B-type haemophilus paragallinarum and application thereof
By using the inactivated vaccine prepared by Haemophilus parachycephala XXHp2408B1, the problem of poor prevention and treatment of Haemophilus parachycephala B is solved, effective immune protection against adult chickens is achieved, and morbidity and mortality are reduced.
Patent Information
- Application Number
- CN202510293699.3
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-03-13
- Publication Date
- 2025-07-04
AI Technical Summary
The existing vaccines have poor control and treatment of Haemophilus parachyxae, resulting in a high incidence of infectious rhinitis in chickens and serious economic losses.
A strain of Haemophilus parachyx XXHp2408B1 was provided. After propagation, pure testing and inactivated, it was added to the water-in-oil-in-oil adjuvant for livestock and poultry, Summit S550, to prepare an inactivated vaccine to prevent Haemophilus parachyx infection.
The prepared inactivated vaccine has good immune protection effect. When the immune dose is 0.1mL, it can significantly reduce the incidence and mortality of adult chickens, with high safety and significant immune protection effect.
Smart Images
Figure CN120249107A_ABST
Abstract
Description
Technical Field
[0001] The present invention belongs to the technical field of microbiology, and particularly relates to a strain of Haemophilus paragallinarum serotype B and its application. Background Art
[0002] Haemophilus paragallinarum (HPg) is a Gram-negative facultative anaerobe of the genus Avibacterium in the family Pasteurellaceae. It is polymorphic, being coccobacillus in young age. It is the pathogen of Infectious coryza (Ic) in chickens. This bacterium often causes acute or subacute respiratory diseases in chickens, which can occur in chickens of all ages. The main symptoms are inflammation of the nasal cavity and infraorbital sinus, and the clinical manifestations are bilateral or unilateral swelling of the face, runny nose, dyspnea and conjunctivitis. It mainly harms growing chickens and laying hens, can reduce the egg production of laying hens, impede the growth of broilers and degrade the meat quality. The incidence rate is high while the mortality rate is low, causing great economic losses to the chicken farming industry.
[0003] This disease is widely distributed all over the world. Beach first reported this disease in 1920, and then De Bliekc first isolated Haemophilus paragallinarum. In 1987, Haemophilus paragallinarum was first isolated in Beijing in China. Subsequently, there were reports of isolation of this bacterium in Hebei, Liaoning, Shandong and other places. At present, this bacterium is widespread or epidemic in most chicken farms in China. Haemophilus paragallinarum has multiple serotypes. According to the slide agglutination test, this bacterium can be divided into three serotypes: A, B, and C. Some studies have shown that there is cross-protection among the same serotypes, and there is no cross-protection among different serotypes. The incidence rate of this disease is high, and adult chickens are more susceptible than chicks. The mortality rate generally does not exceed 20%. The economic losses mainly come from the increased culling rate and the decreased egg production. The incubation period of Infectious coryza in chickens is relatively short, the transmission is fast, the incidence rate can reach 20% - 50%, and the mortality rate is generally 5% - 20%. However, when complicated with other infectious diseases, the course of the disease will be prolonged and the death and culling rate will increase significantly. Bacterin immunization is an important prevention and control measure for this disease. At present, the bacterins used for the prevention of Infectious coryza in chickens on the market are all inactivated vaccines, which can be divided into monovalent vaccines, bivalent vaccines and trivalent vaccines according to the different serotypes of the pathogenic bacteria used, and the application effects vary. In the past two years, the clinical isolation rate of Haemophilus paragallinarum serotype B has been high, and it has become the current prevalent dominant serotype, causing relatively serious harm in production. There is an urgent need for a new bacterin prepared from a strain with safety and good immunogenicity to prevent and control the currently prevalent dominant pathogenic bacteria. Summary of the Invention
[0004] Aiming at the defects and problems of the poor prevention and control effect of the current existing vaccines on the currently prevalent dominant pathogenic bacteria, the present invention provides a strain of Haemophilus paragallinarum and its application.
[0005] The present invention provides a strain of Haemophilus paragallinarum, which is Haemophilus paragallinarum XXHp2408B1. Its deposit number is CGMCC No: 46208, the deposit date is October 31, 2024, the deposit unit is the General Microbiology Center of the China Committee for Culture Collection of Microorganisms, and the deposit address is No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing.
[0006] The above-mentioned Haemophilus paragallinarum XXHp2408B1 is Haemophilus paragallinarum serotype B.
[0007] The above-mentioned Haemophilus paragallinarum XXHp2408B1 was isolated from the infraorbital sinus secretions of adult laying hens with facial swelling and typical respiratory symptoms.
[0008] The present invention also provides the application of Haemophilus paragallinarum in the preparation of inactivated vaccines against Haemophilus paragallinarum.
[0009] For the above-mentioned application, the inactivated vaccine is prepared by propagating the Haemophilus paragallinarum XXHp2408B1 as described in claim 1, performing purity inspection, inactivating it, and then adding an adjuvant.
[0010] For the above-mentioned application, the adjuvant is the oil-in-water-in-water adjuvant Summit S550 for livestock and poultry.
[0011] For the above-mentioned application, the bacterial count of Haemophilus paragallinarum XXHp2408B1 in the inactivated vaccine is 1 - 2×10 9 CFU / mL.
[0012] For the above-mentioned application, the bacterial count of inactivated Haemophilus paragallinarum XXHp2408B1 in the inactivated vaccine is 1×10 9 CFU / mL.
[0013] For the above-mentioned application, the preparation method of the inactivated vaccine includes the following steps:
[0014] (1) Primary seed propagation: Streak-inoculate the freeze-dried strain of Haemophilus paragallinarum XXHp2408B1 onto a TSA plate solid medium with an inoculation loop, culture it in an incubator at 37°C and 5% CO2 for 24 - 36 h, pick typical colonies, and then subculture and inoculate onto a TSA plate, culture it in an incubator at 37°C and 5% CO2 for 24 h. After passing the inspection, it is used as the primary seed;
[0015] (2) Secondary seed propagation: Inoculate the primary seed into a TSB liquid medium, culture it in a medium-speed shaker at 37°C. After 18 - 24 h, observe that the culture becomes turbid and then collect it. After passing the purity inspection, it is used as the secondary seed;
[0016] (3) Bacterial liquid preparation: Inoculate the secondary seeds at 1% respectively into the TSB liquid medium, and culture them by shaking at 37 °C in a medium-speed shaker for 18 - 24 h to harvest the bacterial liquid;
[0017] (4) Viable bacteria counting: Use a TSA medium shake flask containing 5% newborn bovine serum and 0.01% NAD for culture, conduct viable bacteria counting, measure the culture concentration, and adjust the number of Haemophilus paragallinarum bacteria in the culture to 2×10 9 CFU / mL;
[0018] (5) Inactivation and inspection of the bacterial liquid: Add 2 mL of formaldehyde solution to every 1000 mL of the culture, mix quickly, and place it in a 37 °C water bath or incubator for inactivation for 48 h to obtain the original bacterial vaccine; Use a sterile pipette to suck 0.1 mL of the inactivated bacterial liquid and evenly spread it by streaking on a TSA solid medium, and culture it in a 37 °C, 5% CO₂ incubator for 48 h. If no bacteria grow, it is qualified;
[0019] (6) Bacterial vaccine preparation: Mix an adjuvant with a volume of 60% of the bacterial liquid and sterile physiological saline with a volume of 40% of the bacterial liquid, and then add the original bacterial vaccine liquid, mix evenly to obtain an inactivated Haemophilus paragallinarum bacterial vaccine with a final concentration of 1×10 9 CFU / mL.
[0020] Compared with the prior art, the beneficial effects of the present invention are:
[0021] 1. The Haemophilus paragallinarum XXHp2408B1 isolated in the present invention is isolated from the infraorbital sinus secretion of adult laying hens with facial swelling and typical respiratory symptoms. It grows well when isolated on a TSA solid medium, and no other bacteria grow. It stably proliferates in the TSB liquid medium and has a high titer.
[0022] 2. The Haemophilus paragallinarum strain XXHp2408B1 isolated in the present invention has stable biological characteristics, has strong pathogenicity to adult chickens, can cause adult chickens to become ill and die, and has good immunogenicity.
[0023] 3. The inactivated vaccine prepared using the Haemophilus paragallinarum strain XXHp2408B1 isolated in the present invention has excellent immune protection effects, and has good protective effects even when the immune dose is 0.1 mL. Description of the Drawings
[0024] Figure 1 It is the colony morphology of strain XXHp2408B1.
[0025] Figure 2 It is the 10×100 morphology of strain XXHp2408B1 under a Gram stain microscope.
[0026] Figure 3PCR identification results of strain XXHp2408B1. In the figure, M is Marker DL 2000bp; 1 is the amplification result of the universal primer, 2 is the amplification result of primer type A, 3 is the amplification result of primer type B, and 4 is the amplification result of primer type C. Detailed implementation mode
[0027] The present invention will be further described below in conjunction with the accompanying drawings and embodiments.
[0028] Example 1: Isolation and identification of Haemophilus paragallinarum
[0029] 1. Collection of diseased materials
[0030] The diseased materials were from the infraorbital sinus secretions of suspected adult laying hens sent for inspection from a large-scale laying hen farm in Xinxiang City in August 2024. The diseased chickens had swollen facial areas and typical respiratory symptoms.
[0031] 2. Preparation of culture media
[0032] TSA solid medium: Dissolve 40 g of TSA agar powder (Tryptic Soy Agar) in 1000 mL of ultrapure water, sterilize at 110 °C under high pressure for 20 min, add 2 mL of 1% NAD (coenzyme I, nicotinamide adenine dinucleotide) and 50 mL of cow serum, dispense into petri dishes and store at 4 °C for later use.
[0033] TSB liquid medium: Dissolve 35 g of TSB broth powder (Tryptic Soybroth) in 1000 mL of ultrapure water, sterilize at 110 °C under high pressure for 20 min, aseptically add 2 mL of 1% NAD and 50 mL of cow serum, dispense and store refrigerated for later use.
[0034] 3. Isolation and culture of the strain
[0035] Autopsy the diseased chickens, aseptically collect their infraorbital sinus and nasal secretions, streak inoculate them on the TSA petri dish solid medium with an inoculation loop, and culture them in an incubator at 37 °C and 5% CO2 for 24 - 36 h. Small colonies with a size of about 1 mm, like needle tips, dewdrop-like, translucent, grayish-white, smooth and moist grow, as Figure 1 shown. After staining with the Gram staining method and examining under a 10×100 oil immersion microscope, as Figure 2 shown, Gram-negative bacteria with different morphological forms such as coccobacilli, bacilli, and slender filaments can be seen, and it is named strain XXHp2408B1.
[0036] 4. Identification of the strain
[0037] (1) Primer design
[0038] A pair of universal primers was designed according to the 16S rRNA gene sequence of Haemophilus paragallinarum for the amplification of Haemophilus paragallinarum. The primer sequences are the upstream primer P1 and the downstream primer P2.
[0039] P1: 5’-TGAGGGTAGTCTTGCACGCGAAT-3’ (SEQ ID NO.1);
[0040] P2: 5’-CAAGGTATCGATCGTCTCTCTACT-3’ (SEQ ID NO.2);
[0041] The expected amplified fragment size is 500 bp.
[0042] Three pairs of typing primers for Haemophilus paragallinarum were designed for the hmtp210 gene. The common upstream primer F and the downstream typing primers R are as follows:
[0043] Common upstream typing primer F: 5’-ATTCGGATACCTCAATGACAG-3’ (SEQ ID NO.3);
[0044] Downstream primer AR for type A: 5’-AAGCCAGCGTAGTTAGTTG-3’ (SEQ ID NO.4), 781 bp;
[0045] Downstream primer BR for type B: 5’-CGCAAGAGTAATCGCATCT-3’ (SEQ ID NO.5), 1037 bp;
[0046] Downstream primer CR for type C: 5’-TACCGCCAGCGATGATAT-3’ (SEQ ID NO.6), 1437 bp.
[0047] (2) PCR identification
[0048] The column method DNA extraction kit was used to extract the strain DNA, and the DNA concentration was determined by a spectrophotometer to be 100 μg / mL.
[0049] The PCR amplification reaction system was 50 μl:
[0050]
[0051]
[0052] Reaction conditions: Denaturation at 94 °C for 5 min, enter the cycle: 94 °C for 30 s, 55 °C for 30 s, 72 °C for 30 s, a total of 35 cycles, and finally extension at 72 °C for 10 min. Take the PCR product and perform electrophoresis on 1.0% agarose gel. After recovery of the PCR product, it was sequenced.
[0053] Add 10 μL of the amplification product to each well, perform electrophoresis using 1% agarose gel, and observe the electrophoresis results of the product under ultraviolet light. As Figure 3 shown, it shows that fragments of 500 bp and 1037 bp are amplified, proving that the amplified fragments are the target fragments and conforming to the expected designed size. After the PCR amplification product is recovered, it is sequenced, and the sequence is as follows:
[0054] TCGGAGGTGTTATCCGCTTTTAAGGCTATGCCCGATTTAGTTACTTCAACGTGTTCTGCATTTTCCGCACCGATAGATAATTTTGTCGGGGCTAATTTGCTTTCATCGCTGCCATTTTTCACCGAGAAGCCATCACGACTTACTTTCACTAAGTTTGTTTGAGCAGAATTTGTTGTGCTATCAATGGTTAAGCCATCTTCTGCAAAAGTGGTGGTTGAACCATTTGTTGTGTCGCCTTTTTTGAAGGTTAAACCCGCACTGCTCATTCTGCCCGTAACTTGATTTGGAGCTTGCCCTGACTTATCAAAGGTAATGCTGTTTACCCCTTCAATGTCTTTCATTAAGCCGACAGTGAAGGTTTTTTTCTTGTTGTTATCGGTAGAAGACTCAACTGTGATCGGTGAATTTGCTTTTTTCACCACATCCACCAAGCCAGTAATGCCTTTGTTGGCTTCTGCTGAAACCGTTGGTTTTGCACCTTTAAGTGGTTCATAGACAGCTTCCCCTGACACCACTTCTTCTTCTGTTGCCGAAAGCGAGATCAATTTGGTGAGAACATTATTAATCGCATCGTGGATTGTATCTTGCCCTGTGCCGCCAATATTTGTAAATGTAATTGTGCCATCAGTGGCAAGATTTGCATTGCCACCAAAGTTGTTCTTAACAGATTGAGCCACTTTGCTCAACATAAAGTTCGTTGCATAAAGCTGTGAGCCGTTAATGGCTTCAGTAGAAGCTTGCGAAACATCGCCTGCTGCAACATTAACAATTTTACGCTCTTTCCCAGCCGTTCCGATACTTAACACACCGAGTGTTTCAGGGGAACCTGCAAAATTATTGAATATTAAACCATTTATCATCGGTGAACTTGTACGGCTAATTGCGGAATTGGCAACCGTCGAATCTTGCCCCAATGCAATGGAAGGTTTTCCACCCGCAGTAACC(SEQ ID NO.7).
[0055] The obtained sequence was aligned and analyzed with the 16S rRNA and hmtp210 genes of other Haemophilus paragallinarum reference strains in the GenBank database. The sequencing result showed 98.94% homology with the Haemophilus paragallinarum serotype B reference strain VRDC / AVpg / H40, indicating that this isolated strain XXHp2408B1 is Haemophilus paragallinarum serotype B.
[0056] (3) Serotype identification
[0057] Using the slide agglutination test method, the purified XXHp2408B1 strain was subjected to agglutination tests with the standard positive sera of Haemophilus paragallinarum serotypes A, B, and C. The result showed agglutination with the standard positive serum of Haemophilus paragallinarum serotype B within 2 - 3 minutes, and no agglutination with the standard positive sera of Haemophilus paragallinarum serotypes A and C. At the same time, both the positive control and the negative control were valid, proving that this strain is Haemophilus paragallinarum serotype B.
[0058] (4) Virulence test
[0059] Thirty 90 - day - old healthy chickens were selected as experimental animals and randomly divided into two equal groups, with 15 in the experimental group and 15 in the control group.
[0060] XXHp2408B1 was inoculated into a 20 - mL closed centrifuge tube containing TSB liquid medium and cultured at 37°C in a medium - speed shaker for 24 h. The bacterial suspension was diluted 10 - fold and evenly spread on a flat glass slide, and viable bacteria were counted under a low - power microscope to determine the bacterial concentration, and the original bacterial concentration of the culture was restored. The bacterial concentration was adjusted to 10 8 CFU / mL. Each chicken in the experimental group was instilled with 0.1 mL of the adjusted bacterial suspension into the nasal cavity, and each chicken in the control group was instilled with 0.1 mL of TSB liquid medium into the nasal cavity. They were fed separately at intervals of 1 - 2 weeks, and the morbidity, casualties, etc. of the two groups were observed and recorded.
[0061] The chickens in the experimental group showed clear nasal discharge, coughing and sneezing, and their nostrils were covered with feed particles 48 h after inoculation with the bacterial suspension. After 1 - 2 days, the nasal discharge became thick, and they showed open - mouth breathing. Gradually, unilateral eyelid and infraorbital sinus swelling occurred, and some nostrils were filled with purulent cheesy substances with a foul smell. In the long - course cases, there was listlessness, a significant decrease in feed intake, the feathers became fluffy and lost luster, the eyes were closed and the wings were drooping, and some chickens tucked their heads under their wings and squatted motionless in a corner of the cage. Deaths occurred 3 days later, and most of the course was 1 - 2 weeks. In some cases, the inflammation spread to the lower respiratory tract, with snoring and rales, and some finally suffocated to death. Six chickens survived after 2 weeks, showing emaciation and growth retardation. The chickens in the control group had normal body temperature and spirit within 2 weeks of the experiment, and no obvious respiratory symptoms such as runny nose, cough, and snoring were observed.
[0062] During the experiment, the dead chickens were dissected in time, and the diseased materials and bacterial cultures were retained. After 2 weeks, the surviving chickens in the experimental group and the chickens in the control group were dissected. At the same time, diseased materials such as the infraorbital sinus and trachea were collected for the culture and isolation of Haemophilus paragallinarum.
[0063] Upon dissection of the chickens in the experimental group, it was found that there was subcutaneous edema in the face and wattles, the serosa was congested and swollen, the infraorbital sinus and nasal cavity showed catarrhal inflammation, the mucosa was congested and swollen, and a large amount of yellowish-white viscous fluid was attached to it. There were caseous clots and necrotic substances formed by exudate in the infraorbital sinus. No typical obvious macroscopic lesions were found upon dissection of the chickens in the control group. Through bacterial isolation and culture, Haemophilus paragallinarum was isolated from more than 10 tissues such as the infraorbital sinus of the chickens in the experimental group. After PCR amplification, the results of the gel electrophoresis image were consistent with the XXHp2408B1 band, while no similar Haemophilus paragallinarum colonies were cultured from 10 randomly cultured diseased materials such as the infraorbital sinus in the control group. Based on the comprehensive virulence test results, it was proved that this bacterium has strong pathogenicity and stability.
[0064] Example 2: Preparation and inspection of the vaccine
[0065] 1. Vaccine preparation
[0066] (1) Strain preparation
[0067] Primary seed propagation: Streak-inoculate the freeze-dried XXHp2408B1 strain onto a TSA petri dish solid medium with an inoculation loop, and culture it in an incubator at 37°C and 5% CO2 for 24 - 36 h. Pick typical colonies and then subculture and inoculate them onto a TSA plate, and culture it in an incubator at 37°C and 5% CO2 for 24 h. After passing the inspection, it is used as the primary seed.
[0068] Secondary seed propagation: Inoculate the primary seed into a TSB liquid medium, place it in a medium-speed shaker and culture it at 37°C. After 18 - 24 h, observe that the culture becomes turbid and then collect it. After passing the purity inspection, it is used as the secondary seed.
[0069] (2) Bacterial liquid preparation
[0070] Inoculate the secondary seed into a TSB liquid medium containing 1% respectively, and culture it in a medium-speed shaker at 37°C with shaking for 18 - 24 h, and harvest the bacterial liquid.
[0071] (3) Viable count
[0072] According to the method in the appendix of the current "Chinese Veterinary Pharmacopoeia", use a TSA medium containing 5% newborn bovine serum and 0.01% NAD suitable for the growth of this bacterium for shake flask culture for viable count, measure the concentration of the culture, and adjust the number of Haemophilus paragallinarum bacteria in the culture to 2×10 9 CFU / mL.
[0073] (4) Inactivation and inspection of the bacterial liquid
[0074] Add 2 mL of formaldehyde solution to every 1000 mL of the culture, mix well quickly, and inactivate it in a 37 °C water bath or incubator for 48 h to obtain the original bacterial vaccine solution. Use a sterile pipette to aspirate 0.1 mL of the inactivated bacterial solution and evenly spread it by streaking on a TSA solid medium, and culture it in a 37 °C, 5% CO₂ incubator for 48 h. If no bacteria grow, it is qualified.
[0075] (5) Vaccine preparation
[0076] Mix 60% of the volume of the bacterial solution of the water-in-oil-in-water adjuvant Summit S550 for livestock and poultry with 40% of the volume of sterile normal saline, and then add the original bacterial vaccine solution, and mix evenly to obtain a Haemophilus paragallinarum inactivated bacterial vaccine with a final concentration of 1×10 9 CFU / mL.
[0077] 2. Vaccine safety
[0078] Select 20 healthy commercial laying hens at 60 days of age and randomly divide them into 2 groups, with 10 hens in each group.
[0079] Vaccine test group: Inject 2 mL of this vaccine into the chest muscle of each hen.
[0080] Control group: Inject 2 mL of sterile normal saline into the chest muscle of each hen.
[0081] Feed for 2 weeks and observe their growth performance.
[0082] It was found that during the entire test period, the chickens in the vaccine group and the control group showed normal performance in terms of feeding, mental state, respiratory frequency, etc. The body temperature of the chickens in the vaccine group was basically normal within 1 - 3 days after injection, and the fluctuation range was within 1 °C. No other obvious adverse reactions and clinical manifestations were observed. This indicates that the inactivated bacterial vaccine has high safety.
[0083] 3. Vaccine potency verification
[0084] Select 40 healthy commercial laying hens at 50 days of age and randomly divide them into 5 groups, with 8 hens in each group. Groups 1 - 4 are the vaccine test groups, and 0.1 mL, 0.2 mL, 0.3 mL, and 0.5 mL of this bacterial vaccine are subcutaneously injected into the neck of groups 1 - 4 in sequence; the 5th group is set as the control group, and 0.5 mL of sterile normal saline is subcutaneously injected into the neck. The chickens in the control group and the vaccine group are re-injected and immunized with the same dose of sterile normal saline and the vaccine at 80 days of age. 28 days later, 0.3 mL is instilled into the nasal cavity of each of the above chickens, 10 7XXHp2408B1 bacterial solution at CFU / mL was used for the challenge test. The test lasted for two weeks, during which the clinical manifestations and appearance symptoms of the chickens in the test group and the control group were recorded. After the challenge test, all the chickens in the test group and the control group were dissected, and secretions from the nasal cavity, infraorbital sinus, trachea, etc. were aseptically collected for bacterial isolation and identification to determine the vaccine protection rate accordingly.
[0085] The challenge test showed obvious differences between the control group and the vaccine-immunized group; in the control group, the chickens started to show disease symptoms successively on the third day, coughing and having clear nasal discharge, purulent nasal discharge appeared on the 4th - 5th day, the nostrils were sticky with feed particles, unilateral or bilateral lower eyelid swelling occurred, some chickens stretched their necks and opened their mouths to breathe, feed intake decreased significantly, all chickens got sick, deaths occurred 5 days after the challenge test, 4 chickens died after 14 days, and the mortality rate was 50%. All the dead and sick chickens were dissected, and the symptoms were basically the same: the nasal cavity showed catarrhal inflammation, the mucosa was congested and swollen, and was attached with yellowish-white viscous fluid, and there were caseous clots and necrotic substances formed by exudate in the infraorbital sinus. The vaccine-immunized group showed that the chickens in the groups injected with 0.1 mL, 0.2 mL, 0.3 mL, and 0.5 mL of the vaccine did not show obvious clinical symptoms during the challenge test. Haemophilus paragallinarum was isolated from all the dissected sick chickens.
[0086] The protection effect of the vaccine in the chicken challenge test is shown in Table 1:
[0087] Table 1 Statistical results of the challenge protection effect of chickens in different groups
[0088]
[0089] As can be seen from Table 1, the vaccine prepared by the present invention has good protective effects at an immunization dose of 0.1 mL, indicating that the vaccine prepared from the strain of the present invention has excellent immune protection effects.
[0090] The above are only the preferred embodiments of the present invention and do not limit the present invention. Any modifications, equivalent replacements, and improvements made within the spirit and principle of the present invention shall be included within the protection scope of the present invention.
Claims
1. A Haemophilus paragallinarum strain, characterized in that: The Haemophilus paragallinarum is Haemophilus paragallinarum XXHp2408B1, with the preservation number of CGMCC No: 46208, the preservation date of October 31, 2024, the preservation unit being the General Microbiology Center of the China Committee for Culture Collection of Microorganisms, and the preservation address being No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing.
2. The Haemophilus paragallinarum according to claim 1, characterized in that: The Haemophilus paragallinarum XXHp2408B1 is Haemophilus paragallinarum of serotype B.
3. The Haemophilus paragallinarum according to claim 1, characterized in that: The Haemophilus paragallinarum XXHp2408B1 was isolated from the infraorbital sinus secretion of adult laying hens with facial swelling and typical respiratory symptoms.
4. Use of the Haemophilus paragallinarum according to claim 1 in the preparation of an inactivated Haemophilus paragallinarum vaccine.
5. The application according to claim 4, characterized in that: The inactivated vaccine is prepared by multiplying the Haemophilus paragallinarum XXHp2408B1 according to claim 1, performing pure inspection, inactivating it, and then adding an adjuvant.
6. The application according to claim 4, wherein: The adjuvant is the oil-in-water-in-water adjuvant Summit S550 for livestock and poultry.
7. The application according to claim 4, characterized in that: The bacterial count of Haemophilus paragallinarum XXHp2408B1 in the inactivated vaccine is 1 - 2×10 9 CFU / mL.
8. The application according to claim 7, wherein: The bacterial quantity of inactivated Haemophilus paragallinarum XXHp2408B1 in the inactivated vaccine is 1×10 9 CFU / mL.
9. The application according to any one of claims 4 - 8, characterized in that: The preparation method of the inactivated vaccine includes the following steps: (1) Primary seed propagation: Streak-inoculate the freeze-dried strain of Haemophilus paragallinarum XXHp2408B1 onto a TSA plate solid medium with an inoculation loop, place it in an incubator at 37°C and 5% CO2 for 24 - 36 h, pick typical colonies, and then subculture and inoculate onto a TSA plate, and culture it in an incubator at 37°C and 5% CO2 for 24 h. After passing the inspection, it is used as the primary seed; (2) Secondary seed propagation: Inoculate the primary seed into a TSB liquid medium, place it in a medium-speed shaker and culture it at 37°C. After 18 - 24 h, observe that the culture becomes turbid and then collect it. After passing the pure inspection, it is used as the secondary seed; (3) Bacterial liquid preparation: Inoculate the secondary seed into a TSB liquid medium containing 1% respectively, and culture it in a medium-speed shaker at 37°C with shaking for 18 - 24 h, and harvest the bacterial liquid; (4) Viable cell count: Shake flask culture was carried out using TSA medium containing 5% newborn bovine serum and 0.01% NAD for viable cell count, the concentration of the culture was determined, and the number of Haemophilus paragallinarum in the culture was adjusted to 2×10 9 CFU / mL; (5) Bacterial liquid inactivation and inspection: Add 2 mL of formaldehyde solution to every 1000 mL of the culture, mix well quickly, and inactivate it in a 37°C water bath or incubator for 48 h to obtain the original bacterial vaccine. Use a sterile pipette to suck 0.1 mL of the inactivated bacterial liquid and spread it evenly by streaking on a TSA solid medium, and culture it in an incubator at 37°C and 5% CO2 for 48 h. If no bacteria grow, it is considered qualified; (6) Vaccine preparation: Mix adjuvant with a volume of 60% of the bacterial solution and sterile normal saline with a volume of 40% of the bacterial solution, and then add the original vaccine solution. Mix evenly to obtain an inactivated vaccine of Haemophilus paragallinarum with a final concentration of 1×10 9 CFU / mL.