Marker-free gene deletion mutant strain of pseudomonas plecoglossicida as well as construction method and application of marker-free gene deletion mutant strain

Abstract

The invention relates to a condition deletion mutant strain of Pseudomonas plecoglossicida phosphoric acid pantetheinyl transferase and application thereof, starting from a wild strain P.plecoglossicida NB2011, firstly, a recombinant plasmid pET22b-entD integrated with an escherichia coli entD (PPTase participating in siderophore enterobacter synthesis) gene sequence is transformed into the NB2011, under the condition, a double homologous recombination method is adopted, a primer is designed, and a mutant strain of Pseudomonas plecoglossicida phosphoric acid pantetheinyl transferase is obtained. The method comprises the following steps: by taking an NB2011 PPTase coding sequence as a target gene, constructing a deletion mutant strain delta PPT / pET22b-entD NB2011 in a PPTase frame; the growth rate, siderophore generation and other biological phenotypes of the wild strain and the mutant strain are analyzed, and by testing the adhesion, internalization and proliferation characteristics of the deletion strain to mouse macrophage J774A.1 and the virulence change of the deletion strain to large yellow croaker, the influence of PPTase on the thallus virulence is evaluated; according to the invention, the successful construction of the condition deletion mutant strain can provide a necessary strain basis for in-depth study on the biological function of the PPTase in the P.plecoglossicida and the effect of the PPTase in a pathogenic mechanism.

Description

Technical Field

[0001] The present invention relates to the field of biotechnology, and more particularly, to a markerless gene deletion mutant of Pseudomonas plecoglossicida, a method for constructing the same, and an application thereof. Background Art

[0002] Pseudomonas plecoglossicida is the main pathogenic bacterium of visceral white spot disease in marine fish, especially in cultured large yellow croaker and Epinephelus coioides. The infection cycle of this disease is long, and the morbidity and mortality are high, often causing serious economic losses to the aquaculture industry. At present, the prevention and control measures for this disease mainly rely on antibiotic treatment. However, the long-term use of antibiotics easily leads to the emergence of drug-resistant strains and also pollutes the aquaculture environment. Therefore, in-depth study of the pathogenic mechanism of Pseudomonas plecoglossicida and exploration of new prevention and control strategies are of great significance for the healthy development of aquaculture.

[0003] Phosphopantetheinyl transferase (PPTase) is a class of modifying enzymes widely present in bacteria, archaea, and eukaryotic cells. Its main function is to catalyze the transfer of the phosphopantetheine arm on the coenzyme A (CoA) molecule to the conserved serine residue of substrate molecules such as fatty acid synthase (FAS), polyketide synthase (PKS), and non-ribosomal peptide synthase (NRPS), thereby activating the synthesis of fatty acids, polyketides, and non-ribosomal peptides. These metabolites play a key role in the primary and secondary metabolism of bacteria, especially in the growth, quorum sensing, siderophore synthesis, and virulence expression of pathogenic bacteria. PPTase usually plays an important regulatory role.

[0004] In the genome of Pseudomonas plecoglossicida, only one PPTase is encoded, indicating that this gene may be involved in both primary and secondary metabolism and plays an indispensable role in the growth and pathogenic process of this bacterium. However, since PPTase is an essential gene, conventional gene knockout methods cannot directly knockout this gene, otherwise the bacteria will not survive. Therefore, there are still technical bottlenecks in the current research on the function of the PPTase gene of Pseudomonas plecoglossicida, and it is difficult to directly construct a PPTase gene deletion mutant, thus affecting the in-depth analysis of the specific function of this gene in the bacterial physiology and pathogenic mechanism.

[0005] Existing studies have shown that in Pseudomonas aeruginosa, PPTase (PapcpS) is not only involved in fatty acid biosynthesis but also related to siderophore production, quorum-sensing signal molecule generation, and virulence regulation. Similarly, P. plecoglossicida mainly produces a fluorescent siderophore, pyoverdine, a secondary metabolite closely related to the virulence of this bacterium and potentially regulated by PPTase. Therefore, in-depth study of the biological function of P. plecoglossicida PPTase, especially its role in virulence regulation, not only helps to reveal the pathogenic mechanism of this bacterium but may also provide a theoretical basis for the development of novel vaccines and anti-infective drugs.

[0006] However, current research on the P. plecoglossicida PPTase gene still faces many challenges: Gene essentiality issue: As a key metabolic enzyme, PPTase cannot be directly deleted by traditional gene knockout techniques, limiting the study of its function. Lack of applicable functional replacement strategies: Although homologous PPTases exist in Escherichia coli and P. aeruginosa, whether these enzymes can compensate for their functions in P. plecoglossicida has not been systematically verified. Lack of a stable conditional deletion system: Currently, there is no mature method to achieve conditional deletion of PPTase in P. plecoglossicida to study its biological function and virulence mechanism without affecting bacterial survival. Unknown impact on host infection ability: Whether the deletion of PPTase will affect the infection ability of P. plecoglossicida in host cells and fish, and whether it will change the growth characteristics and virulence of the bacterium still need further study.

[0007] In summary, the functional study of PPTase in P. plecoglossicida still faces many technical challenges. It is urgent to develop a feasible strategy to achieve the deletion of this gene under appropriate conditions and verify its role in bacterial growth, metabolism, and virulence expression to provide a scientific basis for the analysis of the pathogenic mechanism of this bacterium and the research and development of prevention and control technologies. Summary of the Invention

[0008] The technical problem to be solved by the present invention is to provide a markerless gene deletion mutant strain of Pseudomonas plecoglossicida, so as to solve the problems of residual resistance genes, low genetic stability, and restricted growth of the strain in the gene knockout process in the prior art. At the same time, a more stable and controllable strain is provided, providing new experimental materials for the virulence research and related applications of Pseudomonas plecoglossicida.

[0009] To overcome the above defects of the prior art, the present invention provides a markerless gene deletion mutant strain of Pseudomonas plecoglossicida, named ΔPPT / pET22b-entDP. plecoglossicidaNB2011. The mutant strain has been transformed with the recombinant plasmid pET22b-entD and lacks the coding sequence of the endogenous phosphopantetheinyl transferase.

[0010] In a possible implementation, the deposit number of ΔPPT / pET22b-entDP. plecoglossicidaNB2011 is CGMCC No. 33817. The deposit location is the General Microbiology Center of the China Committee for Culture Collection of Microorganisms. The deposit date is March 14, 2025. The address of the deposit unit is No. 13, North First Street, Zhongguancun, Haidian District, Beijing.

[0011] Compared with the prior art, the markerless gene deletion mutant strain of Pseudomonas plecoglossicida provided by the present application provides a highly stable markerless gene deletion mutant strain, successfully overcoming the problems of genetic instability, residual resistance genes, and growth restriction in the prior art. It can be widely applied to the research on the pathogenic mechanism of Pseudomonas plecoglossicida, gene function analysis, and related bioengineering fields, providing new experimental materials for future molecular biology research and application development. Specifically, it has the following advantages: No exogenous resistance gene, improving genetic stability: The prior art usually relies on resistance genes for screening when constructing mutant strains, resulting in the genetic background of the mutant strains being affected and possibly causing unexpected phenotypic changes. The present invention adopts a double homologous recombination combined with plasmid complementation strategy, avoiding the introduction of resistance genes, making the mutant strain genetically more stable and capable of long-term passage without gene drift; Specific deletion of the PPTase gene, retaining core physiological functions: The PPTase gene plays an important role in the secondary metabolism and virulence factor synthesis of Pseudomonas plecoglossicida. Its complete deletion may affect the growth and survival of the strain. The present invention achieves functional complementation by transforming the recombinant plasmid pET22b-entD, ensuring that the mutant strain still has controllable growth ability while achieving gene deletion, thus avoiding experimental deviations caused by metabolic impairment; Optimizing the genetic background and enhancing the research value: Since the mutant strain of the present invention does not carry exogenous marker genes, its genomic structure is closer to that of the wild-type strain, which helps to accurately study the role of the PPTase gene in the synthesis of virulence factors, metabolic regulation, and pathogenicity, making this mutant strain have higher experimental value in the research of functional genes of Pseudomonas plecoglossicida, host-pathogen interaction research, etc.; The mutant strain has stable growth and can be used for long-term research: Traditional gene deletion strategies may lead to slow growth or reduced adaptability of the strain, thus limiting its application in long-term experiments. The mutant strain of the present invention maintains its basic growth ability through plasmid complementation while achieving the deletion of specific functions, enabling it to survive stably for a long time and be suitable for research under different experimental conditions.

[0012] The second technical problem to be solved by the present invention is to provide an application of a marker-free gene deletion mutant strain of Pseudomonas plecoglossicida to overcome the limitations in the research of pathogen virulence regulation, pathogenic mechanism analysis, and vaccine development in the prior art. In particular, due to the residual resistance genes, complex genetic background, or unstable virulence regulation of traditional research materials, the research results are limited, affecting their application value in vaccine development and pathogenic mechanism research.

[0013] To overcome the above defects of the prior art, the present invention provides an application of the marker-free gene deletion mutant strain of the said Pseudomonas plecoglossicida, and the application includes the application of the mutant strain in altering the virulence of the bacteria, studying the pathogenic mechanism of Pseudomonas plecoglossicida, and using it as a candidate vaccine strain for vaccine development.

[0014] Compared with the prior art, the application of a marker-free gene deletion mutant strain of Pseudomonas plecoglossicida in this application has the following advantages: The mutant strain in the present invention precisely deletes the PPTase gene and can be used to study the virulence regulation mechanism and pathogenic mechanism of Pseudomonas plecoglossicida, avoiding the problem of inaccurate experimental results caused by the interference of exogenous resistance genes in traditional mutant strains. At the same time, the virulence of this mutant strain decreases and it still retains certain immunogenicity, having the potential to be used as a candidate vaccine strain, providing new ideas for the research and development of aquatic vaccines. In addition, the mutant strain provided by the present invention can also be used to explore new anti-infection strategies, providing experimental materials for the prevention and control of aquatic diseases and the research of new antibacterial targets.

[0015] The third technical problem to be solved by the present invention is to provide a construction method of a marker-free gene deletion mutant strain of Pseudomonas plecoglossicida to solve the problems of difficult gene deletion operation, low mutation success rate, and the influence of residual exogenous resistance genes on the genetic stability of the strain existing in the prior art.

[0016] To overcome the above defects of the prior art, the present invention provides a construction method of the marker-free gene deletion mutant strain of the said Pseudomonas plecoglossicida, which includes the following steps: S1: Construction of donor bacteria: Construct a suicide plasmid containing a deletion fragment of the PPTase gene and introduce it into the donor bacterium E. coli WM3064; S2: Construction of recipient bacteria: Construct a recombinant plasmid pET22b-entD containing the Escherichia coli phosphopantetheinyl transferase gene and transfer it into P. plecoglossicida NB2011 to obtain recipient bacteria; S3: Induce homologous recombination to obtain a ΔPPT deletion mutant: Through the conjugation transfer of the donor bacteria and the recipient bacteria, achieve double homologous recombination, and screen and identify to obtain the ΔPPT / pET22b-entD mutant.

[0017] In a possible implementation manner, the step S1 includes: S11: Design primers using the genomic DNA of Pseudomonas plecoglossicida NB2011 as a template, and PCR amplify the upstream and downstream sequences of PPTase; S12: Use the upstream and downstream sequences of the PPTase gene amplified in the step S11 to obtain an overlapping product through overlap extension PCR; S13: Clone the overlapping product obtained in the step S12 onto the suicide vector pK18mobsacB to obtain a recombinant vector pK18mobsacB-PPT; S14: Transform the recombinant plasmid into E. coli DH5α competent cells and screen for correct positive clones; S15: Extract the plasmid from the positive clone obtained in step 4, and by the method of heat shock transformation, transfer the recombinant suicide plasmid into E. coli WM3064 competent cells and screen for positive clones to obtain the donor bacterium E. coli WM3064.

[0018] The present invention provides a method for constructing a marker-free gene deletion mutant of Pseudomonas plecoglossicida, which adopts a double homologous recombination strategy. Through the conjugation transfer of a donor bacterium and a recipient bacterium, the marker-free deletion of the phosphopantetheinyl transferase (PPTase) gene of Pseudomonas plecoglossicida is achieved, ensuring the genetic stability and biosafety of the mutant strain. The method has the following advantages: The double homologous recombination technology is used in the present invention to construct a PPTase gene deletion mutant, avoiding the problem of foreign gene residues caused by traditional antibiotic marker screening, and improving genetic stability and biosafety. In the method of the present invention, the donor bacterium E. coli WM3064 carries the suicide plasmid pK18mobsacB-PPT, which enters the recipient bacterium P. plecoglossicida NB2011 (pET22b-entD) through conjugation transfer, realizing the precise deletion of the gene and not generating unnecessary resistance gene fragments, ensuring the controllability and application safety of the mutant strain. Secondly, the complementary expression of the Escherichia coli phosphopantetheinyl transferase (entD) gene is utilized in the present invention, enabling the PPTase deletion mutant strain to still maintain growth in the absence of endogenous PPTase. This strategy not only reduces the survival pressure during the mutant construction process, improves the screening success rate of the mutant strain, but also provides convenience for subsequent functional verification. Compared with the traditional mutant construction strategy, the operation process of this method is optimized, reducing non-specific mutations and ensuring the precision of gene knockout. Moreover, the method of the present invention can efficiently screen out the target mutant strain through the conjugation transfer of the donor bacterium and the recipient bacterium, combined with resistance screening, sucrose screening and PCR identification, solving the problems of low success rate of strain construction and difficult screening in the prior art. Compared with traditional chemical transformation or electroporation, the conjugation transfer method is applicable to Gram-negative bacteria that are difficult to transform, further improving the experimental success rate and enhancing the applicability of this method. In summary, the method for constructing a marker-free gene deletion mutant of Pseudomonas plecoglossicida provided by the present invention overcomes the problems of marker gene residues, low mutation efficiency and difficult screening existing in the gene deletion construction methods in the prior art, and provides an efficient and feasible technical means for the functional research of pathogenic bacteria, the analysis of virulence regulation mechanisms and vaccine development.

[0019] In a possible implementation manner, the step S11 includes: Design two pairs of primers PPT-MF1 / MF2 and PPT-MR1 / MR2 using the genomic DNA of Pseudomonas plecoglossicida NB2011 as a template, and perform PCR amplification of the upstream homologous arm fragment (780 bp) and downstream homologous arm fragment (742 bp) of PPTase through these two pairs of primers respectively. Among them, the sequences of PPT-MF1 / MF2 and PPT-MR1 / MR2 are shown in SEQ.ID.NO:1-4, specifically: PPT-MF1: GCTCTAGACCTTGTCGGCTATTACGC; PPT-MF2: ACAATACCCGCCATGAACCGTCTGAACGTTACTGCG; PPT-MR1: CGCAGTAACGTTCAGACGGTTCATGGCGGGTATTGT; PPT-MR2: CGGGATCCGCAGCCTTCAATGGCATG; The step S13 includes: using XbaⅠ and BamHⅠ to perform double digestion on the upstream and downstream homologous arm fragments of the PPTase gene obtained by PCR amplification and the pK18mobsacB plasmid respectively. After digestion, a ligation product pK18mobsacB-PPT is obtained by means of low-temperature ligation.

[0020] Compared with the prior art, by adopting the above technical solution, an accurate double homologous recombination strategy is used to complete the directional deletion of the PPTase gene of Pseudomonas plecoglossicida without introducing exogenous resistance genes. Through two long homologous arm sequences of 780bp + 742bp, the homologous recombination efficiency is significantly improved, the risk of non-specific integration is reduced, and the homologous arm fragments of the PPTase gene are accurately inserted by using the double digestion sites of XbaⅠ and BamHⅠ. Combining with the low-temperature ligation technology, the stability of the recombinant plasmid pK18mobsacB-PPT construction is ensured, and the situations of vector self-ligation or fragment loss are reduced. Moreover, the above technical solution of the present invention is different from the traditional gene deletion method mediated by resistance genes, avoiding the residue of exogenous resistance genes, making the strain more suitable for subsequent virulence mechanism research and vaccine development. By optimizing the PCR amplification and digestion cloning process, the method of the present invention greatly improves the success rate, operation convenience and genetic stability of mutant construction, and overcomes the problems of low gene deletion construction efficiency and unstable recombination in the prior art.

[0021] In a possible implementation manner, the step S14 includes: transferring the obtained recombinant product into Escherichia coli DH5α competent cells, coating them on a plate containing 50 μg / mL kanamycin, culturing overnight at 37°C, performing PCR on the obtained colonies with the universal primers M13F(-47) / M13R(-48), screening positive clones, and sequencing. The sequences of M13F(-47) and M13R(-48) are shown in SEQ.ID.NO:5-6, specifically: M13F(-47): CGCCAGGGTTTTCCCAGTCACGAC M13R(-48): AGCGGATAACAATTTCACACAGGA; The step S15 includes: using a plasmid extraction kit to extract the recombinant vector pK18mobsacB-PPTase from the positive clone strain obtained in S14, transforming the extracted recombinant vector into the competent cells of Escherichia coli WM3064, coating it on an LB plate containing 50 μg / mL kanamycin and 0.3 mM 2,6-diaminopimelic acid, and culturing overnight at 37°C; when single colonies grow out, perform PCR using the universal primers M13F(-47) / M13R(-48), screen positive clones, and sequence them to obtain the donor bacterium E. coli WM3064.

[0022] Compared with the prior art, adopting the above technical solution can improve the construction efficiency of the gene deletion vector and the accuracy of donor bacterium screening, thereby ensuring the stable construction of mutant strains. The present invention adopts a dual-strain screening strategy (DH5α and WM3064), combined with the method of resistance screening + PCR verification + sequencing, to ensure the correct construction and efficient transfer of the gene deletion plasmid. In step S14, the recombinant plasmid is received by E. coli DH5α competent cells, and after kanamycin resistance screening + PCR identification + sequencing, the correct recombinant clones are obtained. DH5α is suitable for plasmid amplification and screening due to its stable genetic background, which can reduce the possibility of non-specific insertion and ensure that the correctly constructed plasmid is used for subsequent experiments; while in step S15, the correctly constructed pK18mobsacB-PPTase plasmid is transferred into the competent cells of E. coli WM3064. Since WM3064 is a DAP-dependent donor bacterium, it can be used for subsequent conjugation transfer experiments, and its correctness is further verified by kanamycin resistance screening + PCR sequencing. By culturing on an LB plate containing kanamycin and 2,6-diaminopimelic acid, the stable growth of the donor bacterium is ensured, and the high efficiency of its subsequent conjugation transfer is guaranteed.

[0023] In a possible implementation manner, the step S2 includes: S21: Transform the pre-constructed complementary plasmid pET22b-entD into P. plecoglossicida NB2011 by the method of conjugation transfer; S22: Identify the single colonies obtained in step 5.1 to obtain positive clones, that is, the recipient bacterium P. plecoglossicida NB2011.

[0024] More specifically, the step S2 includes: S21: Transform the constructed Escherichia coli complementary plasmid pET22b-entD into the competent cells of Escherichia coli WM3064, coat it on a plate containing 100 μg / mL ampicillin and 0.3 mM DAP, and culture overnight at 37°C; S22: The obtained positive strain was conjugated with Pseudomonas plecoglossicida NB2011 on an LB (DAP = 0.3 mM) plate at 28 °C for 48 h. The bacterial lawn was resuspended with liquid LB (DAP = 0.3 mM) and diluted and spread on a plate containing 100 μg / mL ampicillin. The obtained colonies were identified by PCR to obtain the recipient strain P. plecoglossicida NB2011 (pET22b-entD); Compared with the prior art, adopting the above technical solution, in step S21, first, the recombinant plasmid pET22b-entD was introduced into the competent cells of Escherichia coli WM3064 and cultured under the screening conditions of ampicillin + DAP to ensure the correct integration of the plasmid. Due to its DAP dependence, WM3064 can only grow under the condition of providing DAP. This characteristic makes it an ideal conjugation donor bacterium, reducing the possibility of non-specific contamination and improving the specificity of conjugation transfer; while in step S22, by using the method of conjugation transfer, the donor bacterium WM3064 carrying pET22b-entD was co-cultured with Pseudomonas plecoglossicida NB2011, and liquid LB resuspension and ampicillin resistance screening were used to ensure that the successfully transferred strains could survive and form colonies. Further, through PCR identification, the correct insertion of the target gene was further confirmed to ensure the successful construction of the recipient strain P. plecoglossicida NB2011 (pET22b-entD); finally, by optimizing the selection of donor bacteria, plasmid construction and conjugation transfer methods, the construction efficiency of the recipient strain of Pseudomonas plecoglossicida was significantly improved, providing a reliable method support for further gene function research and vaccine development.

[0025] In a possible implementation manner, the step S3 includes: S31: The donor bacterium E. coli WM3064 prepared in step S1 and the recipient bacterium P. plecoglossicida NB2011 prepared in S2 were incubated on an LB plate containing kanamycin and ampicillin, and then conjugation transfer was carried out. The strains carrying the plasmid were screened by homologous recombination once to obtain the insertion mutant positive clones; S32: The positive clone bacterial solution in step S31 was diluted and spread on an LB plate containing sucrose and cultured overnight. Through secondary homologous recombination screening identification and sequencing, the Pseudomonas plecoglossicida PPTase conditional deletion mutant strain ΔPPT / pET22b-entD was obtained.

[0026] Compared with the prior art, the above technical scheme is adopted. In step S31, the donor bacteria E. coli WM3064 (pK18mobSacB-PPT) and the recipient bacteria P. plecoglossicida NB2011 (pET22b-entD) are used for conjugation transfer, the recombinant suicide plasmid pK18mobsacB-PPT is introduced into the recipient bacteria, and the positive clones are screened under the dual-antibody screening conditions of kanamycin + ampicillin. Since pK18mobsacB contains the sacB gene, it can cause death in a high osmotic pressure sucrose environment, ensuring that only insertion mutation-positive strains that have undergone one homologous recombination are obtained; in step S32, a secondary homologous recombination strategy is used to remove strains still carrying the suicide plasmid through negative screening in a sucrose culture medium, so that only the ΔPPT deletion mutant strain that has undergone complete homologous recombination can survive, and the accuracy and stability of the mutant strain are verified by PCR identification and sequencing; by optimizing the homologous recombination strategy, conjugation transfer method and screening conditions, the PPTase marker-free gene deletion mutant strain ΔPPT / pET22b-entD of Pseudomonas aeruginosa was successfully constructed.

[0027] In a possible embodiment, in the step S31, the content of kanamycin in the LB plate is 50 μg / mL, the content of ampicillin is 100 μg / mL, and the incubation condition is incubation at a temperature of 28°C for 48 hours; in the step S32, the mass content of sucrose in the LB plate is 30%, and the temperature of overnight culture is 28°C.

[0028] Compared with the prior art, the above technical scheme is adopted. In step S31, the kanamycin (50 μg / mL) and ampicillin (100 μg / mL) resistance screening in the conjugation transfer process can effectively screen out the strains that have successfully conjugated. At the same time, suitable growth conditions are provided by incubating at 28°C for 48 hours to ensure the conjugation efficiency and strain survival rate. This optimized conjugation condition enables the donor bacteria and the recipient bacteria to fully conjugate, thereby improving the success rate of homologous recombination. In step S32, 30% sucrose screening is combined with overnight culture at 28°C, and the sucrose-induced screening strategy is used to promote the insertion strain containing the resistance marker to undergo secondary homologous recombination, and finally successfully eliminate the resistance gene and form a marker-free gene deletion mutant. Based on the sucrose-sensitive characteristics of the sacB gene, this method can effectively eliminate cells that have not completed recombination, improve the specificity and efficiency of mutant screening, and finally achieve the accurate and efficient construction of marker-free gene deletion mutants, and ensure the stability and repeatability of the mutation process.

[0029] More specifically, step S3 includes: S31: The donor bacterium E. coli WM3064 (pK18mobSacB-PPT) and the recipient bacterium P. plecoglossicida NB2011 (pET22b-entD) were conjugated on an LB (Amp = 100 μg / mL, DAP = 0.3 mM) plate at 28 °C for 48 h. The bacterial lawn was resuspended with liquid LB (DAP = 0.3 mM) and diluted and spread on an LB plate containing Kan (50 μg / mL) and Amp (100 μg / mL). The obtained colonies were detected with primer pairs PPT-wS / wA and PPT-dS / dA for the clones respectively. After verification, single crossover bacteria were obtained; The single crossover bacteria were inoculated into fresh LB liquid medium and cultured overnight at 28 °C; S32: The single crossover bacterial solution obtained in S31 was diluted and spread on an LB (containing Amp 100 μg / mL) plate containing 30% sucrose and cultured overnight at 28 °C. After PCR identification and sequencing of the grown colonies with primers PPT-wA and PPT-dS, the conditional deletion mutant strain ΔPPT / pET22b-entD of the PPTase gene of P. plecoglossicida was obtained. Description of the Drawings

[0030] Figure 1 It is an electrophoretic analysis diagram of the amplification products of the upstream and downstream homologous arms of the PPTase gene; among them, lane 1: upstream homologous arm fragment; lane 2: downstream homologous arm fragment; M: DL2000 DNA Marker; Figure 2 It is an electrophoretic analysis diagram of the PCR amplification products of the upstream and downstream homologous arm fusion fragments of the PPTase gene; among them, lane 1: upstream and downstream homologous arm fusion fragment; M: DL2000 DNA Marker; Figure 3 It is an electrophoretic analysis diagram of the colony PCR amplification products of the recombinant suicide plasmid pK18mobSacB-PPTase; among them, lanes 1, 3 - 5: empty plasmid; lanes 2 and 6: pK18mobSacB-PPTase recombinant suicide plasmid; M: DL5000 DNA Marker; Figure 4 It is an electrophoretic analysis diagram of the colony PCR amplification products of the positive clone strain of the recipient bacterium P. plecoglossicida NB2011 (pET22b-entD); among them, lanes 1 - 3: P. plecoglossicida NB2011 (pET22b-entD); M: DL5000 DNA Marker Figure 5Electrophoresis analysis chart of PCR amplification products of single-exchange bacterial colonies; among them, A: PPTase-wS / PPTase-wA; B: PPTase-dS / PPTase-dA; Lanes 1-10: Positive clones; Lane 11: Wild-type NB2011 strain control; M: DL5000 DNA Marker; Figure 6 Electrophoresis analysis chart of PCR amplification products of the PPTase gene deletion mutant strain ΔPPT / pET22b-entD of Pseudomonas plecoglossicida; among them, Lanes 1-3: Positive clones; Lane 4: NB2011 as a negative control; M: DL5000 DNA Marker; Figure 7 Bacterial growth curve chart of wild strain NB2011 and mutant strain ΔPPT / pET22b-entD; Figure 8 Growth situation chart of wild strain NB2011 and mutant strain ΔPPT / pET22b-entD under the addition of different concentrations of lysine; Figure 9 Siderophore production ability chart of wild strain NB2011 and mutant strain ΔPPT / pET22b-entD; Figure 10 Adhesion of wild strain NB2011 and mutant strain ΔPPT / pET22b-entD to murine macrophage J774A.1 and the situation of intracellular proliferation after being internalized by the cells; Detailed implementation manners

[0031] First of all, those skilled in the art should understand that these implementation manners are only used to explain the technical principles of the embodiments of this application, and are not intended to limit the protection scope of the embodiments of this application. Those skilled in the art can make adjustments according to needs to adapt to specific application scenarios.

[0032] The present invention provides a marker-free gene deletion mutant strain of Pseudomonas plecoglossicida, the mutant strain is named ΔPPT / pET22b-entD P. plecoglossicida NB2011, and the mutant strain has been transfected with the recombinant plasmid pET22b-entD and lacks the coding sequence of the endogenous phosphopantetheinyl transferase.

[0033] As a preferred scheme, the preservation number of ΔPPT / pET22b-entD P. plecoglossicida NB2011 is CGMCC No. 33817, the preservation location is the General Microbiology Center of the China Microbial Culture Collection Center, the preservation date is March 14, 2025, and the address of the preservation unit is No. 13, Beiyitiao, Zhongguancun, Haibin District, Beijing.

[0034] The present invention also provides an application of the marker-free gene deletion mutant strain of Pseudomonas plecoglossicida, and the application includes the application of the mutant strain in changing the virulence of the bacterial cells, studying the pathogenic mechanism of Pseudomonas plecoglossicida, and serving as a candidate vaccine strain for vaccine research and development.

[0035] The application of the marker-free gene deletion mutant strain of Pseudomonas plecoglossicida provided by this application has the following advantages compared with the prior art: Precisely regulating the virulence of bacterial cells and optimizing the research model of pathogenic mechanism: In existing research, the pathogenic mechanism of Pseudomonas plecoglossicida is affected by multiple regulatory factors. In the study of virulence regulation by traditional methods, it is easily interfered by the knockout of exogenous resistance genes or non-target genes, affecting the accuracy of the experiment. The ΔPPT / pET22b-entD mutant strain of the present invention changes the virulence level of the bacterial cells by specifically deleting the PPTase gene, and can be used to systematically study the role of PPTase in the synthesis of virulence factors, the growth of pathogenic bacteria, and environmental adaptability, providing reliable experimental materials for analyzing the pathogenic mechanism of Pseudomonas plecoglossicida;

[0036] Marker-free gene deletion, improving the reliability of experimental data: Traditional gene mutant strains usually carry resistance genes or screening markers, which may affect the metabolic adaptability of pathogenic bacteria in the host, thus affecting the experimental results. The mutant strain of the present invention does not contain exogenous resistance genes, and only precisely deletes the PPTase gene through double homologous recombination. At the same time, plasmid complementation is used to maintain the basic growth ability, ensuring that only the function of the target gene is studied during the experiment without interference from exogenous factors, improving the accuracy and repeatability of experimental data.

[0037] As a candidate vaccine strain, it has potential value for vaccine research and development: The PPTase gene plays a key role in the virulence regulation of Pseudomonas plecoglossicida, and its deletion may lead to a decrease in the virulence of the strain, making it a potential candidate strain for attenuated vaccines. Compared with traditional inactivated vaccines or attenuated live vaccines, the mutant strain of the present invention reduces virulence while still retaining certain immunogenicity through specific gene deletion, and can be used to develop vaccines against Pseudomonas plecoglossicida infection, providing a new technical means for the prevention and control of aquatic diseases.

[0038] Expanding the research on functional genes of aquatic pathogenic bacteria and providing a theoretical basis for new anti-infection strategies: The mutant strain of the present invention can not only be used to study the pathogenic mechanism of Pseudomonas plecoglossicida, but also serve as an experimental material for studying the regulation of bacterial virulence factors, host-pathogen interactions, and new anti-infection strategies. Through the application of this mutant strain, the role of PPTase in the synthesis of bacterial secondary metabolites, host immune escape, and environmental adaptability can be further explored, providing a scientific basis for new antibacterial strategies and the prevention and control of aquatic diseases.

[0039] The present invention also provides a method for constructing a marker-free gene deletion mutant of Pseudomonas plecoglossicida, comprising the following steps: S1: Constructing a donor bacterium: constructing a suicide plasmid containing a deletion fragment of the PPTase gene and introducing it into the donor bacterium E. coli WM3064; S2: Constructing a recipient bacterium: constructing a recombinant plasmid pET22b-entD containing the Escherichia coli phosphopantetheinyl transferase gene and transferring it into P. plecoglossicida NB2011 to obtain a recipient bacterium; S3: Inducing homologous recombination to obtain a ΔPPT deletion mutant: achieving double homologous recombination through conjugative transfer of the donor bacterium and the recipient bacterium, screening and identifying to obtain the ΔPPT / pET22b-entD mutant.

[0040] As a preferred solution, the step S1 includes: S11: Designing primers using the genomic DNA of Pseudomonas plecoglossicida NB2011 as a template and PCR amplifying the upstream and downstream sequences of PPTase; S12: Using the upstream and downstream sequences of the PPTase gene amplified in the step S11 to obtain an overlapping product through overlap extension PCR; S13: Cloning the overlapping product obtained in the step S12 onto the suicide vector pK18mobsacB to obtain a recombinant vector pK18mobsacB-PPT; S14: Transforming the recombinant plasmid into competent E. coli DH5α and screening for correct positive clones; S15: Extracting the plasmid from the positive clone obtained in step 4, transferring the recombinant suicide plasmid into competent E. coli WM3064 by heat shock transformation, and screening for positive clones to obtain the donor bacterium E. coli WM3064.

[0041] The present invention application successfully constructs a conditional deletion mutant of the PPTase gene of Pseudomonas plecoglossicida by means of double homologous recombination, and conducts biological phenotype research and cell and fish body virulence analysis on the deletion mutant.

[0042] It was found that, compared with the wild strain NB2011, the growth rate of the ΔPPT / pET22b-entD strain decreased; the mutant strain showed lysine auxotrophy; at the same time, compared with the wild strain, the siderophore production of the mutant strain decreased significantly. Using murine macrophage J774A.1 as a cell model, the adhesion of the wild strain and the mutant strain ΔPPT / pET22b-entD to macrophages and their intracellular proliferation after being internalized by the cells were counted. The proliferation rate and the number of bacterial cells of ΔPPT / pET22b-entD were significantly lower than those of the wild strain NB2011. When artificially infecting large yellow croaker by intraperitoneal injection at a concentration of 1×106 cells / mL, the mortality rate of the mutant strain infection group was 30%, while that of the wild strain was 75%, indicating that the virulence of the mutant strain to large yellow croaker was significantly weakened. The deletion of the PPTase gene can significantly reduce the virulence of Pseudomonas plecoglossicida. The results of this invention can provide a reference for the in-depth study of the pathogenic mechanism of this bacterium and the subsequent screening of related vaccines.

[0043] As a preferred solution, the step S11 includes: designing two pairs of primers PPT-MF1 / MF2 and PPT-MR1 / MR2 using the genomic DNA of Pseudomonas plecoglossicida NB2011 as a template, and respectively performing PCR amplification of the 780 bp upstream homologous arm fragment and the 742 bp downstream homologous arm fragment of PPTase through these two pairs of primers. Among them, the sequences of PPT-MF1 / MF2 and PPT-MR1 / MR2 are shown in SEQ.ID.NO:1-4, specifically: PPT-MF1: GCTCTAGACCTTGTCGGCTATTACGC; PPT-MF2: ACAATACCCGCCATGAACCGTCTGAACGTTACTGCG; PPT-MR1: CGCAGTAACGTTCAGACGGTTCATGGCGGGTATTGT; PPT-MR2: CGGGATCCGCAGCCTTCAATGGCATG; The step S13 includes: respectively performing double digestion on the upstream and downstream homologous arm fragments of the PPTase gene obtained by PCR amplification and the pK18mobsacB plasmid using XbaⅠ and BamHⅠ. After digestion, a ligation product pK18mobsacB-PPT is obtained by means of low-temperature ligation.

[0044] As a preferred solution, step S14 includes: transferring the obtained recombinant product into Escherichia coli DH5α competent cells, spreading them on a plate containing 50 μg / mL kanamycin, culturing overnight at 37 °C, performing PCR on the obtained colonies using universal primers M13F(-47) / M13R(-48), screening for positive clones, and sequencing. Among them, the sequences of M13F(-47) and M13R(-48) are shown in SEQ.ID.NO:5-6, specifically: M13F(-47): CGCCAGGGTTTTCCCAGTCACGAC M13R(-48): AGCGGATAACAATTTCACACAGGA; Step S15 includes: using a plasmid extraction kit to extract the recombinant vector pK18mobsacB-PPTase from the positive clone strain obtained in S14, transforming the extracted recombinant vector into Escherichia coli WM3064 competent cells, spreading them on an LB plate containing 50 μg / mL kanamycin and 0.3 mM 2,6-diaminopimelic acid, and culturing overnight at 37 °C; after single colonies grow out, performing PCR using universal primers M13F(-47) / M13R(-48), screening for positive clones, and sequencing to obtain the donor bacterium E. coli WM3064.

[0045] As a preferred solution, step S2 includes: S21: Using the method of conjugation transfer, transform the pre-constructed complementary plasmid pET22b-entD into P. plecoglossicida NB2011; S22: Identify the single colonies obtained in step 5.1 to obtain positive clones, that is, the recipient bacterium P. plecoglossicida NB2011.

[0046] As a preferred solution, step S3 includes: S31: Incubate the donor bacterium E. coli WM3064 prepared in step S1 and the recipient bacterium P. plecoglossicida NB2011 prepared in step S2 on an LB plate containing kanamycin and ampicillin, then perform conjugation transfer, and screen for strains carrying the plasmid as insertion mutation positive clones through a single homologous recombination; S32: Dilute and spread the positive clone bacterial solution obtained in step S31 on an LB plate containing sucrose, culture overnight, screen, identify, and sequence through a second homologous recombination to obtain the Pseudomonas plecoglossicida PPTase conditional deletion mutant strain ΔPPT / pET22b-entD.

[0047] As a preferred solution, in step S31, in the LB plate, the content of kanamycin is 50 μg / mL, the content of ampicillin is 100 μg / mL, and the incubation condition is incubation at 28 °C for 48 h; in step S32, in the LB plate, the mass content of sucrose is 30%, and the overnight culture temperature is 28 °C.

[0048] The following provides specific examples combined with data and experimental conditions to further expand the technical solutions within the above scope of the present invention: Example: This example provides a marker-free gene deletion mutant strain of Pseudomonas plecoglossicida and its construction method and application. The mutant strain is named ΔPPT / pET22b-entD P. plecoglossicida NB2011, and the mutant strain has been transformed with the recombinant plasmid pET22b-entD and lacks the coding sequence of the endogenous phosphopantetheinyl transferase. The deposit number of ΔPPT / pET22b-entD P. plecoglossicida NB2011 is CGMCC No. 33817, the deposit location is the General Microbiology Center of the China Microbial Culture Collection Center, the deposit date is March 14, 2025, and the address of the deposit unit is No. 13, Beiyitiao, Zhongguancun, Haidian District, Beijing.

[0049] The specific steps of the construction method are as follows: S1: Construct the donor bacterium S11: Using the genomic DNA of Pseudomonas plecoglossicida NB2011 as a template, design two pairs of primers PPT-MF1 / MF2 and PPT-MR1 / MR2, and amplify the upstream homologous arm (780 bp) and downstream homologous arm (742 bp) of PPTase respectively; The specific sequences of the primers are shown in SEQ ID NO:1-4 as follows: PPT-MF1: GCTCTAGACCTTGTCGGCTATTACGC; PPT-MF2: ACAATACCCGCCATGAACCGTCTGAACGTTACTGCG; PPT-MR1: CGCAGTAACGTTCAGACGGTTCATGGCGGGTATTGT; PPT-MR2: CGGGATCCGCAGCCTTCAATGGCATG; S12: Through overlap extension PCR, connect the amplified upstream homologous arm and downstream homologous arm to construct a complete upstream and downstream homologous arm fragment of PPTase; S13: Perform double digestion of the overlapping PCR product and the suicide vector pK18mobsacB with XbaⅠ / BamHⅠ, and ligate them at low temperature to obtain the recombinant plasmid pK18mobsacB-PPT; S14: Transfer the recombinant plasmid into competent E. coli DH5α cells, culture them overnight at 37°C on a plate containing 50 μg / mL kanamycin, screen for positive clones by PCR using the universal primers M13F(-47) / M13R(-48), and verify by sequencing; The specific sequences of the primers are shown in SEQ ID NO:5-6, as follows M13F(-47): CGCCAGGGTTTTCCCAGTCACGAC M13R(-48): AGCGGATAACAATTTCACACAGGA S15: Use a plasmid extraction kit to extract pK18mobsacB-PPT, and transform it into competent E. coli WM3064. Culture it overnight at 37°C on an LB plate containing 50 μg / mL kanamycin and 0.3 mM 2,6-diaminopimelic acid (DAP). Subsequently, use M13F(-47) / M13R(-48) to screen for positive clones by PCR, and confirm by sequencing to obtain the donor bacterium E. coli WM3064 (pK18mobsacB-PPT;

[0050] S2: Construct the recipient bacterium S21: Transform the complementary plasmid pET22b-entD into competent E. coli WM3064 cells, and culture them overnight at 37°C on an LB plate containing 100 μg / mL ampicillin and 0.3 mM DAP; S22: Perform conjugation transfer of the screened pET22b-entD positive clone strain with P. plecoglossicida NB2011, and incubate it on an LB (DAP = 0.3 mM) plate at 28°C for 48 h. Subsequently, resuspend the bacterial lawn with liquid LB (DAP = 0.3 mM), dilute and spread it on a plate containing 100 μg / mL ampicillin. After PCR identification of the screened colonies, it is P. plecoglossicida NB2011 (pET22b-entD), which is the recipient bacterium;

[0051] S3: Induce homologous recombination to obtain the ΔPPT deletion mutant S31: Mix the donor bacterium (E. coli WM3064 (pK18mobsacB-PPT)) with the recipient bacterium (P.plecoglossicida NB2011 (pET22b-entD)), incubate on an LB plate containing 50 μg / mL kanamycin and 100 μg / mL ampicillin at 28 °C for 48 h to complete conjugative transfer. Then, resuspend the bacterial lawn with liquid LB (DAP = 0.3 mM), dilute and spread on a plate containing 50 μg / mL kanamycin and 100 μg / mL ampicillin. Perform PCR identification on the selected colonies using the PPT-wS / wA and PPT-dS / dA primers to confirm the acquisition of single crossover positive clone strains;

[0052] The PCR identification primers are as follows: PPT-wS: CGAGCAGTGTGTTGAAGG; PPT-wA: CGAAGTACGCCTGAGCTA; PPT-dS: CAAGGCTGAAATGGACGC; PPT-dA: TTGCTGGTGCTCATCACC; S32: Inoculate the obtained single crossover strain into fresh LB liquid medium and culture overnight at 28 °C; After diluting the bacterial solution, spread it on an LB plate containing 30% sucrose and 100 μg / mL ampicillin and culture overnight at 28 °C to perform secondary homologous recombination screening using sucrose resistance screening; Finally, after PCR identification and sequencing verification, the markerless deletion mutant strain ΔPPT / pET22b-entD of the PPTase gene of Pseudomonas plecoglossicida was successfully obtained.

[0053] As Figures 1 - 5 shown, Figure 1 is the electrophoresis analysis diagram of the upstream and downstream homologous arm amplification products of the PPTase gene. Among them, lane 1: upstream homologous arm fragment; lane 2: downstream homologous arm fragment; M: DL2000 DNA Marker; Figure 2 is the electrophoresis analysis diagram of the PCR amplification product of the upstream and downstream homologous arm fusion fragment of the PPTase gene. Among them, lane 1 is the upstream and downstream homologous arm fusion fragment; M: DL2000 DNA Marker; Figure 3Electrophoresis analysis diagram of the colony PCR amplification product of the recombinant suicide plasmid pK18mobSacB-PPTase. Among them, lanes 1, 3-5: empty plasmid; lanes 2 and 6: pK18mobSacB-PPTase recombinant suicide plasmid; M: DL5000 DNA Marker; Figure 4 Electrophoresis analysis diagram of the colony PCR amplification product of the recipient bacterium P. plecoglossicida NB2011 (pET22b-entD) positive clone strain. Among them, lanes 1-3: P. plecoglossicida NB2011 (pET22b-entD); M: DL5000 DNA Marker; Figure 5 Electrophoresis analysis diagram of the colony PCR amplification product of the single crossover bacterium. Among them, A: PPTase-wS / PPTase-wA; B: PPTase-dS / PPTase-dA; lanes 1-10: positive clones; lane 11: wild-type NB2011 strain control; M: DL5000 DNA Marker.

[0054] For the biological phenotype research and analysis of the Pseudomonas plecoglossicida PPTase gene deletion mutant strain ΔPPT / pET22b-entD prepared in the embodiment of the present invention, the following method was used to analyze the biological phenotype of the Pseudomonas plecoglossicida PPTase gene deletion mutant strain ΔPPT / pET22b-entD, specifically as follows: The PCR detection result of the Pseudomonas plecoglossicida PPTase gene deletion mutant strain of the present invention is as Figure 6 shown Figure 6 After PCR identification and sequencing with primers PPT-wA and PPT-dS (lanes 1-3), the Pseudomonas plecoglossicida PPTase gene deletion mutant strain ΔPPT / pET22b-entD was obtained.

[0055] To study the effect of PPTase gene deletion on the growth of Pseudomonas plecoglossicida, the present invention analyzed the growth rates of the wild strain and the mutant strain by the following Method 1, as Figure 7 shown. The results showed that there was basically no difference in the growth of the wild strain and the mutant strain in the first 6 h. After 6 h, the growth rate of ΔPPT / pET22b-entD was always lower than that of the wild strain until the 14th h, but the difference was not significant (P>0.05). This also revealed that the introduction of the Escherichia coli entD gene could basically compensate for the effect of PPTase deletion on the growth of this bacterium.

[0056] Method 1: Growth curve determination Pick single colonies of freshly activated NB2011 and ΔPPT / pET22b-entD strains, inoculate them into fresh LB liquid medium, and culture overnight at 28°C with 180 rpm; Take the overnight culture, adjust the bacterial concentration to OD600 = 0.6 with sterile LB liquid medium, and transfer it to 100 mL LB medium at a ratio of 1:100, and culture it on a shaker at 28°C; Taking the transfer time as 0 h, measure the OD600 values at 3 h - 13 h at intervals of 1 h, and plot the growth curve of culture time (X-axis) - OD600 value of the bacterial solution (Y-axis).

[0057] Immediately afterwards, the growth of wild-type and mutant strains in M9 minimal medium (using glucose as the sole carbon source) with and without lysine nutrient was analyzed by the following Method 2, as Figure 8 , when lysine was not added, the wild-type strain NB2011 could grow normally, while ΔPPT / pET22b-entD showed weak growth, and its growth rate was extremely significantly lower than that of the wild-type strain (P < 0.001); when 50 µg / mL lysine was added to the medium, both NB2011 and ΔPPT / pET22b-entD could grow normally, but the growth rate of the conditional mutant strain was significantly lower than that of the wild-type strain (P < 0.05), indicating that the deletion of the PPTase gene led to the dependence of the bacteria on lysine nutrient.

[0058] Method 2: Bacterial growth under lysine auxotrophic conditions Pick single colonies of freshly activated NB2011 and ΔPPT / pET22b-entD strains, inoculate them into fresh LB liquid medium, and culture overnight at 28°C with 180 rpm.

[0059] Take the overnight culture, adjust the bacterial concentration to OD600 = 0.6 with sterile LB liquid medium, and transfer it to M9 minimal medium (using glucose as the sole carbon source) at a ratio of 1:100 respectively. Experimental groups with added lysine and without added lysine were set up, and cultured overnight on a shaker at 28°C.

[0060] Measure the OD600 values and plot the curve of lysine concentration (X-axis) - OD600 value of the bacterial solution (Y-axis). Take the average value of 3 repeated experiments for analysis.

[0061] To test whether the ability of Pseudomonas plecoglossicida ΔPPT / pET22b-entD to produce siderophores has changed, the present invention was detected according to the operation of the following Method 3, and the results are as Figure 9As shown in the figure, in the succinic acid medium with limited iron, the relative amount of siderophore activity of the wild strain NB2011 was 29.49%, and that of ΔPPT / pET22b-entD was 15.39%, which was significantly lower than that of the wild strain (P < 0.01). This indicates that the deletion of the PPTase gene reduces the ability of Pseudomonas plecoglossicida to produce siderophores.

[0062] Method 3: Determination experiment of siderophores in culture supernatant Pick single colonies of freshly activated NB2011 and ΔPPT / pET22b-entD strains, inoculate them into fresh LB liquid medium, and culture overnight at 28°C and 180 rpm; take the overnight culture, adjust the bacterial liquid concentration to OD600 = 0.6, and transfer it to 30 ml of succinic acid medium at a ratio of 1:100, and culture at 28°C until the late logarithmic phase; centrifuge at 4°C at 12,000 rpm for 10 min to collect the supernatant, and after centrifugation, take the supernatant solution and filter it through a 0.22 µm sterilized needle filter; take the filtered supernatant and mix it thoroughly with an equal volume of CAS detection solution, incubate for 1 h under dark conditions, and measure the absorbance at 630 nm after incubation. The blank control group is the uninoculated succinic acid medium; after the experiment, calculate the relative amount of siderophore activity (%) according to the formula: Relative amount of siderophore activity (%) = (Ar - As) / Ar × 100%.

[0063] To further study the pathogenic mechanism of Pseudomonas plecoglossicida and explore the role of the PPTase gene in the virulence of this bacterium, the present invention observed the adhesion of the wild strain NB2011 and the mutant strain ΔPPT / pET22b-entD to mouse macrophages J774A.1 and their intracellular proliferation after being internalized by the cells according to the operation of Method 4, specifically as Figure 10 shown. As can be seen from the figure, compared with the wild strain, the adhesion rate of ΔPPT / pET22b-entD to macrophages was slightly lower; at 4 h after internalization, obvious proliferation occurred in all strains, and the proliferation trend continued until 24 h after internalization; during the period of 4 h - 24 h after internalization, the proliferation rate and the number of bacterial cells of ΔPPT / pET22b-entD were significantly lower than those of the wild strain NB2011. The results suggest that this gene is involved in the intracellular proliferation process of the bacterial cells, and the deletion mutation of the PPTase gene affects the effective proliferation of this bacterium in macrophages.

[0064] Method 4: Observation of the adhesion, internalization and proliferation characteristics of the wild strain and the mutant strain ΔPPT / pET22b-entD to mouse macrophages J774A.1: Step 1: Resuscitate NB2011 and the ΔPPT / pET22b-entD mutant strain on an LB plate, pick a single colony and inoculate it into LB medium, and culture overnight at 28°C and 180 rpm.

[0065] Step 2: After subculturing mouse macrophage J774A.1 for 3 passages, seed them in a 24-well plate at a density of 10 6 cells / well and culture in an incubator at 37°C and 5% CO2 until the cells are nearly confluent.

[0066] Step 3: Infect the macrophages with the test bacterial suspension. According to the macrophage count results in the 96-well plate, add DMEM to resuspend and quantify the bacterial suspension at a multiplicity of infection (MOI) of 10:1, and continue to culture in an incubator at 30°C and 5% CO2.

[0067] Step 4 (Adhesion analysis): After culturing for 1 h, wash the cells 3 times with PBS to remove non-adherent bacteria, then add 1% TritonX-100 to lyse the cells, and use the plate culture method to determine the number of viable colonies in the lysate. The final value represents the adhesion value.

[0068] Step 5 (Internalization analysis): In the remaining wells, wash 3 times with PBS, then add DMEM medium containing 200 μg / mL gentamicin and incubate at 30°C for 2 h to kill extracellular bacteria and detect the number of internalized bacteria.

[0069] Step 6: Wash 3 times with PBS to remove gentamicin, add 500 μL of 1% Triton X-100 to lyse the cells, spread the lysate on a Chromagar plate and count the number of viable bacteria.

[0070] Step 7 (Proliferation analysis): Wash 6 times with PBS to remove gentamicin, then add DMEM medium containing 10% fetal bovine serum and continue to culture the cells at 30°C. Starting from this point as zero, remove the medium every 4 h, add 500 μL of 1% Triton X-100 to lyse the cells, and use the plate culture method to detect the number of bacteria in the lysate. The final value represents the proliferation amount.

[0071] Immediately following Method 5, a virulence analysis experiment using large yellow croaker as the experimental animal was conducted. The fish were artificially infected by intraperitoneal injection at a concentration of 1×106 cells / mL, and the disease onset and mortality of the fish were observed within 7 days. As shown in Table 1, compared with the wild strain, the virulence of ΔPPT / pET22b-entD was significantly weakened.

[0072] Method 5: Virulence analysis experiment on large yellow croaker Experimental animal: Healthy large yellow croaker (body weight 50 ± 10 g) were selected and aerated and temporarily cultured in the breeding room for ≥ 1 week.

[0073] Experimental design: Twenty large yellow croaker were in each group, and 0.1 mL of the bacterial suspension with a concentration of 1.0×10 6 cells / mL was injected intraperitoneally. The control group was injected with the same dose of PBS.

[0074] Observation index: The disease onset and mortality of the fish were observed daily. The dead large yellow croaker were dissected, and the bacteria were aseptically isolated from the spleen and inoculated onto a Pseudomonas chromogenic plate to confirm whether the death was caused by Pseudomonas plecoglossicida infection. The experiment lasted for 7 days, and the mortality was counted. During the experiment, the water temperature was maintained at 20 ± 1°C.

[0075] Table 1 Virulence test of the mutant strain on large yellow croaker The above results indicate that the conditional deletion of the PPTase gene partially affects the growth ability of Pseudomonas plecoglossicida, reduces the production of siderophores, shows dependence on lysine nutrition, and demonstrates that the PPTase gene plays an important role in the growth process of Pseudomonas plecoglossicida and the production of secondary metabolites such as lysine and siderophores; the deletion of the PPTase gene not only affects the biological phenotype of Pseudomonas plecoglossicida but also significantly reduces its virulence to the host.

[0076] In summary, the PPTase of Pseudomonas plecoglossicida cannot be directly knocked out. The conditional deletion mutant strain ΔPPT / pET22b-entD shows a relatively weak growth and low virulence state, indicating that the PPTase gene is a key survival factor in Pseudomonas plecoglossicida and also plays an important role in the virulence mechanism of this bacterium. Therefore, the results of this invention can provide a partial basis for further in-depth study of the pathogenic mechanism of this bacterium and the development of effective prevention and control technologies.

[0077] In the description of the present application, the descriptions referring to terms such as "one embodiment", "some embodiments", "in this embodiment", "specific examples", or "some examples", etc. mean that the specific features, structures, materials, or characteristics described in connection with the embodiment or example are included in at least one embodiment or example of the present application. In this specification, the schematic expressions of the above terms do not necessarily refer to the same embodiment or example. Moreover, the specific features, structures, materials, or characteristics described can be combined in a suitable manner in any one or more embodiments or examples. In addition, without contradiction, those skilled in the art can combine and combine the different embodiments or examples described in this specification and the features of different embodiments or examples.

[0078] As described above, it is only the specific implementation manner of the present application, but the protection scope of the present application is not limited thereto. Any changes or substitutions that can be easily thought of by those skilled in the art within the technical scope disclosed in the present application should be covered by the protection scope of the present application. Therefore, the protection scope of the present application should be subject to the protection scope of the claims.

Claims

1. An unmarked gene deletion mutant strain of Pseudomonas plecoglossicida, characterized in that, The mutant strain is named Pseudomonas plecoglossicida, and the mutant strain has been transformed with the recombinant plasmid pET22b-entD and lacks the coding sequence of the endogenous phosphopantetheinyl transferase.

2. The markerless gene deletion mutant of Pseudomonas plecoglossicida according to claim 1, characterized in that, The preservation number of Pseudomonas plecoglossicida is CGMCC No. 33817. The preservation location is the General Microbiology Center of the China Microbial Culture Collection Center. The preservation date is March 14, 2025. The address of the preservation unit is No. 13, Beiyitiao, Zhongguancun, Haidian District, Beijing.

3. Use of the markerless gene deletion mutant of Pseudomonas plecoglossicida according to any one of claims 1-2, characterized in that, The applications include the applications of the mutant strain in changing the virulence of the bacterial cells, studying the pathogenic mechanism of Pseudomonas plecoglossicida, and serving as a candidate vaccine strain for vaccine research and development.

4. A method for constructing a marker-free gene deletion mutant of Pseudomonas plecoglossicida, as described in any one of claims 1-2, characterized in that, It includes the following steps: S1: Constructing the donor bacterium: Constructing a suicide plasmid containing the deleted fragment of the PPTase gene and introducing it into the donor bacterium E. coli WM3064. S2: Constructing the recipient bacterium: Constructing the recombinant plasmid pET22b-entD containing the Escherichia coli phosphopantetheinyl transferase gene and transferring it into P. plecoglossicida NB2011 to obtain the recipient bacterium. S3: Inducing homologous recombination to obtain the ΔPPT deletion mutant strain: Through the conjugation transfer of the donor bacterium and the recipient bacterium, double homologous recombination is achieved, and the ΔPPT / pET22b-entD mutant strain is screened and identified.

5. The construction method according to claim 4, characterized in that The step S1 includes: S11: Designing primers using the genomic DNA of Pseudomonas plecoglossicida NB2011 as a template and PCR amplifying the upstream and downstream sequences of PPTase. S12: Using the upstream and downstream sequences of the PPTase gene amplified in the step S11 to obtain an overlapping product through overlap extension PCR. S13: Cloning the overlapping product obtained in the step S12 onto the suicide vector pK18mobsacB to obtain the recombinant vector pK18mobsacB-PPT. S14: Transforming the recombinant plasmid into the competent E. coli DH5α and screening out the correct positive clones. S15: Extracting the plasmid from the positive clones obtained in step 4, and by the method of heat shock transformation, transferring the recombinant suicide plasmid into the competent E. coli WM3064 and screening for positive clones to obtain the donor bacterium E. coli WM3064.

6. The construction method according to claim 5, characterized in that The step S11 includes: Designing two pairs of primers PPT-MF1 / MF2 and PPT-MR1 / MR2 using the genomic DNA of Pseudomonas plecoglossicida NB2011 as a template, and respectively performing PCR amplification of the upstream homologous arm fragment of 780 bp and the downstream homologous arm fragment of 742 bp of PPTase by these two pairs of primers. Among them, the sequences of PPT-MF1 / MF2 and PPT-MR1 / MR2 are shown in SEQ.ID.NO:1-4, specifically: PPT-MF1: GCTCTAGACCTTGTCGGCTATTACGC; PPT-MF2: ACAATACCCGCCATGAACCGTCTGAACGTTACTGCG; PPT-MR1: CGCAGTAACGTTCAGACGGTTCATGGCGGGTATTGT; PPT-MR2: CGGGATCCGCAGCCTTCAATGGCATG; The step S13 includes: performing double digestion on the upstream and downstream homologous arm fragments of the PPTase gene obtained by PCR amplification and the plasmid pK18mobsacB respectively using XbaⅠ and BamHⅠ. After digestion, a ligation product pK18mobsacB-PPT is obtained by means of low-temperature ligation.

7. The construction method according to claim 5, characterized in that The step S14 includes: transferring the obtained recombinant product into competent cells of Escherichia coli DH5α, coating it on a plate containing 50 μg / mL kanamycin, culturing overnight at 37°C, performing PCR on the obtained colonies using universal primers M13F(-47) / M13R(-48) to screen for positive clones and sequencing them. Among them, the sequences of M13F(-47) and M13R(-48) are shown as SEQ.ID.NO:5-6, specifically: M13F(-47): CGCCAGGGTTTTCCCAGTCACGAC M13R(-48): AGCGGATAACAATTTCACACAGGA; The step S15 includes: using a plasmid extraction kit to extract the recombinant vector pK18mobsacB-PPTase from the positive clone strain obtained in S14, transforming the extracted recombinant vector into competent Escherichia coli WM3064, coating it on an LB plate containing 50 μg / mL kanamycin and 0.3 mM 2,6-diaminopimelic acid, and culturing overnight at 37°C; after single colonies grow out, performing PCR using universal primers M13F(-47) / M13R(-48) to screen for positive clones and sequencing them to obtain the donor bacterium E. coli WM3064.

8. The construction method according to claim 4, characterized in that, The step S2 includes: S21: transforming the pre-constructed complementary plasmid pET22b-entD into P. plecoglossicida NB2011 by means of conjugation transfer; S22: identifying the single colonies obtained in step 5.1 to obtain positive clones, namely the recipient bacterium P. plecoglossicida NB2011.

9. The construction method according to claim 4, characterized in that The step S3 includes: S31: incubating the donor bacterium E. coli WM3064 prepared in step S1 and the recipient bacterium P. plecoglossicida NB2011 prepared in S2 on an LB plate containing kanamycin and ampicillin, then performing conjugation transfer, and screening the strains carrying the plasmid as insertion mutation positive clones through a single homologous recombination. S32: Dilute and spread the positive clone bacterial liquid in step S31 on an LB plate containing sucrose, incubate overnight, screen, identify, and sequence through secondary homologous recombination to obtain the Pseudomonas plecoglossicida PPTase conditional deletion mutant strain ΔPPT / pET22b-entD.

10. The construction method according to claim 9, characterized in that, In the said step S31, in the said LB plate, the content of kanamycin is 50 μg / mL, the content of ampicillin is 100 μg / mL, and the incubation conditions are to incubate at a temperature of 28 °C for 48 h; in the said step S32, in the said LB plate, the mass content of sucrose is 30%, and the temperature for overnight incubation is 28 °C.

Images