problems and deficiencies existing in the prior art, the purpose of the present invention is to provide the application of the TRIM16 / NFKBIZ / NF-κB axis in hepatocellular carcinoma.

[0006] Based on the above purpose, the application of the TRIM16 / NFKBIZ / NF-κB axis in hepatocellular carcinoma of the present invention adopts the following technical solutions:

[0007] The application of the TRIM16 / NFKBIZ / NF-κB axis in the preparation of diagnostic products or therapeutic drugs for hepatocellular carcinoma, wherein NFKBIZ regulates the signal transduction of downstream NF-κB by interacting with TRIM16.

[0008] Preferably, the overexpression of TRIM16 regulates the ubiquitination and degradation of NFKBIZ.

[0009] Mechanistically, TRIM16 enhances the ubiquitination of NFKBIZ by directly interacting with the K48 site of NFKBIZ, reducing the sensitivity of hepatocellular carcinoma cells to sorafenib.

[0010] Furthermore, NFKBIZ binds to NF-κB in the nucleus to regulate the growth and migration of hepatocellular carcinoma mediated by downstream NF-κB signal transduction, and the TRIM16 / NFKBIZ / NFκB is associated with the sensitivity of hepatocellular carcinoma to sorafenib.

[0011] Furthermore, NFKBIZ is negatively correlated with the progression of hepatocellular carcinoma. The high expression of NFKBIZ is positively correlated with the overall survival and disease-free survival of patients with hepatocellular carcinoma, and the high expression of NFKBIZ is negatively correlated with the recurrence rate, HBV infection rate, and tumor size of hepatocellular carcinoma.

[0012] The high expression of NFKBIZ is negatively correlated with the proliferation, invasion and migration abilities of hepatocellular carcinoma.

[0013] The high expression of NFKBIZ is negatively correlated with the expression of tumor markers; the low expression of NFKBIZ is negatively correlated with the expression of epithelial cell markers; the high expression of NFKBIZ is negatively correlated with the expression of p65, phosphorylated-p65, C-Myc, MMP9, CyclinD1 and BCL-2.

[0014] The high expression of TRIM16 is associated with poor prognosis, higher tumor grade and stage in HCC patients.

[0015] Further preferably, the drug comprises NFKBIZ, TRIM16, NF-κB, and a pharmaceutically acceptable carrier.

[0016] Compared with the prior art, the beneficial effects of the present invention are as follows:

[0017] This application finds that low levels of NFKBIZ in hepatoma cells of low HCC patients predict poor prognosis, and NFKBIZ regulates the proliferation and metastasis of HCC cells through the NFκB pathway. This application also finds that TRIM16 alleviates the inhibitory effect of NFKBIZ on HCC cells by increasing the ubiquitination of NFKBIZ. Overexpression of NFKBIZ enhances the apoptosis rate of HCC cells, and under sorafenib treatment, TRIM16 reduces this effect by promoting the degradation of NFKBIZ. These findings suggest the potential role of NFKBIZ as a new target for HCC treatment and prognosis, and its potential value as a key target for regulating the sensitivity of HCC to sorafenib. Brief Description of the Drawings

[0018] Figure 1A - D In it, A is the expression of NFKBIZ in LIHC (hepatocellular carcinoma) based on the GEPIA database (T: tumor, n = 369; N: normal liver, n = 160); B is the gene expression of NFKBIZ in LIHC at different stages in the TCGA database; C and D are the detection of the expression of NFKBIZ protein and mRNA in adjacent non-tumor (N) and HCC tissues (T) by Western blot (n = 12) and qRT-PCR (n = 28), respectively;

[0019] Figure 1E - G In it, E is the immunohistochemical analysis of the expression of NFKBIZ in adjacent non-tumor and primary HCC tissues (n = 102); F and G are the classification of HCC patients into low and high NFKBIZ groups (n = 51 in each group) according to the IHC score, and then the Kaplan-Meier survival is applied to evaluate the effect of NFKBIZ on OS (n = 102) and DFS (n = 102);

[0020] Figure 2A - E Among them, A is the expression of NFKBIZ in 5 HCC cell lines (n = 3 for each group); B is the expression of NFKBIZ in MHCC97H and Huh7 cells after transfection with Vector or NFKBIZ overexpression plasmid (n = 3 for each group); C is the expression of NFKBIZ in Huh7 and HepG2 cells after transient transfection with shNC, sh-NFKBIZ-1 (sh-1) and sh-NFKBIZ-2 (sh-2) plasmids for 48 h (n = 3 for each group); D and E are the absorbances of MHCC97H, Huh7 and HepG2 cells after CCK-8 assay at 24 h, 48 h, 72 h and 96 h respectively (n = 5 for each group).

[0021] Figure 2F - G Among them, F and G are the optical microscope images of colony formation of MHCC97H, Huh7 and HepG2 cells under different treatments, and the bar chart is the statistical situation of the number of colonies.

[0022] Figure 3A - B Among them, A and B are the scratched areas of MHCC97H and Huh7 cells transfected with Vector or NFKBIZ overexpression plasmid (A) or Huh7 and HepG2 cells transfected with shNC, sh-1 and sh-2 plasmids (B) photographed under an optical microscope at 0 h and 48 h (magnification 40x, n = 3 for each group).

[0023] Figure 3C - F Among them, C and D. Using an optical microscope, the Transwell experiment shows the effects of NFKBIZ overexpression or knockdown on the migration and invasion abilities of HCC cells (magnification 40x, n = 3 for each group); E and F are the expression levels of EMT-related proteins analyzed by Western blotting after overexpression or knockdown of NFKBIZ in MHCC97H, Huh7 and HepG2 cells for 48 h (****p < 0.0001, relative to a specific control group).

[0024] Figure 4A - F Among them, A and B are the in vivo tumor images of each group (n = 6) of BALB / c female nude mice (A) and the tumors formed by subcutaneous injection of MHCC97H or Huh7 cells (5x10 6Tumor nodules after 21 days with cells suspended in 100 μL PBS) (B) Representative figures, with tumor nodules expressing Vector (Vector group) on the left and tumor nodules with overexpressed NFKBIZ (NFKBIZ group) on the right in the same mouse; C is the tumor weight of mice in group A; D is the mRNA level of NFKBIZ in tumor tissues extracted from subcutaneous xenograft models of mice in each group in A; E and F are the expressions of NFKBIZ and PCNA in tumor tissues of subcutaneous xenograft models of mice in each group in A, respectively;

[0025] Figure 4G - J In, G and H are representative images of lung tissues with liver cancer lung metastases isolated and photographed 8 weeks after establishing a lung metastasis model in mice by injecting MHCC97H or Huh7 cells (5x10 6 cells suspended in 200 μL PBS) and statistical analysis of metastatic nodules in lung tissues (n = 8 for each group); I and J are representative H&E staining images (magnification 40 - 100x) of lung tissues in G and H, respectively;

[0026] Figure 5A - F In, A and B are the expressions of β-catenin, AKT / p-AKT, and NFκB proteins in MHCC97H and Huh7 cells transfected with Vector or NFKBIZ overexpression plasmids (A) or in Huh7 and HepG2 cells transfected with shNC, sh-1, or sh-2 plasmids (B) (n = 3 for each group) by Western blot analysis; C and D are the expressions of key targets in the NFκB signaling pathway in HCC cells treated the same as in A or B by Western blot analysis; E and F are the expressions of NFκB-targeted genes in HCC cells treated the same as in A or B by Western blot analysis, respectively;

[0027] Figure 5G - H In, G is the proliferation ability of MHCC97H and Huh7 cells (50 ng / mL, 24 h, n = 3) transfected with Vector or NFKBIZ overexpression plasmids with or without PMA treatment measured by CCK-8 assay,; H is the migration ability of HCC cells treated the same as in G, with representative images taken by optical microscope (magnification: 40x, PMA concentration: 50 ng / mL), and the histogram is its statistical analysis;

[0028] Figure 6A - BIn (figure), A shows the effect of NFKBIZ on HCC cell apoptosis in MHCC97H cells transfected with Vector or NFKBIZ overexpression plasmid, with or without sorafenib treatment (36 h, left, n = 3 per group), and the statistical chart of relative apoptosis rate (right); B shows the mRNA levels of NFKBIZ in MHCC97H or HepG2 cells treated with different concentrations of sorafenib (0, 1, 5, 10 μM) within 36 h (n = 3 per group), and the protein expression of NFKBIZ after 36 h at different sorafenib concentrations (0, 1, 5, 10 μM) in HCC cells (n = 3 per group).

[0029] Figure 6C - E In (figure), C shows the expression of NFKBIZ in MHCC97H and HepG2 cells treated with DMSO (0.1%), MG132 (50 ng / mL), and CQ (50 ng / mL) for 24 h (n = 3 per group); D shows MHCC97H and HepG2 seeded in 6-well plates, CHX added at time points 0, 2, 4, 6, 8, 10 h, and total proteins extracted from each group (n = 3 per group). The degradation trend of NFKBIZ in MHCC97H and HepG2 was shown by Western blot (left), and the line chart of NFKBIZ degradation was shown (right) (sorafenib concentration: 10 μM; CHX concentration: 50 ng / mL); E shows the Western blot results of NFKBIZ ubiquitination levels in HCC cells after adding different concentrations of sorafenib for 24 h (sorafenib concentrations: 0, 1, 5, 10 μM; CHX concentration: 50 ng / mL).

[0030] Figure 7A - F In (figure), A shows the expression of TRIM16 in MHCC97H and HepG2 cells treated with different sorafenib concentrations (0, 1, 5, 10 μM); B shows the gene expression of TRIM16 in liver cancer samples in the GEPIA database (T: tumor, n = 369; N: normal liver, n = 160); C and D respectively show that according to GEPIA data, with a threshold of 50%, HCC patients were divided into a low TRIM16 expression group and a high TRIM16 expression group (n = 162 per group), and the Kaplan–Meier analysis method was used to analyze the effect of TRIM16 on OS and DFS of liver cancer patients; E and F respectively show the gene expression of NFKBIZ in patients with different HCC grades and stages according to the UALCAN database.

[0031] Figure 7G - IIn it, G and H respectively detected the mRNA and protein expressions of TRIM16 in adjacent non-tumor and HCC tissues of patients by Western blotting (n = 12) and qRT-PCR (n = 15); I verified the expression of TRIM16 in adjacent non-tumor and HCC tissues by immunohistochemistry (n = 102, magnification: left figure 50x, right figure 200x);

[0032] Figure 8A - B, E In it, A was the Co-IP result presented by Western blotting, showing the interaction between TRIM16 and NFKBIZ. IB: HA was the co-precipitated HA-TRIM16 pulled down by anti-HA and IgG. IgG was rabbit IgG, and Anti-HA (1:500) was used to detect HA-TRIM16; IB: NFKBIZ was to detect NFKBIZ using the NFKBIZ antibody. IgG was the negative control. Input represented the whole cell lysate used in this experiment. Anti-HA (1:1000) was used to detect the transfection efficiency of TRIM16, and NFKBIZ (1:1000) was used to detect the abundance of NFKBIZ; B was the expression of NFKBIZ in HCC cells with or without overexpression of TRIM16 after treatment with DMSO (0.1%), MG132 (50 ng / mL), and CQ (50 ng / mL) for 24 h (n = 3 for each group); E was the expression of proteins related to apoptosis (Caspase3 / c-Caspase3, Survivin, BCL-2, and Bax) in HCC cells 48 h after transfection with HA-TRIM16 and sh-NFKBIZ (n = 3 for each group);

[0033] Figure 8C - D, F In it, C was the ubiquitination level of NFKBIZ in HCC cells with or without overexpression of TRIM16 when sorafenib was added or not; D was to detect the specific ubiquitination sites of NFKBIZ mediated by TRIM16; F was a schematic diagram of the research in this application;

[0034] Figure 9 In it, A was the distribution of p65 in the cytoplasm and nucleus after overexpression of NFKBIZ in MHCC97H and Huh7 cells;

[0035] Figure 10A and 10B were respectively the expressions of a series of TRIM family proteins (TRIM16, 9, 31, 28, 43, 63) in MHCC97H and Huh7 cells after treatment with different concentrations of sorafenib. Specific embodiments

[0036] Embodiments of the present invention will be described in detail below. Examples of the embodiments are shown in the accompanying drawings. The embodiments described below by referring to the accompanying drawings are exemplary and are intended to explain the present invention, and should not be construed as limiting the present invention.

[0037] I. Test method

[0038] NFKBIZ expression profile mining and bioinformatics analysis were performed in The Cancer Genome Atlas (TCGA). Relevant data or charts were downloaded from the TCGA database (http: / / cancergenome.nih.gov), and analysis was performed based on the Gene Expression Profiling Interactive Analysis database (GEPIA; http: / / gepia.cancer-pku.cn) and the UALCAN database (http: / / ualcan.path.uab.edu).

[0039] 1. Human cancer tissue samples and cell lines

[0040] A total of 102 pairs of human HCC tissue and paired non-tumor tissue samples were obtained. The above samples were randomly selected from hepatocellular carcinoma patients who underwent surgical treatment in a affiliated hospital in Zhengzhou. The above patients did not receive any radiotherapy or chemotherapy before surgical resection, and the patient information has been tracked since June 2018. The clinical information is shown in Table 4. All human HCC cell lines were derived from the Henan Organ Transplantation Research Center.

[0041] 2. Quantitative real-time polymerase chain reaction (qRT-PCR)

[0042] Total RNA of HCC cells and clinical tissue samples was extracted by Trizol, and mRNA was reverse transcribed into cDNA using Ⅲ FirstStrand cDNA Synthesis Kit. qRT-PCR was performed using 2x SYBR Green qPCR Master Mix and Rox. The mRNA expression level was calculated by the standard formula, 2-△△CT = (CT target - CTβ-actin) experimental group - (CT target - CTβ-actin) control group, to evaluate the fold change. All primer sequences used are summarized in Table 1.

[0043] Table 1 Primer sequences

[0044] Plasmid NFKBIZ F: ACACCCACAAACCAACTCTGG SUNYA, China N / A NFKBIZ R: GGCAAAACTGTGATTCTGGACC SUNYA, China N / A TRIM16F: GTCCTGTCTAACCTGCATGGT SUNYA, China N / A TRIM16R: GGCAGTATCGCCAGTTGTG SUNYA, China N / A TRIM28F: TTTCATGCGTGATAGTGGCAG SUNYA, China N / A TRIM28R: GCCTCTACACAGGTCTCACAC SUNYA, China N / A TRIM31F: AACCTGTCACCATCGACTGTG SUNYA, China N / A TRIM31R: TGATTGCGTTCTTCCTTACGG SUNYA, China N / A TRIM43F: AGGGAACCATCACCGAAAATG SUNYA, China N / A TRIM43R: TTGTTTGCCTATGGGTCCCAC SUNYA, China N / A TRIM63F: CTTCCAGGCTGCAAATCCCTA SUNYA, China N / A TRIM63R: ACACTCCGTGACGATCCATGA SUNYA, China N / A TRIM9 F: GTGTGCGGCTCCTTCTATCGA SUNYA, China N / A TRIM9 R: GCTGTATAGGCTCATCTTGTCCA SUNYA, China N / A GAPDH F: GTGGATATTGTTGCCATCAA SUNYA, China N / A GAPDH R: ATTCGTTGTCATACCAGGAA SUNYA, China N / A

[0045] 3. Western blotting

[0046] Tissues and cell proteins were lysed in RIPA buffer containing 1 mM PMSF (phenylmethylsulfonyl fluoride) and protein inhibitors, and then the samples were placed on ice for 30 min. The protein concentration was measured using a BCA protein assay reagent. Equal amounts of protein (10 μg / band) were separated by 10% SDS-PAGE, transferred to a PVDF membrane, and then blocked in 5% non-fat milk for 60 min. The membrane was incubated with specific antibodies overnight at 4 °C. The next day, the membrane was incubated with the corresponding anti-HRP antibody for 2 h at room temperature. Densitometric analysis was performed using Image J software. Details of all the antibodies used are shown in Table 2.

[0047] Table 2 Antibodies

[0048]

[0049]

[0050] 4. Transient and lentiviral transfection

[0051] MHCC97H, Huh7, and HepG2 cells (4x10 5 cells per well) were seeded into 6-well plates, and samples were collected 48 h after adding a mixture of plasmid and transfection reagent. Lentivirus packaging was performed using plasmids pCMV-dR8.91 and pCMV-VSV-G to achieve stable overexpression of NFKBIZ. The next day, HEK293 cells (3x10 5 cells per well) were seeded into 6-well plates until 90% confluence was reached. 48 h after transfection with pCMV-dR8.91, pCMV-VSV-G, and the target plasmid (2 μg of each plasmid), the supernatant was collected for infecting MHCC97H, Huh7, and HepG2 cells (MOI 40). After 24 h, the infected cells were screened and cultured in medium containing 1 μg / mL puromycin. Details of the drugs and packaging plasmids used are shown in Table 3. All experiments were performed in mycoplasma-free cells. All human cell lines have been verified by STR (or SNP) typing in the past three years.

[0052] Table 3 Drugs and packaging plasmids used

[0053]

[0054]

[0055] 5. Cell proliferation and apoptosis assays

[0056] MHCC97H, Huh7, and HepG2 cells (1x10 3Cells were transiently transfected in 96-well plates and cultured at 0, 24, 48, 72, and 96 h. Cell viability was analyzed by CCK-8. At the specified time points, the culture medium was replaced with fresh culture medium containing 10% CCK-8. After incubation at 37 ° C for 120 min, the absorbance was measured at a wavelength of 450 nm. Flow cytometry and Annexin V-APC / 7-AAD apoptosis detection kit were used to evaluate the apoptosis level of HCC cells.

[0057] 6. Colony Formation Assay

[0058] Transfected MHCC97H, Huh7 and HepG2 cells (1x10 3 Cells) were implanted into 6-well plates and cultured for 14 days (during the culture period, the culture medium was changed every 4 days). At the planned time point, the colonies were washed with PBS, fixed with 4% formalin for 20 min, stained with 0.1% crystal violet for 30 min, then washed with PBS and photographed.

[0059] 7. Wound healing assay

[0060] Transfected MHCC97H, Huh7 and HepG2 cells (4x10 6 Cells were seeded into 6-well plates and cultured overnight to about 90% confluence. A 200 μL sterile pipette tip was used to scratch the monolayer cells, and the cells were cultured in fresh medium without serum. The width of the scratch was captured and recorded at 0, 24 and 48 h. The area of ​​cell migration was measured using ImageJ software (v1.8.0).

[0061] 8. Cell migration and invasion assay (Transwell)

[0062] Transfected MHCC97H, Huh7 and HepG2 cells (2x10 5 cells) were seeded into the upper chamber of a cell culture insert with a polycarbonate filter membrane (pore size 8 μm, diameter 6.5 mm). 5 The cells were incubated with 200 μL of fresh serum-free medium in the upper chamber without Matrigel, while Matrigel was used in the invasion assay. 600 μL of DMEM containing 20% ​​FBS was added to the lower chamber. After 2 days, the non-migrated and non-invaded cells in the upper chamber were carefully wiped, while the migrated and invaded cells in the lower chamber were treated with 4% formalin and then stained with 0.1% crystal violet.

[0063] 9. Co-immunoprecipitation

[0064] The transfected MHCC97H, Huh7, and HepG2 cells were lysed on ice with IP lysis buffer. After 48 h, the lysates were centrifuged at 12,000 rpm for 10 min. A portion of the supernatant was taken as Input, and the rest was used for IP. Subsequently, the IP of each group was mixed with the primary antibody. Protein A and G agarose beads were washed three times with IP lysis buffer, and then 30 μL of beads was added to the mixture of each group. Then, the mixture was incubated overnight at 4 °C on a shaker. Finally, the beads of each group were collected, washed with IP lysis buffer, 2× loading buffer was added, and the mixture was heated at 100 °C for 10 min.

[0065] 10. Immunohistochemistry (IHC) and immunofluorescence experiments

[0066] Immunohistochemistry (IHC) experiments were performed on paraffin sections fixed with formalin. For immunofluorescence staining, MHCC97H and Huh7 cells (2×10 4 cells per group) were transfected with NFKBIZ overexpression or control plasmids and seeded on coverslips. After 48 h, the cells were washed twice with PBS and then fixed with 4% formalin for 20 min. Subsequently, the cells were blocked in PBS containing 0.5% Triton X-100 at room temperature for 20 min, and 5% BSA was added. The cells were incubated with p65 antibody (1:1000, 80979-1-RR, Proteintech, China) and a specific secondary antibody (Goat Anti-Rabbit IgG(H+L) Alexa Fluor 594). The cells were stained with 4,6-diamidino-2-phenylindole (DAPI) for 5 min and photographed with a fluorescence microscope.

[0067] 11. Subcutaneous xenograft tumor model and lung metastasis model

[0068] For the subcutaneous xenograft tumor model experiment, MHCC97H or Huh7 cells stably transfected with a lentiviral vector or overexpressing NFKBIZ were resuspended in 100 μL of PBS and subcutaneously injected into the backs of 4-week-old male nude mice. Specifically, mice in each group were injected with HCC cells stably expressing Vector on the left back and HCC cells stably overexpressing NFKBIZ on the right back. For the lung metastasis model, 5×10 6 HCC cells were injected into the tail vein in 200 μL of PBS. After 8 weeks, the mice were sacrificed to obtain lung tissues for counting lung metastasis nodules and H&E staining. All mice were randomly grouped by the random number method.

[0069] 12. Data analysis

[0070] All cell experiments were performed in triplicate. All statistical results were processed using GraphPad Prism 8.0. Data from the three independent replicates were presented as mean ± standard deviation. The statistical methods used in each experiment were described in the legend. The Mann-Whitney U test was used to evaluate the relationship between NFKBIZ expression and various clinicopathological parameters. Compared with the specific control group, differences with *p < 0.05, **p < 0.01, ***p < 0.001, and ****p < 0.0001 were considered significant.

[0071] II. Results and Analysis

[0072] 1. Influence of NFKBIZ Expression on the Prognosis of HCC Patients

[0073] The TCGA database was used to predict the NFKBIZ mRNA expression level in HCC samples. As shown in Figure 1A, NFKBIZ was significantly downregulated in HCC tissues compared with normal liver tissues. As shown in Figure 1B, NFKBIZ was negatively correlated with the HCC stage. As shown in Figures 1C and 1D, the protein and mRNA levels of NFKBIZ were consistently downregulated in HCC tissues. IHC experiments were performed on HCC tissue samples from 102 patients. As shown in Figure 1E, the expression of NFKBIZ in HCC tissues was decreased compared with adjacent non-tumor tissues. To clarify the clinical significance of NFKBIZ in HCC, patients were divided into a high-expression group and a low-expression group of NFKBIZ, and the cut-off point of H-SCORE was 50%. As shown in Figures 1F and 1G, HCC patients with high NFKBIZ expression had significantly prolonged overall survival (OS) and disease-free survival (DFS).

[0074] Table 4 Domestic Information and Clinicopathological Characteristics of HCC Patients

[0075]

[0076]

[0077] As shown in Table 4, the analysis of clinicopathological characteristics showed that high NFKBIZ expression was significantly associated with a reduced HCC recurrence rate, a lower HBV infection rate, and a smaller tumor size. The above results indicated that NFKBIZ was downregulated in HCC cells and suggested that NFKBIZ might be associated with the progression of HCC.

[0078] 2. Influence of NFKBIZ on the Proliferation, Metastasis, and EMT Process of HCC Cells

[0079] To investigate the effect of NFKBIZ on the progression of HCC, the expression of NFKBIZ in HCC cell lines was evaluated. As shown in Figure 2A, the expression of NFKBIZ was the lowest in MHCC97H cells, the highest in HepG2 cells, and relatively average in Huh7 cells. Therefore, NFKBIZ overexpression was performed in MHCC97H and Huh7 cells, while NFKBIZ silencing was performed in Huh7 and HepG2 cells. As shown in Figures 2B and 2C, stable NFKBIZ overexpression was successfully established in MHCC97H and Huh7 cells, and transient silencing of NFKBIZ was established in Huh7 and HepG2 cells. As shown in Figures 2D and 2F, the rates of cell growth and colony formation in HCC cells with NFKBIZ overexpression were significantly slowed down, indicating that proliferation was inhibited. In contrast, NFKBIZ silencing significantly enhanced the proliferation of HCC cells, with an accelerated formation rate and larger colonies (Figures 2E and 2G). In summary, NFKBIZ can regulate the in vitro proliferation ability of HCC cells.

[0080] To investigate the effect of NFKBIZ on the migration and invasion of HCC, a scratch wound healing assay was performed. Compared with the Vector group, the enhanced rate of the healing area of HCC cells with NFKBIZ overexpression was slower (Figure 3A), which was consistent with the results of the Transwell migration assay (Figure 3C). In contrast, the migration rate of HCC cells with NFKBIZ silencing was significantly higher than that of the shNC group (Figure 3B), which was consistent with the results of the Transwell migration assay (Figure 3D). The Transwell invasion assay showed that NFKBIZ overexpression inhibited the invasion ability of HCC cells, while NFKBIZ silencing had the opposite effect. Then, the relationship between NFKBIZ and epithelial-mesenchymal transition (EMT) was investigated. EMT is closely related to tumor metastasis and invasion. In HCC cells with high expression of NFKBIZ, the expression of some matrix markers such as N-cadherin, vimentin, and snail decreased (Figure 3E). When NFKBIZ was silenced, the expression level of the epithelial cell marker E-cadherin increased (Figure 3F). Therefore, NFKBIZ may regulate the metastatic ability of HCC by altering EMT.

[0081] 3. NFKBIZ inhibits the growth and metastasis of hepatocellular carcinoma cells in vivo

[0082] To verify the effect of NFKBIZ on in vivo tumor formation, MHCC97H and Huh7 cells stably expressing Vector and NFKBIZ were subcutaneously injected into the left and right backs of nude mice, respectively, to construct xenograft mouse models. Compared with the tumor tissues on the left (Vector group), the tumor tissues on the right (NFKBIZ group) showed smaller tumor size and weight (Figure 4A - 4C). As shown in Figures 4D and 4E, the mRNA and protein levels of NFKBIZ in the NFKBIZ group were significantly higher than those in the Vector group. Proliferating cell nuclear antigen (PCNA) is a marker reflecting the cell proliferation status. As shown in Figures 4E and 4F, the expression of PCNA in the NFKBIZ group was significantly weaker, confirming the inhibitory effect of NFKBIZ on the growth of HCC cells. To verify the effect of NFKBIZ on the in vivo metastasis of HCC, the same number of MHCC97H and Huh7 cells stably expressing Vector and NFKBIZ were respectively injected into the tail veins of nude mice to construct a lung metastasis model. As shown in Figures 4G - 4J, in the NFKBIZ group, the number of lung metastasis nodules was significantly reduced. It was demonstrated that NFKBIZ effectively inhibited the growth and metastasis of HCC cells in vivo.

[0083] 4. NFKBIZ mediates HCC progression by regulating NF-κB signaling

[0084] To explore the potential mechanism by which NFKBIZ regulates HCC progression, the involvement of the Wnt / β-catenin, PI3K / AKT, and NF-κB signaling pathways was investigated. Western blot results showed that in HCC cells with overexpressed NFKBIZ, the expression levels of p65 and its active form phosphorylated-p65 (p-p65) were decreased. The regulation of NFKBIZ expression did not affect the expression of β-catenin, AKT, and phosphorylated-AKT (p-AKT) (Figures 5A and 5B). However, when NFKBIZ was regulated, the protein expressions including IKKα, IKKβ, IκBα, and p-IκBα remained unchanged (Figures 5C and 5D).

[0085] To clarify the effect of NFKBIZ on NF-κB signaling, protein expression was investigated. As shown in Figures 5E and 5F, in HCC cells with overexpressed NFKBIZ, the expressions of C-Myc, MMP9, CyclinD1, and BCL-2 were decreased, while the opposite was true when NFKBIZ was silenced. Therefore, NFKBIZ inhibited the expression of NF-κB downstream genes by binding to NF-κB in the nucleus. Through immunofluorescence experiments, it was found that in HCC cells with overexpressed NFKBIZ, compared with the Vector group, the abundance of p65 in the cytoplasm and nucleus was decreased ( Figure 9)。The effect of NFKBIZ was examined using PMA (an NF-κB agonist) to check whether it could be reversed. As shown in Figures 5G and 5H, under PMA treatment, the inhibitory effects of NFKBIZ overexpression on HCC cell growth and migration were eliminated. In summary, the elevated expression of NFKBIZ can inhibit the NF-κB pathway, thus potentially improving the progression of HCC.

[0086] 5. Effect of sorafenib on the protein degradation of NFKBIZ in HCC cells

[0087] Flow cytometry was used to measure the apoptosis levels of HCC cells in the NFKBIZ and Vector groups with or without sorafenib treatment. The results showed that when NFKBIZ was overexpressed, the apoptosis level of HCC was significantly increased. Sorafenib treatment accompanied by NFKBIZ overexpression did not further exacerbate the apoptosis of HCC cells (Figure 6A). In HCC cells treated with sorafenib, the mRNA level of NFKBIZ increased with the increase in sorafenib concentration. However, the protein level showed the opposite trend, indicating that it may be regulated by specific post-translational modifications (Figure 6B).

[0088] As is well known, the forms of protein degradation include the ubiquitin-proteasome pathway and the autophagy-lysosome pathway. To verify the NFKBIZ protein degradation pathway, the expression of NFKBIZ in MHCC97H and HepG2 cells was detected after treatment with DMSO, MG132 (an inhibitor of the 26S ubiquitin-proteasome pathway), and CQ (an inhibitor of lysosomal activity), respectively. The reversal of NFKBIZ protein degradation was observed in HCC cells with the inhibition of the ubiquitin-proteasome pathway (Figure 6C). When sorafenib was added to HCC cells, the degradation of NFKBIZ increased (Figure 6D). In addition, the ubiquitination of NFKBIZ was enhanced in HCC cells treated with sorafenib (Figure 6E). In summary, HCC cells may counteract the sensitivity to the anti-tumor drug sorafenib by increasing the ubiquitination degradation of NFKBIZ.

[0089] 6. TRIM16 interacts with NFKBIZ and enhances its ubiquitination to attenuate HCC cell apoptosis

[0090] To identify the potential upstream targets of NFKBIZ, TRIMs were screened through the TCGA database, and according to their expression levels in HCC tissues, TRIM9, TRIM16, TRIM28, TRIM31, TRIM43, and TRIM63 were determined to be the target genes highly expressed in HCC. Among them, only the expression level of TRIM16 in MHCC97H and HepG2 increased steadily with the increase in sorafenib concentration (Appendix Figure 10A and 10B)。Western blot results verified that the protein level of TRIM16 seemed to show the same trend as the mRNA level (Figure 7A and 7B). It was found that TRIM16 was upregulated in HCC tissues, and its high expression was associated with poor prognosis, higher tumor grade and stage in HCC patients (Figure 7C - 7F). As shown in Figure 7G - 7I, compared with adjacent non-tumor tissues, the expression of TRIM16 in HCC tissues was significantly increased.

[0091] To verify whether TRIM16 could act as an upstream E3 ubiquitin ligase of NFKBIZ, a CO-IP experiment was conducted, and the results showed that TRIM16 interacted with NFKBIZ (Figure 8A). It was further found that overexpression of TRIM16 regulated the ubiquitination and degradation of NFKBIZ (Figure 8B). Whether sorafenib was used or not, TRIM16 could directly mediate the ubiquitination of NFKBIZ, and this regulatory effect was further enhanced under sorafenib treatment (Figure 8C). As shown in Figure 8D, the ubiquitination of NFKBIZ mediated by TRIM16 occurred at its K48 site rather than other sites. To clarify the regulatory role of TRIM16 / NFKBIZ in HCC cell apoptosis, TRIM16 overexpression or / and sh-NFKBIZ plasmids were transfected into HCC cells. As shown in Figure 8E, in HCC cells transfected with sh-NFKBIZ, the expression of pro-apoptotic proteins including Caspase3 / c-Caspase3 and Bax increased, while the expression of anti-apoptotic markers (Survivin and BCL-2) was inhibited. This phenomenon also occurred in HCC cells transfected with TRIM16 overexpression plasmids, probably due to the increased degradation of NFKBIZ through direct interaction with TRIM16. In addition, the expression of TRIM16 increased in HCC cells under sorafenib treatment, which might reduce the abundance of NFKBIZ and further hinder cell apoptosis (Figure 8E). Mechanistically, TRIM16 could promote the ubiquitination of NFKBIZ and exacerbate the development of HCC, which might be a potential mechanism for sorafenib insensitivity in clinical treatment of HCC (Figure 8F).

[0092] Flow cytometry, protein degradation experiments and co-immunoprecipitation results showed that TRIM16 could enhance the ubiquitination of NFKBIZ by directly interacting with its K48 site, thereby weakening the sensitivity of HCC cells to sorafenib. Studies have shown that NFKBIZ regulated the tumor growth and metastasis of HCC by mediating NF-κB signaling, and the TRIM16 / NFKBIZ / NF-κB axis might be a potential mechanism for sorafenib insensitivity in HCC.

[0093] Although the embodiments of the present invention have been shown and described above, it can be understood that the above embodiments are exemplary and should not be construed as limiting the present invention. Those of ordinary skill in the art can make changes, modifications, substitutions, and variations to the above embodiments within the scope of the present invention.

Claims

1. Application of the TRIM16 / NFKBIZ / NF-κB axis in the preparation of a diagnostic product or therapeutic drug for hepatocellular carcinoma, wherein NFKBIZ regulates the transduction of downstream NF-κB signals by interacting with TRIM16.

2. Use of the TRIM16 / NFKBIZ / NF-κB axis according to claim 1 in hepatocellular carcinoma, characterized in that, Overexpression of TRIM16 regulates the ubiquitination and degradation of NFKBIZ.

3. Use of the TRIM16 / NFKBIZ / NF-κB axis according to claim 2 in the preparation of a diagnostic product or therapeutic drug for hepatocellular carcinoma, characterized in that, TRIM16 enhances the ubiquitination of NFKBIZ by directly interacting with the K48 site of NFKBIZ, reducing the sensitivity of hepatocellular carcinoma cells to sorafenib.

4. Use of the TRIM16 / NFKBIZ / NF-κB axis according to claim 3 in the preparation of a diagnostic product or therapeutic drug for hepatocellular carcinoma, characterized in that, NFKBIZ binds to NF-κB in the nucleus to regulate the growth and migration of hepatocellular carcinoma mediated by downstream NF-κB signal transduction, and the TRIM16 / NFKBIZ / NFκB is associated with the sensitivity of hepatocellular carcinoma to sorafenib.

5. Use of the TRIM16 / NFKBIZ / NF-κB axis according to claim 4 in the preparation of a hepatocellular carcinoma diagnostic product or therapeutic drug, characterized in that, NFKBIZ is negatively correlated with the progression of hepatocellular carcinoma. High expression of NFKBIZ is positively correlated with the overall survival and disease-free survival of patients with hepatocellular carcinoma, and high expression of NFKBIZ is negatively correlated with the recurrence rate, HBV infection rate, and tumor size of hepatocellular carcinoma.

6. Use of the TRIM16 / NFKBIZ / NF-κB axis according to claim 4 in the preparation of a diagnostic product or therapeutic drug for hepatocellular carcinoma, characterized in that, High expression of NFKBIZ is negatively correlated with the proliferation, invasion, and migration abilities of hepatocellular carcinoma.

7. Use of the TRIM16 / NFKBIZ / NF-κB axis according to claim 4 in the preparation of a diagnostic product or therapeutic drug for hepatocellular carcinoma, characterized in that, High expression of NFKBIZ is negatively correlated with the expression of tumor markers; low expression of NFKBIZ is negatively correlated with the expression of epithelial cell markers; high expression of NFKBIZ is negatively correlated with the expression of p65, phosphorylated-p65, C-Myc, MMP9, CyclinD1, and BCL-2.

8. Use of the TRIM16 / NFKBIZ / NF-κB axis according to claim 4 in the preparation of a diagnostic product or therapeutic drug for hepatocellular carcinoma, characterized in that, High expression of TRIM16 is associated with poor prognosis, higher tumor grade and stage in HCC patients.

9. Use of the TRIM16 / NFKBIZ / NF-κB axis according to any one of claims 1 to 8 in the preparation of a hepatocellular carcinoma diagnostic product or therapeutic drug, characterized in that, The drug includes NFKBIZ, TRIM16, NF-κB, and a pharmaceutically acceptable carrier.