Compositions for in vitro detection of various cancers and uses thereof

Abstract

The invention provides a composition for simultaneously detecting multiple cancers in vitro and application thereof, the composition comprises nucleic acid for detecting the methylation state of a target gene, the methylation state of the target gene is characterized by methylation of a target sequence of the target gene, and the target gene is a UBQLN1 gene and / or a UBALD1 gene. The invention also provides a kit comprising the composition, and application of the composition in preparation of the kit for detecting various cancers in vitro.

Description

Technical Field

[0001] This application belongs to the field of molecular biology and relates to gene detection. Specifically, it relates to a nucleic acid composition for in vitro detection of methylation of multiple cancer-related genes, as well as a corresponding kit and use thereof. Background Art

[0002] Currently, cancers with relatively high incidence and mortality rates in the world include lung cancer, liver cancer, gastric cancer, colorectal cancer, esophageal cancer, ovarian cancer, etc. In clinical practice, early-stage cancers can be cured. However, due to the lack of obvious symptoms in the early stage of cancer, when patients go to the hospital for treatment with obvious clinical symptoms, most tumors have reached the middle and late stages, and the treatment effect is not ideal. The 5-year survival rate after surgery is less than 30%. Therefore, achieving early diagnosis and early treatment is the key to improving the survival rate of cancer patients.

[0003] Currently, the technical means clinically applied to the early screening and diagnosis of lung cancer mainly include imaging examinations, hematological examinations, pathological examinations, etc. However, these means all have certain limitations: for example, obtaining lung cancer tissue through surgery or puncture for pathological examination is the gold standard for lung cancer diagnosis, but it has a large operation difficulty and a large trauma to patients; low-dose spiral CT (LD-CT) chest scans can reduce the overall lung cancer mortality by increasing the detection rate of early lung cancer, but its high false positive rate and possible radiation damage are worrying; clinically commonly used serological tumor markers, such as the five lung cancer markers (CEA, CYFRA21-1, SCC, Pro-GRP, NSE), etc., are used as auxiliary diagnostic means for lung cancer, but the detection sensitivity of these traditional serological tumor markers for early lung cancer is low and cannot meet the requirements of early screening.

[0004] Currently, the technical means clinically applied to the early screening and diagnosis of liver cancer mainly include the traditional screening means of "abdominal ultrasound + serum alpha-fetoprotein detection", but this means far from meets the clinical needs of screening early HCC, and there are problems such as low screening implementation rate, low sensitivity for screening early HCC, and new challenges to HCC screening formed by changes in the basic causes of liver cancer.

[0005] Currently, the technical means clinically applied to the early screening and diagnosis of gastric cancer mainly include gastroscopy (electronic gastroscopy, high-definition screening gastroscopy, magnetic control capsule gastroscopy, etc.) and serological screening (Hp detection, serum PG, G-17, and common tumor markers). Gastroscopy is an invasive examination with complex preoperative preparations. The cost of magnetic control capsule gastroscopy is higher than that of traditional electronic gastroscopy, and the effective and reasonable allocation of resources is limited. The common serological screening markers have insufficient sensitivity and low specificity.

[0006] Currently, the technical means applied clinically for the early screening and diagnosis of colorectal cancer mainly include fecal detection methods such as fecal immunochemical test (FIT) and colonoscopy. FIT is the most widely used early screening technology for colorectal cancer at present, but its specificity is not high and there are many false positives. Colonoscopy is the most sensitive examination method for detecting intestinal tumors, but the detection rate of lesions by colonoscopy is affected by factors such as intestinal preparation, endoscopic operation technique, the examiner's ability to identify lesions, and examination time. A large amount of water needs to be drunk for intestinal preparation before colonoscopy, and there is a risk of perforation during the examination. These factors limit colonoscopy as the primary means for large-scale screening. Flexible sigmoidoscopy only has a diagnostic effect on the examined part of the colon, and its application has limitations. Digital rectal examination can effectively detect low rectal tumors, and it is recommended that the general population undergoing physical examinations have digital rectal examinations, but the screening value of digital rectal examination for rectal tumors is unclear.

[0007] Currently, the technical means applied clinically for the early screening and diagnosis of esophageal cancer mainly include endoscopy and pathological biopsy. For esophageal cancer, there is still a lack of "pre-screening" measures (such as serological tests) similar to those for gastric cancer screening, so it is difficult to improve the screening positive rate. In addition, the combined operation technique of iodine staining of esophageal mucosa or electronic staining + indicative biopsy under endoscopy has become the most practical and effective screening method at the present stage in China. Screening methods such as esophageal exfoliative cytology examination and upper gastrointestinal barium examination used in the past have been no longer used for esophageal cancer screening due to problems such as low diagnostic efficiency and easy esophageal injury.

[0008] Currently, the technical means applied clinically for the early screening and diagnosis of ovarian cancer mainly include ultrasound and serum marker detection. However, existing research data based on the general population show that whether it is carbohydrate antigen (CA) 125, transvaginal ultrasound alone or the combination of the two, none of them can achieve satisfactory screening results. Further exploration is needed for the screening methods for the general population.

[0009] Large-scale clinical data analysis found that for the above six types of cancers, imaging examinations have a relatively high false positive rate or false negative rate, so there is a risk of overdiagnosis or missed diagnosis. In addition, imaging examinations have certain limitations in terms of equipment cost, operation technique, result interpretation, and radiation hazards. Various endoscopic examinations are highly invasive and not suitable for large-scale popularization. If the general population undergoing physical examinations hopes to complete the screening and diagnosis of the above six types of high-incidence and high-fatality cancers, they need to register for examinations in the corresponding departments one by one, which has a long cycle, high cost, and low efficiency. Summary of the Invention

[0010] In view of the problems existing in the detection technologies for the above 6 common, highly prevalent, and highly lethal cancers (lung cancer, liver cancer, gastric cancer, colorectal cancer, esophageal cancer, ovarian cancer), the present application provides a nucleic acid composition for simultaneously detecting multiple cancers in vitro. The composition provided by the present application can sensitively and specifically detect lung cancer, liver cancer, gastric cancer, colorectal cancer, esophageal cancer, and ovarian cancer. The present application also provides a kit containing the composition and its use in detecting the above multiple cancers. The kit provided by the present application has good cancer detection sensitivity and can sample once, conveniently, quickly, and effectively detect the above 6 common, highly prevalent, and highly lethal cancers simultaneously.

[0011] The specific technical solution of the present application is as follows:

[0012] 1. A composition for simultaneously detecting multiple cancers in vitro, the composition comprising:

[0013] Nucleic acids for detecting the methylation status of target genes,

[0014] wherein the methylation status of the target gene is characterized by the methylation of the target sequence of the target gene,

[0015] wherein the target gene is the UBQLN1 gene and / or the UBALD1 gene.

[0016] 2. The composition according to item 1, wherein the target sequence of the UBQLN1 gene is as shown in any one of SEQ ID NO: 1-4, or the target sequence of the UBQLN1 gene comprises a sequence as shown in any one of SEQ ID NO: 1-4.

[0017] 3. The composition according to item 1, wherein the target sequence of the UBALD1 gene is as shown in any one of SEQ ID NO: 5-8, or the target sequence of the UBALD1 gene comprises a sequence as shown in any one of SEQ ID NO: 5-8.

[0018] 4. The composition according to any one of items 1 to 3, wherein the nucleic acids for detecting the methylation status of the target gene comprise:

[0019] Primers, the primers being fragments of at least 9 nucleotides in the target sequence of the target gene,

[0020] The fragment contains at least one CpG dinucleotide sequence.

[0021] 5. The composition according to any one of items 1 to 4, wherein the nucleic acids for detecting the methylation status of the target gene comprise:

[0022] Probes, the probes being fragments of at least 15 nucleotides that hybridize to the target sequence of the target gene under medium stringency or stringent conditions,

[0023] The fragment contains at least one CpG dinucleotide sequence.

[0024] 6. The composition according to any one of items 1 to 5, further comprising:

[0025] A reagent for converting the unmethylated cytosine base at the 5th position of the target sequence of the target gene into uracil.

[0026] 7. The composition according to any one of items 1 to 6, wherein the nucleic acid for detecting the methylation status of the target gene further comprises:

[0027] A blocker that preferentially binds to the target sequence in the unmethylated state.

[0028] 8. The composition according to item 7, wherein

[0029] The fragment of at least 9 nucleotides is the sequence of SEQ ID NO:9 and SEQ ID NO:10, or it is the sequence of SEQ ID NO:11 and SEQ ID NO:12.

[0030] 9. The composition according to item 7, wherein the fragment of at least 15 nucleotides is the sequence of SEQ ID NO:13, or the sequence of SEQ ID NO:14.

[0031] 10. An oligonucleotide for in vitro detection of multiple cancers, comprising:

[0032] A fragment of at least 9 nucleotides of the sequence shown in any one of SEQ ID NO:1-4 or its complementary sequence and containing at least one CpG dinucleotide sequence; and / or

[0033] A fragment of at least 9 nucleotides of the sequence shown in any one of SEQ ID NO:5-8 or its complementary sequence and containing at least one CpG dinucleotide sequence.

[0034] 11. The oligonucleotide according to item 10, further comprising:

[0035] Hybridizing to a fragment of at least 15 nucleotides of the sequence shown in any one of SEQ ID NO:1-4 or its complementary sequence and containing at least one CpG dinucleotide sequence under medium stringency or stringent conditions; and / or

[0036] Hybridizing to a fragment of at least 15 nucleotides of the sequence shown in any one of SEQ ID NO:5-8 or its complementary sequence and containing at least one CpG dinucleotide sequence under medium stringency or stringent conditions.

[0037] 12. The oligonucleotide according to item 10, further comprising:

[0038] A blocker that preferentially binds to a target sequence in a non-methylated state.

[0039] 13. An oligonucleotide for in vitro detection of multiple cancers, comprising:

[0040] The sequences of SEQ ID NO:9 and SEQ ID NO:10.

[0041] 14. The oligonucleotide according to item 13, further comprising:

[0042] The sequence of SEQ ID NO:13.

[0043] 15. An oligonucleotide for in vitro detection of multiple cancers, comprising:

[0044] The sequences of SEQ ID NO:11 and SEQ ID NO:12.

[0045] 16. The oligonucleotide according to item 15, further comprising:

[0046] The sequence of SEQ ID NO:14.

[0047] 17. A kit, comprising the composition according to any one of items 1-9 or the oligonucleotide according to any one of items 10-16.

[0048] 18. The kit according to item 17, further comprising at least one other component selected from the following:

[0049] Nucleoside triphosphates, DNA polymerase, and a buffer required for the function of the DNA polymerase.

[0050] 19. The kit according to item 17 or 18, wherein the samples for detection by the kit include: cell lines, histological sections, tissue biopsies / paraffin-embedded tissues, body fluids, feces, colonic effluents, urine, plasma, serum, whole blood, isolated blood cells, cells isolated from blood, or combinations thereof.

[0051] 20. The kit according to any one of items 17-19, further comprising: an instruction manual.

[0052] 21. Use of the composition according to any one of items 1-9 or the oligonucleotide according to any one of items 10-16 in the preparation of a kit for in vitro detection of multiple cancers.

[0053] 22. The use according to item 21, wherein the kit for in vitro detection of multiple cancers detects cancers by a method comprising the following steps:

[0054] 1) Isolate a DNA sample containing the target sequence or its fragment of the target gene from the biological sample to be tested;

[0055] 2) Determine the methylation status of the target sequence of the target gene;

[0056] 3) Judge the status of the biological sample based on the detection result of the methylation status of the target sequence of the target gene, so as to realize the in vitro detection of cancer.

[0057] 23. The use according to item 22, wherein the method comprises the following steps:

[0058] Extract genomic DNA from the biological sample to be tested;

[0059] Treat the extracted genomic DNA with a reagent to convert the unmethylated cytosine base at the 5th position into uracil or other bases;

[0060] Contact the DNA sample treated with the reagent with DNA polymerase and primers of the target sequence of the target gene to carry out DNA polymerization reaction;

[0061] Detect the amplified product with a probe; and

[0062] Based on the presence or absence of the amplified product, determine the methylation status of at least one CpG dinucleotide of the target sequence of the target gene.

[0063] 24. The use according to item 23, wherein the reagent is a bisulfite reagent.

[0064] 25. Use of UBQLN1 gene and / or UBALD1 gene in the preparation of a kit for in vitro detection of various cancers.

[0065] 26. The use according to item 25, wherein the target sequence of the UBQLN1 gene is shown in any one of SEQ ID NO: 1-4 or the target sequence of the UBQLN1 gene comprises a sequence shown in any one of SEQ ID NO: 1-4.

[0066] 27. The use according to item 25, wherein the target sequence of the UBALD1 gene is shown in any one of SEQ ID NO: 5-8 or the target sequence of the UBALD1 gene comprises a sequence shown in any one of SEQ ID NO: 5-8.

[0067] The present application has the following beneficial effects:

[0068] This application has screened out the UBQLN1 gene and UBALD1 gene, which are related to six types of cancers (lung cancer, liver cancer, gastric cancer, colorectal cancer, esophageal cancer, ovarian cancer), and determined the target sequences where abnormal methylation of the related markers occurs, enabling sensitive and specific detection of the methylation status of this gene. The composition described in this application is used for the screening of asymptomatic populations in a non-invasive manner, with the characteristic of being non-invasive and capable of realizing real-time monitoring. Therefore, this application provides a composition, a kit, and a detection method that can be used for in vitro detection of multiple cancers, can conveniently, quickly, and effectively detect the above six types of cancers, and has important clinical application value. Detailed Description of the Invention

[0069] The following provides a detailed description of this application. Although specific embodiments of this application are shown, it should be understood that this application can be implemented in various forms and should not be limited by the embodiments described herein. Instead, these embodiments are provided to enable a more thorough understanding of this application and to fully convey the scope of this application to those skilled in the art.

[0070] Unless otherwise specified, the implementation of this application will adopt conventional molecular biology (including recombinant technology), microbiology, cell biology, biochemistry, and genetics techniques, which are all within the scope of conventional technical means in the art. Such techniques are described in detail in the literature, such as Molecular Cloning: A Laboratory Manual, Second Edition (Sambrook et al., 1989); Oligonucleotide Synthesis (M.J. Gait, 1984 Edition); Animal Cell Culture (R.I. Freshney, 1987 Edition); Methods in Enzymology series (Academic Press, Inc., USA); Current Protocols in Molecular Biology (F.M. Ausubel et al., 1987 Edition, and updated regularly); PCR: The Polymerase Chain Reaction (Mullis et al., 1994 Edition). The primers, probes, blockers, and kits used in this application can be prepared using standard techniques well-known in the art.

[0071] Unless otherwise defined, the technical and scientific terms used in this application have the same meaning as commonly understood by those of ordinary skill in the art to which this application belongs.

[0072] Definitions

[0073] "Pre-cancer" in the present application refers to cells in the early stage of transformation into cancer cells or cells prone to transformation into cancer cells. Such cells may exhibit one or more phenotypic traits characteristic of cancer cells.

[0074] "Stringent hybridization conditions" and "highly stringent" in the present application refer to the conditions under which a probe hybridizes to its target sequence, typically in a complex mixture of nucleic acids. Stringent conditions are sequence-dependent and vary in different circumstances. Longer sequences hybridize specifically at higher temperatures. Detailed guidance on nucleic acid hybridization can be found in Tijssen, Biochemistry and Molecular Biology Techniques - Nucleic Acid Probe Hybridization, "Review of Principles of Hybridization and Strategies of Nucleic Acid Assays". Generally, stringent conditions are about 5-10 °C below the melting temperature (Tm) of a particular nucleic acid at a defined ionic strength and pH. At the Tm temperature (at the defined ionic strength, pH, and nucleic acid concentration), 50% of the probe complementary to the target hybridizes evenly to the target sequence. Stringent conditions can also be achieved by adding destabilizers. For selective or specific hybridization, a positive signal is twice the background hybridization, preferably 10 times. Exemplary stringent hybridization conditions are as follows: Hybridize at 42 °C in a solution of 50% formamide, 5x SSC, and 1% SDS, or hybridize at 65 °C in a solution of 5x SSC and 1% SDS, and then wash at 65 °C in a solution of 0.2x SSC and 0.1% SDS.

[0075] Moreover, even nucleic acids that do not hybridize under stringent conditions are substantially similar if the polypeptides encoded by the nucleic acids are substantially similar. In such cases, typically, the nucleic acids are hybridized under moderately stringent hybridization conditions. As an example, "moderately stringent hybridization conditions" include hybridizing at 37 °C in a solution of 40% formamide, 1 M sodium chloride, and 1% SDS, and washing at 45 °C in a solution of 1x SSC. Those of ordinary skill in the art can clearly obtain guidance on conditions for achieving the same stringency in the prior art. For PCR, a temperature of about 36 °C typically applies to low-stringency amplification, while the annealing temperature ranges from 32 °C to 48 °C based on the length of the primers. For highly stringent PCR amplification, it is generally at 62 °C, while the annealing temperature for highly stringent hybridization ranges from 50 °C to 65 °C based on the length and specificity of the primers. For the cycling conditions of highly stringent and low-stringency amplifications, typically, they include: a denaturation stage at 90-95 °C for 30 seconds to 2 minutes, an annealing stage for 30 seconds to 2 minutes, and an extension stage at about 72 °C for 1 to 2 minutes. Tools and guidance on low- and high-stringency amplification reactions can be obtained in the prior art.

[0076] "Oligonucleotide" in the present application refers to a molecule composed of two or more nucleotides, preferably a molecule composed of more than three nucleotides, and its exact size can depend on many factors, which in turn are determined by the ultimate function and use of the oligonucleotide. In certain specific embodiments, the oligonucleotide can include a length of 10 nucleotides to 100 nucleotides. In certain specific embodiments, the oligonucleotide can include a length of 10 nucleotides to 30 nucleotides, or can have a length of 20 and 25 nucleotides. In some specific embodiments, oligonucleotides shorter than these lengths are also suitable.

[0077] "Primer" in the present application refers to an oligonucleotide that can serve as a starting point for synthesis when placed under conditions that induce the synthesis of a primer extension product complementary to a nucleic acid strand, i.e., in the presence of nucleotides and an inducer such as DNA or RNA polymerase and at an appropriate temperature and pH, whether it is naturally occurring in a purified restriction digest or synthetically produced. The primer can be single-stranded or double-stranded and must be long enough to initiate the synthesis of the desired extension product in the presence of the inducer. The exact length of the primer depends on various factors, including temperature, primer source, and the method used. For example, for diagnostic and prognostic applications, oligonucleotide primers typically contain at least or more than about 9, 10, or 15, or 20, or 25 or more nucleotides, depending on the complexity of the target sequence, but it can contain fewer or more nucleotides. The factors involved in determining the appropriate length of the primer are well known to those skilled in the art.

[0078] "Primer pair" in the present application refers to a pair of primers that hybridize to opposite strands of a target DNA molecule or to a target DNA region flanking the nucleotide sequence to be amplified.

[0079] "Primer site" in the present application refers to the region of a target DNA or other nucleic acid to which a primer hybridizes.

[0080] "Probe" in the present application, when referring to a nucleic acid sequence, is used in its ordinary meaning and refers to a selected nucleic acid sequence that can hybridize to a target sequence under specified conditions and can be used to detect the presence of that target sequence. The probe is a single-stranded or double-stranded DNA with a length ranging from dozens to hundreds or even thousands of base pairs. It can utilize the denaturation, renaturation of molecules, and the high precision of base complementary pairing to bind (hybridize) to the complementary unlabeled single-stranded DNA or RNA in the test sample through hydrogen bonds to form a double-stranded complex (hybrid). Those skilled in the art should understand that in some cases, a probe can also be used as a primer, and a primer can be used as a probe.

[0081] "DNA methylation" in the present application refers to the addition of a methyl group to the 5-position of cytosine (C), which usually (but not necessarily) occurs in the context of CpG (guanine following cytosine) dinucleotides. As a relatively stable modification state, under the action of DNA methyltransferase, it can be inherited to the newly generated daughter DNA during DNA replication, and is an important epigenetic mechanism. When DNA is methylated, methylation in the promoter region of a gene can lead to transcriptional silencing of tumor suppressor genes, so it is closely related to the occurrence of tumors. Aberrant methylation includes hypermethylation of tumor suppressor genes and DNA repair genes, hypomethylation of repetitive sequence DNA, and loss of imprinting of certain genes, which is related to the occurrence of various tumors. The "increased degree of methylation" or "significant degree of methylation" used herein refers to the presence of at least one methylated cytosine nucleotide in a DNA sequence, where the corresponding C in a normal control sample (e.g., a DNA sample extracted from non-cancerous cells or tissue samples or a DNA sample treated for methylation of DNA residues) is non-methylated. In certain embodiments, at least 2, 3, 4, 5, 6, 7, 8, 9, 10 or more C's can be methylated, where the C's at these positions in the control DNA sample are non-methylated.

[0082] In embodiments, a variety of different methods can be used to detect DNA methylation alterations. Methods for detecting DNA methylation include, for example, methylation-sensitive restriction endonuclease (MSRE) assays using southern or polymerase chain reaction (PCR) analysis, methylation-specific or methylation-sensitive PCR (MS-PCR), methylation-sensitive single nucleotide primer extension (Ms-SnuPE), high-resolution melting (HRM) analysis, bisulfite sequencing, pyrosequencing, methylation-specific single-strand conformation analysis (MS-SSCA), combined bisulfite restriction analysis (COBRA), methylation-specific denaturing gradient gel electrophoresis (MS-DGGE), methylation-specific melting curve analysis (MS-MCA), methylation-specific denaturing high performance liquid chromatography (MS-DHPLC), methylation-specific microarray (MSO). These assays can be PCR analysis, quantitative analysis using fluorescent labels, or southern blot analysis.

[0083] The "methylation assay" in the present application refers to any assay for determining the methylation status of one or more CpG dinucleotide sequences within a DNA sequence.

[0084] "Detection" in this application refers to any process of observing a biomarker or a change in a biomarker (e.g., a change in the methylation status of a biomarker or the expression level of a nucleic acid or protein sequence) in a biological sample, regardless of whether the biomarker or the change in the biomarker is actually detected. In other words, the act of detecting a biomarker or a change in a biomarker in a sample is "detection", even if the biomarker is determined to be absent or below the sensitivity level. Detection can be a quantitative, semi - quantitative or non - quantitative observation and can be based on a comparison with one or more control samples. It should be understood that detecting the six cancers disclosed herein includes detecting pre - cancerous cells that have started to develop into cancer cells or are about to develop into cancer cells, or have an increased tendency to develop into cancer cells. Detecting the above - mentioned six cancers can also include detecting the possible probability of death or the possible prognosis of a disease condition.

[0085] "Homology", "identity", and "similarity" as used in this application refer to sequence similarity between two nucleic acid molecules. Positions in each sequence can be compared to determine "homology", "identity", or "similarity", and the sequences can be aligned for the purpose of comparison. When the equivalent positions in the sequences being compared are occupied by the same base, the molecules are identical at that position; when the equivalent sites are occupied by the same or similar amino acid (e.g., similar in spatial or charged properties) residues, the molecules can be said to be homologous (similar) at that position. The expression of the percentage of homology / similarity or identity refers to a function of the number of identical or similar amino acids at positions shared by the sequences being compared. "Unrelated" or "non-homologous" sequences share less than 40% identity, preferably less than 25% identity, with the sequences of this application. When comparing two sequences, the presence of deletions or extra residues (amino acids or nucleic acids) also reduces identity and homology / similarity. In a specific embodiment, for two or more sequences or subsequences, determination is made according to the BLAST or BLAST 2.0 sequence comparison algorithm using the default parameters described below or by, for example, manual alignment and visual inspection provided online by the National Center for Biotechnology Information (NCBI). When comparing and aligning for maximum correspondence over a comparison window or specified region, if their sequences have an identity of about 60%, or about 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or higher over the specified region, they can be considered to be substantially or significantly homologous, similar, or identical. This definition also pertains to or can be used to test the complement of a sequence. Thus, to the extent permitted by the context herein, for example, if a nucleotide sequence can be predicted to occur naturally in a DNA duplex or can occur naturally in the form of one or both of the complementary strands, a nucleotide sequence complementary to a specified target sequence or its variant is itself considered to be "similar" to the target sequence, and when referring to "similar" nucleic acid sequences, includes single-stranded sequences, their complementary sequences, double-stranded strand complexes, sequences capable of encoding the same or similar polypeptide products, and any permissible variants of any of the foregoing. Circumstances where similarity must be restricted to the analysis of a single nucleic acid strand sequence can include, for example, the detection and quantification of the expression of a specific RNA sequence or coding sequence in a cell. This definition also includes sequences with deletions and / or additions, as well as sequences with substitutions.In an embodiment, the identity or similarity can be over a region of at least about 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25 or more nucleotides, or over a region of more than about 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95 or more than about 100 nucleotides.

[0086] "Amplification" in this application refers to the process of obtaining multiple copies from a specific genome of a nucleic acid, such as genomic DNA or cDNA. Amplification can be achieved using any of a variety of known means, including but not limited to polymerase chain reaction (PCR), transcription-based amplification, and strand displacement amplification (SDA).

[0087] "Fluorescence-based real-time PCR" in this application refers to a method in which a fluorophore is added to the PCR reaction system, and the entire PCR process is monitored in real time using the accumulation of fluorescence signals, and finally the unknown template is quantitatively analyzed through a standard curve. In this PCR technique, there is a very important concept, the cycle threshold, also known as the Ct value. C represents Cycle, t represents threshold, and the meaning of the Ct value is: the number of cycles experienced when the fluorescence signal in each reaction tube reaches the set threshold. For example, the method for setting the fluorescence threshold is as follows: the fluorescence signals of the first 15 cycles of the PCR reaction are used as the fluorescence background signals, and the default setting of the fluorescence threshold is 10 times the standard deviation of the fluorescence signals of cycles 3 - 15.

[0088] The "cut-off value of real-time PCR" in this application refers to a critical Ct value for determining the positivity or negativity of a sample for a certain biomarker. According to certain specific embodiments of this application, "the critical Ct value (Cut Off value) is obtained based on statistical processing of a certain amount of sample data", and this critical Ct value can vary according to different requirements for sensitivity or specificity.

[0089] The "sensitivity" in this application refers to the proportion of cancers detected from a certain cancer sample, and its calculation formula is: sensitivity = (detected cancers / all cancers), while the "specificity" refers to the proportion of normals detected in a certain healthy human sample, and its calculation formula is specificity = (detected negatives / total negatives).

[0090] A "label" or "detectable moiety" of the present application is a component that can be detected by spectroscopic, photochemical, biochemical, immunochemical, chemical, or other physical means. For example, useful labels include 32P, fluorescent dyes, electron-dense reagents, enzymes (e.g., enzymes commonly used in ELISA), biotin, digoxin, or haptens and proteins that can be prepared to be detectable, e.g., by incorporating a radiolabel into a peptide or an antibody that specifically reacts with the peptide.

[0091] A variety of different methods can be used to detect nucleic acid molecules. Nucleic acid detection methods include, for example, PCR and nucleic acid hybridization (e.g., Southern blotting, Northern blotting, or in situ hybridization). Specifically, oligonucleotides (e.g., oligonucleotide primers) capable of amplifying a target nucleic acid can be used in a PCR reaction. The PCR method generally includes the following steps: obtaining a sample, isolating nucleic acid (e.g., DNA, RNA, or both) from the sample, and contacting the nucleic acid with one or more oligonucleotide primers that specifically hybridize to the template nucleic acid under conditions that allow amplification of the template nucleic acid to occur. In the presence of the template nucleic acid, an amplification product is generated. Conditions for nucleic acid amplification and detection of the amplification product are known to those skilled in the art. A variety of improvements to the basic PCR technique have been developed, including but not limited to, anchored PCR, RACE PCR, RT-PCR, and ligase chain reaction (LCR). The primer pairs in the amplification reaction must anneal to opposite strands of the template nucleic acid and should be held at an appropriate distance from each other such that the polymerase can efficiently polymerize across the region and such that the amplification product can be easily detected, e.g., using electrophoresis. For example, a computer program such as OLIGO (Molecular Biology Insights Inc., Cascade, Colo.) can be used to design oligonucleotide primers to assist in designing primers with similar melting temperatures. Generally, oligonucleotide primers are 9 - 30 or 40 or 50 nucleotides in length (e.g., 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50 nucleotides in length), but oligonucleotide primers can be longer or shorter as long as appropriate amplification conditions are used.

[0092] The detection of amplification products or hybridization complexes is typically achieved using detectable labels. The term "label", when referring to nucleic acids, is intended to include direct labeling of the nucleic acid by coupling (i.e., physically linking) a detectable substance to the nucleic acid, and indirect labeling of the nucleic acid by reaction with another reagent that has been directly labeled with a detectable substance. Detectable substances include a variety of enzymes, cofactors, fluorescent materials, chemiluminescent materials, bioluminescent materials, and radioactive materials. Examples of suitable enzymes include horseradish peroxidase, alkaline phosphatase, β-galactosidase, or acetylcholinesterase; examples of suitable cofactor complexes include streptavidin / biotin and avidin / biotin; examples of suitable fluorescent materials include umbelliferone, fluorescein, fluorescein isothiocyanate, rhodamine, dichlorotriazinylamine fluorescein, dansyl chloride, or phycoerythrin; examples of chemiluminescent materials include luminol; examples of bioluminescent materials include luciferase, luciferin, and aequorin. Examples of indirect labeling include end-labeling of nucleic acids with biotin such that the nucleic acid can be detected with fluorescently labeled streptavidin.

[0093] Overview

[0094] Liquid biopsy technology uses body fluids such as blood, saliva, and urine as test materials and tumor markers as detection indicators to achieve early screening and diagnosis of cancer, assist in staging, prognosis and recurrence monitoring, and drug guidance. It has the advantages of non-invasive, efficient, and accurate. Among them, using abnormal changes in DNA methylation levels as markers for tumor molecular diagnosis is one of the current research hotspots and has gradually become the consensus in the scientific and medical communities. DNA methylation is an important epigenetic modification and participates in regulating various cytological processes, including embryonic development, gene transcription, X chromosome inactivation, genomic imprinting, chromatin structure stability, etc. Therefore, abnormal DNA methylation is closely related to the occurrence of human complex diseases. In normal cells, cytosine in CpG islands and some regions rich in CG sites is usually unmethylated, while cytosine bases in regions with a low CG ratio are mostly in a hypermethylated state. However, in various cancers, the methylation pattern is exactly the opposite. Multiple studies have shown that hypermethylation of CpG islands can inhibit or silence the expression of some tumor suppressor genes and DNA mismatch repair genes, while hypomethylation in other regions of the genome can promote the expression of proto-oncogenes, all of which can endow normal cells with carcinogenic characteristics and thus promote the occurrence of cancer. In addition, abnormal DNA methylation usually occurs in the ultra-early stage of cancer and is a "seed" factor for tumor growth. Moreover, as the cancer progresses, the methylation status of DNA also undergoes dynamic changes, which can directly reflect the growth of tumor lesions. Therefore, using DNA methylation detection for early cancer screening and auxiliary diagnosis has great application potential.

[0095] On the one hand, the present application provides a composition for in vitro detection of multiple cancers, the composition comprising nucleic acids for detecting the methylation status within the target sequences of target genes, wherein the methylation status of the target genes is characterized by the methylation of the target sequences of the target genes, and wherein the target genes are UBQLN1 gene and / or UBALD1 gene.

[0096] The present application provides a set of target sequences of target genes that exhibit abnormal methylation in multiple cancers, including the target sequences of UBQLN1 gene and UBALD1 gene. The target sequence of UBQLN1 gene is shown as any one of SEQ ID NO: 1-4 or includes a sequence shown as any one of SEQ ID NO: 1-4. The target sequence of UBALD1 gene is shown as any one of SEQ ID NO: 5-8 or includes a sequence shown as any one of SEQ ID NO: 5-8.

[0097] Those skilled in the art can also understand that the target sequences of UBQLN1 gene and UBALD1 gene are not limited to the specific sequences listed above. The target sequence of UBQLN1 gene should cover sequences that contain one or two or more than three nucleotide mutations compared with any one of the sequences shown in SEQ ID NO: 1-4, but still substantially have the same substantial function, and also cover sequences that have 95%, 96%, 97%, 98% or 99% sequence identity compared with any one of the sequences shown in SEQ ID NO: 1-4. It also covers sequences that have 90%, 91%, 92%, 93%, 94%, 95% or 96% or 97% or 98% or 99% identity with the nucleotide sequence shown in any one of SEQ ID NO: 1-4 after deleting one or more nucleotides, adding one or more nucleotides, or replacing one or more nucleotides on the basis of the nucleotide sequence shown in any one of SEQ ID NO: 1-4. The target sequence of UBALD1 gene should cover sequences that contain one or two or more than three nucleotide mutations compared with any one of the sequences shown in SEQ ID NO: 5-8, but still substantially have the same substantial function, and also cover sequences that have 95%, 96%, 97%, 98% or 99% sequence identity compared with any one of the sequences shown in SEQ ID NO: 5-8. It also covers sequences that have 90%, 91%, 92%, 93%, 94%, 95% or 96% or 97% or 98% or 99% identity with the nucleotide sequence shown in any one of SEQ ID NO: 5-8 after deleting one or more nucleotides, adding one or more nucleotides, or replacing one or more nucleotides on the basis of the nucleotide sequence shown in any one of SEQ ID NO: 5-8.

[0098] The target sequence of UBQLN1 (5'-3') is as follows:

[0099] TCCGCGGAGGCAGCGGCCGCGGGGGCGCCAGCACCTTCGGCTCCGGCGGCGCTATCCTGGGAGCCCGGAGGACCGCCGCTTTCACCACTCTCGGCCATGGCTGTGGCGGCGGCGGCGGCGGTGACTCAGGCAAGCAGGAGGGAGCAGGCGAGCAAGGAGGAGCCAGCAGACACCAGAGCCGGCAGGCCTGGACAGCGAAGAATGCAGAGCACGCCGC(SEQ ID NO:1)

[0100] The reverse complementary sequence (5'-3') of the target sequence of UBQLN1 is as follows:

[0101] GCGGCGTGCTCTGCATTCTTCGCTGTCCAGGCCTGCCGGCTCTGGTGTCTGCTGGCTCCTCCTTGCTCGCCTG CTCCCTCCTGCTTGCCTGAGTCACCGCCGCCGCCGCCGCCACAGCCATGGCCGAGAGTGGTGAAAGCGGCGGTC CTCCGGGCTCCCAGGATAGCGCCGCCGGAGCCGAAGGTGCTGGCGCCCCCGCGGCCGCTGCCTCCGCGGA(SEQ ID NO:2)

[0102] The sequence of the target sequence of UBQLN1 after bisulfite treatment (5'-3') is as follows:

[0103] TTCGCGGAGGTAGCGGTCGCGGGGGCGTTAGTATTTTCGGTTTCGGCGGCGTTATTTTGGGAGTTCGGAGGA TCGTCGTTTTTATTATTTTCGGTTATGGTTGTGGCGGCGGCGGCGGCGGTGATTTAGGTAAGTAGGAGGGAGTAG GCGAGTAAGGAGGAGTTAGTAGATATTAGAGTCGGTAGGTTTGGATAGCGAAGAATGTAGAGTACGTCGT(SEQ ID NO:3)

[0104] The sequence of the reverse complementary sequence of the target sequence of UBQLN1 after bisulfite treatment (5'-3') is as follows:

[0105] GCGGCGTGTTTTGTATTTTTCGTTGTTTAGGTTTGTCGGTTTTGGTGTTTGTTGGTTTTTTTTTGTTCGTTTGTT TTTTTTTGTTTGTTTGAGTTATCGTCGTCGTCGTCGTTATAGTTATGGTCGAGAGTGGTGAAAGCGGCGGTTTTTC GGGTTTTTAGGATAGCGTCGTCGGAGTCGAAGGTGTTGGCGTTTTCGCGGTCGTTGTTTTCGCGGA(SEQ ID NO:4)

[0106] The target sequence (5'-3') of the UBALD1 gene is as follows:

[0107] GACAAATACTCGTTCAGTGAATGAATGAATGAGCCACTTAAAAGCTCCGCCGCACGTCACCGCCTATAGCTAGCCTCCTAGCTCTCCTCACTCAATCTCTCATCGCCCACTCGTGGCATGGGTCCTTCCTAGCCTGGCTCTGGGCCTGCCCCACTGTAGCCCCATGACCCTCTGGACGGCGCCTGGGACAGGCTGGCGGGGCCAGCAGCCTCTGGTGCTTCGGGGTCCCCCTCCCAGCAGTTCTCCCGCTTTCCCACGCAAAATCTC(SEQ ID NO:5)

[0108] The reverse complementary sequence (5'-3') of the target sequence of the UBALD1 gene is as follows:

[0109] GAGATTTTGCGTGGGAAAGCGGGAGAACTGCTGGGAGGGGGACCCCGAAGCACCAGAGGCTGCTGGCCCCGCCAGCCTGTCCCAGGCGCCGTCCAGAGGGTCATGGGGCTACAGTGGGGCAGGCCCAGAGCCAGGCTAGGAAGGACCCATGCCACGAGTGGGCGATGAGAGATTGAGTGAGGAGAGCTAGGAGGCTAGCTATAGGCGGTGACGTGCGGCGGAGCTTTTAAGTGGCTCATTCATTCATTCACTGAACGAGTATTTGTC(SEQ ID NO:6)

[0110] The sequence (5'-3') of the target sequence of the UBALD1 gene after bisulfite treatment is as follows:

[0111] GATAAATATTCGTTTAGTGAATGAATGAATGAGTTATTTAAAAGTTTCGTCGTACGTTATCGTTTATAGTTAGTTTTTTAGTTTTTTTTATTTAATTTTTTATCGTTTATTCGTGGTATGGGTTTTTTTTAGTTTGGTTTTGGGTTTGTTTTATTGTAGTTTTATGATTTTTTGGACGGCGTTTGGGATAGGTTGGCGGGGTTAGTAGTTTTTGGTGTTTCGGGGTTTTTTTTTTAGTAGTTTTTTCGTTTTTTTACGTAAAATTTT(SEQ ID NO:7)

[0112] The sequence (5'-3') of the complementary sequence of the target sequence of the UBALD1 gene after bisulfite treatment is as follows:

[0113] GAGATTTTGCGTGGGAAAGCGGGAGAATTGTTGGGAGGGGGATTTCGAAGTATTAGAGGTTGTTGGTTTCGTTAGTTTGTTTTAGGCGTCGTTTAGAGGGTTATGGGGTTATAGTGGGGTAGGTTTAGAGTTAGGTTAGGAAGGATTTATGTTACGAGTGGGCGATGAGAGATTGAGTGAGGAGAGTTAGGAGGTTAGTTATAGGCGGTGACGTGCGGCGGAGTTTTTAAGTGGTTTATTTATTTATTTATTGAACGAGTATTTGTT(SEQ ID NO:8)

[0114] The target sequences and related sequences of the UBQLN1 gene and the UBALD1 gene are shown in Table 1:

[0115] Table 1: Target sequences and related sequences of each gene

[0116] Target sequence name Serial number Target sequence of UBQLN1 SEQ ID NO:1 Reverse complementary sequence of the target sequence of UBQLN1 SEQ ID NO:2 Sequence of the target sequence of UBQLN1 after bisulfite treatment SEQ ID NO:3 Sequence of the reverse complementary sequence of the target sequence of UBQLN1 after bisulfite treatment SEQ ID NO:4 Target sequence of UBALD1 gene SEQ ID NO:5 Reverse complementary sequence of the target sequence of UBALD1 gene SEQ ID NO:6 Sequence of the target sequence of UBALD1 gene after bisulfite treatment SEQ ID NO:7 Sequence of the reverse complementary sequence of the target sequence of UBALD1 gene after bisulfite treatment SEQ ID NO:8

[0117] Preferably, the nucleic acid for detecting the methylation status of a target gene comprises a fragment of at least 9 nucleotides in the target sequence of the target gene, wherein the fragment comprises at least one CpG dinucleotide sequence. In certain preferred embodiments, such as when bisulfite is used to transform the DNA of the sample to be tested, the nucleic acid for detecting the methylation status of the target gene comprises a fragment of at least 9 nucleotides in the sequence obtained by bisulfite transformation of the target sequence of the target gene, preferably at least 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22 or more nucleotides, wherein the nucleotide fragment comprises at least one CpG dinucleotide sequence.

[0118] More preferably, the nucleic acid for detecting the methylation status of a target gene comprises a fragment of at least 15 nucleotides that hybridizes to the target sequence of the target gene under medium stringency or stringent conditions, wherein the nucleotide fragment comprises at least one CpG dinucleotide sequence. In certain preferred embodiments, such as when bisulfite is used to transform the DNA of the sample to be tested, the nucleic acid for detecting the methylation status of the target gene comprises a fragment of at least 15 nucleotides that hybridizes to the sequence obtained by bisulfite transformation of the target sequence of the target gene under medium stringency or stringent conditions, preferably at least 16, 17, 18, 19, 20, 21, 22 or more nucleotides, wherein the nucleotide fragment comprises at least one CpG dinucleotide sequence.

[0119] Preferably, the composition further comprises a reagent for converting the unmethylated cytosine base at the 5th position of the target sequence of the target gene into uracil. More preferably, the reagent is bisulfite.

[0120] The nucleic acid for detecting the methylation status of a target gene may further comprise a blocker that preferentially binds to DNA in the unmethylated state.

[0121] Preferably, the composition comprises one or more of the primers and probes shown in Table 2:

[0122] Table 2 Sequences of primers, probes and blockers used in this application

[0123] Sequence number Sequence name Specific nucleotide sequence (5’-3’) SEQ ID NO:9 UBQLN1_F GGCGTTAGTATTTTCGGTTTC SEQ ID NO:10 UBQLN1_R TAACCGAAAATAATAAAAACGACG SEQ ID NO:13 UBQLN1_P CTCCGAACTCCCAAAATAACGCCG SEQ ID NO:11 UBALD1_F GGATTTATGTTACGAGTGGGC SEQ ID NO:12 UBALD1_R AATAAATAAACCACTTAAAAACTCCG SEQ ID NO:14 UBALD1_P CGCACGTCACCGCCTATAAC

[0124] In Table 2, "F" represents the forward primer; "R" represents the reverse primer; "P" represents the probe.

[0125] In certain embodiments, the composition further comprises a reagent that converts the 5 - unmethylated cytosine base of a gene into uracil. Preferably, the reagent is bisulfite. Bisulfite modification of DNA is a known tool for assessing CpG methylation status. In the DNA of eukaryotic cells, 5 - methylcytosine is the most common covalent base modification. 5 - methylcytosine cannot be identified by sequencing because 5 - methylcytosine has the same base - pairing behavior as cytosine. In addition, during PCR amplification, the epigenetic information carried by 5 - methylcytosine is completely lost. The most commonly used method for analyzing the presence of 5 - methylcytosine in DNA is based on the specific reaction of bisulfite with cytosine; after subsequent alkaline hydrolysis, cytosine that is not methylated is converted to uracil, which behaves like thymine in terms of base pairing; but 5 - methylcytosine remains unmodified under these conditions. Thus, the original DNA is transformed in such a way that 5 - methylcytosine, which could not be distinguished from cytosine in its hybridization behavior, can now be detected by conventional known molecular biology techniques as the only remaining cytosine, for example, by amplification and hybridization. All these techniques are based on different base - pairing properties and can now be fully utilized. Thus, typically, the present application provides for the combined use of bisulfite technology with one or more methylation assays to determine the methylation status of CpG dinucleotide sequences within the target sequence of a target gene. In addition, the methods of the present application are suitable for analyzing heterogeneous biological samples, such as low - concentration tumor cells in blood or feces. Thus, when analyzing the methylation status of CpG dinucleotide sequences in such samples, those skilled in the art can use quantitative assays to determine the methylation level (e.g., percentage, fraction, ratio, proportion, or degree) of a specific CpG dinucleotide sequence rather than the methylation status. Accordingly, the term methylation profile or methylation status should also be considered to refer to a value that reflects the methylation status of a CpG dinucleotide sequence.

[0126] On the other hand, the present application provides oligonucleotides for in vitro detection of multiple cancers, which include: a fragment of at least 9 nucleotides of the sequence shown in any one of SEQ ID NO: 1 - 4 or its complementary sequence and containing at least one CpG dinucleotide sequence; and / or a fragment of at least 9 nucleotides of the sequence shown in any one of SEQ ID NO: 5 - 8 or its complementary sequence and containing at least one CpG dinucleotide sequence.

[0127] Preferably, the oligonucleotides for in vitro detection of multiple cancers include: a fragment of at least 9 nucleotides of the sequence obtained by bisulfite conversion of the sequence shown in any one of SEQ ID NO: 1 - 4 or its complementary sequence; and / or a fragment of at least 9 nucleotides of the sequence obtained by bisulfite conversion of the sequence shown in any one of SEQ ID NO: 5 - 8 or its complementary sequence and containing at least one CpG dinucleotide sequence.

[0128] The oligonucleotides for in vitro detection of multiple cancers in the present application further include: a fragment that hybridizes to at least 15 nucleotides of the sequence shown in any one of SEQ ID NO: 1-4 or its complementary sequence under medium stringency or stringent conditions and contains at least one CpG dinucleotide sequence; and / or a fragment that hybridizes to at least 15 nucleotides of the sequence shown in any one of SEQ ID NO: 5-8 or its complementary sequence under medium stringency or stringent conditions and contains at least one CpG dinucleotide sequence.

[0129] Preferably, the oligonucleotides for in vitro detection of multiple cancers include: a fragment that hybridizes to at least 15 nucleotides of the sequence obtained by bisulfite conversion of the sequence shown in any one of SEQ ID NO: 1-4 or its complementary sequence under medium stringency or stringent conditions and contains at least one CpG dinucleotide sequence; and / or a fragment that hybridizes to at least 15 nucleotides of the sequence obtained by bisulfite conversion of the sequence shown in any one of SEQ ID NO: 5-8 or its complementary sequence under medium stringency or stringent conditions and contains at least one CpG dinucleotide sequence.

[0130] The oligonucleotides for in vitro detection of multiple cancers in the present application may further include: blockers that preferentially bind to DNA in the unmethylated state.

[0131] In a specific embodiment, the oligonucleotides for in vitro detection of multiple cancers include: the sequences of SEQ ID NO: 9 and SEQ ID NO: 10. It further includes: the sequence of SEQ ID NO: 13.

[0132] In another specific embodiment, the oligonucleotides for in vitro detection of multiple cancers include: the sequences of SEQ ID NO: 11 and SEQ ID NO: 12. It further includes: the sequence of SEQ ID NO: 14.

[0133] On the other hand, the present application provides a kit comprising the said composition. The kit further contains at least one other component selected from the following: nucleoside triphosphates, DNA polymerase, and a buffer required for the function of the DNA polymerase.

[0134] Typically, the kit further includes a container for accommodating a patient's biological sample. And, the kit also includes instructions for using and interpreting the test results.

[0135] The present application also relates to the use of the above composition and oligonucleotides in the preparation of a kit for in vitro detection of multiple cancers.

[0136] This application also relates to the use of one or more of the UBQLN1 gene and the UBALD1 gene in the preparation of a kit for in vitro detection of multiple cancers.

[0137] Among them, the UBQLN1 gene is located on human chromosome 12q24.31, with a full length of approximately 80 kb and contains 17 exons. This gene encodes Ubiquilin 1, which is a member of the ubiquitin-protein ligase family. The UBQLN1 protein has multiple functions in cells. It can interact with proteasome subunits through its UBL domain to target ubiquitinated proteins to the proteasome for degradation. At the same time, its UBA domain can bind to ubiquitinated substrates, thus playing a key role in the process of protein quality control and participating in the clearance of misfolded or damaged proteins. In addition, UBQLN1 is also involved in processes such as intracellular signal transduction and transcriptional regulation.

[0138] The UBALD1 gene is located at 16p13.3 on human chromosome 16 and encodes a protein containing a UBA-like domain. This domain is found in many proteins and is usually involved in the processes of protein degradation and regulation 1. This protein is mainly localized in the nucleus and cytoplasm. In the nucleus, it may be involved in the regulation of gene transcription; in the cytoplasm, it is related to the protein quality control and degradation processes. It shows a widespread expression pattern in the human body and is expressed in various tissues such as the kidney and liver. Among them, the expression level in the kidney is relatively high, and the RPKM value of its RNA expression can reach 10.6, and the RPKM value in the liver is 8.5.

[0139] On the other hand, this application provides a method for in vitro detection of multiple cancers, and the method includes the following steps:

[0140] 1) Isolate the target sequence or its fragment of the target gene in the biological sample to be tested;

[0141] 2) Determine the methylation status of the target sequence of the target gene;

[0142] 3) Judge the status of the biological sample through the detection result of the methylation status of the target sequence of the target gene, so as to realize the in vitro detection of multiple cancers.

[0143] According to some preferred embodiments, the method further includes the following steps:

[0144] 1) Extract the genomic DNA of the biological sample to be tested;

[0145] 2) Treat the DNA sample obtained in step 1) with a reagent to convert the 5-position unmethylated cytosine base into uracil or other bases, that is, the 5-position unmethylated cytosine base of the target sequence of the target gene is converted into uracil or other bases. The converted base is different from the 5-position unmethylated cytosine base in terms of hybridization performance and is detectable;

[0146] 3) Contact the DNA sample treated in step 2) with a DNA polymerase and a primer of the target sequence of the target gene, so that the treated target sequence of the target gene is amplified to produce an amplification product or not amplified; if a DNA polymerization reaction occurs in the treated target sequence of the target gene, an amplification product will be produced; if a DNA polymerization reaction does not occur in the treated target sequence of the target gene, it will not be amplified;

[0147] 4) Detect the amplification product with a probe; and

[0148] 5) Based on the presence or absence of the amplification product, determine the methylation status of at least one CpG dinucleotide of the target sequence of the target gene.

[0149] Preferably, typical primers include fragments of the target sequence of the target gene, and the fragments of the target sequence of the target gene include fragments that are respectively identical to, complementary to, or hybridize under medium stringency or high stringency conditions to at least 9 nucleotides selected from any one of SEQ ID NO: 1-4 and any one of SEQ ID NO: 5-8.

[0150] Preferably, typical probes include fragments of the target sequence of the target gene, and the fragments of the target sequence of the target gene include fragments that are respectively identical to, complementary to, or hybridize under medium stringency or high stringency conditions to at least 15 nucleotides selected from any one of SEQ ID NO: 1-4 and any one of SEQ ID NO: 5-8.

[0151] Preferably, one or more of the primers and probes are as shown in Table 2 above.

[0152] Moreover, the contact or amplification includes using at least one of the following methods: using a thermostable DNA polymerase as the amplification enzyme, using a polymerase lacking 5'-3' exonuclease activity, using polymerase chain reaction (PCR), and producing an amplified product nucleic acid molecule with a detectable label.

[0153] Preferably, the methylation status is determined by PCR. Assay methods such as "fluorescence-based real-time PCR technology", methylation-sensitive single nucleotide primer extension reaction (Ms-SNuPE), methylation-specific PCR (MSP), and methylation CpG island amplification (MCA) are used to determine the methylation status of at least one CpG dinucleotide of the target sequence of the target gene. Among them, the "fluorescence-based real-time PCR" assay is a high-throughput quantitative methylation assay that uses fluorescence-based real-time PCR (TaqMan) technology and does not require further operations after the PCR step. Briefly, the "fluorescence-based real-time PCR" method starts with a mixed sample of genomic DNA, which is converted into a mixed pool of methylation-dependent sequence differences in a bisulfite reaction according to standard operations. Subsequently, fluorescence-based PCR is performed in a "biased" reaction (using PCR primers that overlap known CpG dinucleotides). Sequence differences can be generated at the amplification level and at the fluorescence detection amplification level. The "fluorescence-based real-time PCR" assay can be used as a quantitative test for the methylation status in genomic DNA samples, where sequence discrimination occurs at the probe hybridization level. In this quantitative method, in the presence of a fluorescence probe that overlaps a specific CpG dinucleotide, the PCR reaction provides methylation-specific amplification. An unbiased control for the starting DNA amount is provided by the following reaction: where neither the primer nor the probe covers any CpG dinucleotides. The "fluorescence-based real-time PCR" method can be used with any suitable probe, such as "TaqMan", "Lightcycler", etc. The TaqMan probe is double-labeled with a fluorescence reporter (RTSPYL5rter) and a quencher molecule and is designed to be specific for regions with a relatively high GC content, so that it melts at a temperature approximately 10°C higher than the forward or reverse primer in the PCR cycle. This allows the TaqMan probe to remain fully hybridized during the PCR annealing / extension step. When Taq polymerase enzymatically synthesizes a new strand during PCR, it will eventually encounter the annealed TaqMan probe. The 5' to 3' endonuclease activity of Taq polymerase will then displace it by digesting the TaqMan probe, thereby releasing the fluorescence reporter molecule for quantitative detection of its now unquenched signal using a real-time fluorescence detection system. Typical reagents for "fluorescence-based real-time PCR" analysis can include, but are not limited to: PCR primers for the target sequence of the target gene; non-specific amplification blockers; TaqMan or Lightcycler probes; optimized PCR buffers and deoxynucleotides; and Taq polymerase, etc.

[0154] In some preferred embodiments, the methylation status of at least one CpG dinucleotide in the target sequence of the target gene is determined by the critical Ct value of a real-time PCR reaction. By using the method of analyzing DNA in a biological sample through a real-time PCR reaction, it is convenient to detect the methylation status of the target sequence of the target gene, and it is possible to quickly and conveniently determine whether the tested sample is positive based on the critical Ct value of the PCR reaction. Therefore, a non-invasive and rapid in vitro detection method for the above six cancers is provided.

[0155] The biological sample is selected from a cell line, a histological section, a tissue biopsy / paraffin-embedded tissue, a body fluid, feces, a colon effluent, urine, plasma, serum, whole blood, isolated blood cells, cells isolated from blood, or a combination thereof. A preferred biological sample is plasma.

[0156] The inventors of the present application found that there are significant differences in the methylation status of the target sequences of the UBQLN1 gene and the UBALD1 gene between the above six cancer tissues and the target sequences of these genes in normal tissues: in the above six cancer tissues, the target sequences of the UBQLN1 gene and the UBALD1 gene are methylated, while in normal tissues, the target sequences of the UBQLN1 gene and the UBALD1 gene are not methylated. Therefore, the present application provides a method for in vitro detection of multiple cancers (lung cancer, liver cancer, gastric cancer, intestinal cancer, esophageal cancer, ovarian cancer) by detecting the methylation status of the target sequences of one or more of the UBQLN1 gene and the UBALD1 gene in a sample. The method provided by the present application can detect the above six cancers non-invasively and rapidly.

[0157] Examples

[0158] The present application generally and / or specifically describes the materials and test methods used in the experiments. In the following examples, unless otherwise specifically stated, % represents wt%, that is, weight percentage. Reagents or instruments without indicating the manufacturer can be obtained as conventional reagent products through commercial purchase.

[0159] Example 1 Primer and Probe Testing

[0160] Genomic DNA of normal human WBC cell line is usually in a low / non-methylated state. For whole-genome amplification of this genomic DNA, since no new methylation is introduced during the amplification process, theoretically the methylation level of the whole-genome amplification product (UM) is extremely low and can be used as a negative reference for detecting the methylation status of the target gene target sequence. The amount of DNA used in this example is 25 ng / reaction; the product treated with human genomic DNA methyltransferase is usually in a high / totally methylated state. In this embodiment, the product treated with human genomic DNA methyltransferase (M) can be used as a positive reference for detecting the methylation status of the target gene target sequence, and the amount of DNA used in this example is 400 pg / reaction.

[0161] The DNA sample is first subjected to bisulfite conversion. Using the converted BisDNA as a template, real-time PCR amplification is carried out using the above primers and probes. Using the β-actin (ACTB) gene as an internal reference, at least one real-time PCR is performed for each sample. In some specific embodiments, two or three real-time PCR detections are carried out. The PCR system for primer and probe testing is shown in Table 3 below.

[0162] Table 3

[0163] Volume (μl) Final concentration Taq DNA Polymerase (Biochain) 1.2 / 4.2× buffer (Biochain) 11.9 1× Forward primer F (10 μM) 1 200 nM Reverse primer R (10 μM) 1 200 nM Probe P (10 μM) 0.75 150 nM Forward primer F of internal reference gene ACTB (10 μM) 0.25 50 nM Reverse primer of internal reference gene ACTB (10 μM) 0.25 50 nM Probe P of internal reference gene ACTB (10 μM) 0.25 50 nM Template BisDNA 5 <![CDATA[H2O]]> 28.4 Total 50

[0164] Note: "F" represents the forward primer; "R" represents the reverse primer; "P" represents the probe.

[0165] The PCR amplification program used is: 94°C, 20 min; (60°C, 35 s - read fluorescence signal; 93°C, 30 s) 45 cycles; 40°C, 10 s.

[0166] Table 4

[0167] Summary of Ct values: M UM NTC Conclusion: Methylation level of UBQLN1 32.3 45 45 Available Methylation level of UBALD1 31.8 45 45 Available

[0168] As can be seen from Table 4, the nucleic acid composition and detection method provided in this application show a negative detection result for the whole-genome amplification product (UM) of normal human WBC cell line DNA and a positive detection result for the product treated with human genomic DNA methyltransferase (M).

[0169] Example 2 Testing of 6 types of high-incidence and high-fatality cancers and normal human peripheral blood buffy coat (WBC), comparing the test performance of common tumor markers

[0170] Using the white buffy coat layer (WBC) samples of peripheral blood from 32 cases of lung cancer, 32 cases of liver cancer, 32 cases of gastric cancer, 32 cases of colorectal cancer, 32 cases of esophageal cancer, 32 cases of ovarian cancer and the white buffy coat layer (WBC) samples of peripheral blood from 96 normal individuals as test materials, genomic DNA was extracted and converted into BisDNA by bisulfite. With a template amount of 25 ng / reaction, the methylation status of UBQLN1 and UBALD1 genes was detected according to the PCR reaction system and reaction procedure in Example 1. Finally, the Ct values of real-time PCR of the target gene target sequence and the internal reference gene sequence for all WBC samples were measured. According to the PCR results, the critical value of the Ct value of the marker UBQLN1 was selected as ≤41, and the critical value of the Ct value of the marker UBALD1 was selected as ≤42. As shown in Table 5 below, the combination of UBQLN1 and UBALD1 genes is more sensitive and specific than using only one of the markers alone, and is also more sensitive and specific than the commonly used general tumor markers in clinic. Therefore, the results show that these two markers can be used for the early screening of various cancers.

[0171] Table 5

[0172]

[0173]

[0174] In summary, the present application uses the above-described composition, nucleic acid sequence, kit and its uses, as well as the above detection method. By detecting the methylated nucleic acid sequence of the target sequence of the target gene, the in vitro detection of the above six cancers is realized by using the methylation biomarker of the target sequence of the target gene, thereby effectively improving the sensitivity and specificity of in vitro cancer detection.

[0175] The above are only the preferred embodiments of the present application, and are not intended to limit the present application in other forms. Any person skilled in the art may use the disclosed technical content to make changes or modifications into equivalent embodiments with equivalent changes. However, any simple modification, equivalent change and modification made to the above embodiments based on the technical essence of the present application without departing from the technical solution content of the present application still belong to the protection scope of the technical solution of the present application.

Claims

1. A composition for simultaneously detecting multiple cancers in vitro, the composition comprising: Nucleic acids for detecting the methylation status of target genes, wherein the methylation status of the target gene is characterized by the methylation of the target sequence of the target gene, wherein the target gene is the UBQLN1 gene and / or the UBALD1 gene.

2. The composition according to claim 1, wherein, The target sequence of the UBQLN1 gene is as shown in any one of SEQ ID NO: 1-4, or the target sequence of the UBQLN1 gene includes a sequence as shown in any one of SEQ ID NO: 1-4.

3. The composition according to claim 1, wherein, The target sequence of the UBALD1 gene is as shown in any one of SEQ ID NO: 5-8, or the target sequence of the UBALD1 gene includes a sequence as shown in any one of SEQ ID NO: 5-8.

4. An oligonucleotide for detecting multiple cancers in vitro, comprising: A fragment of at least 9 nucleotides of the sequence shown in any one of SEQ ID NO: 1-4 or its complementary sequence and containing at least one CpG dinucleotide sequence; and / or A fragment of at least 9 nucleotides of the sequence shown in any one of SEQ ID NO: 5-8 or its complementary sequence and containing at least one CpG dinucleotide sequence.

5. An oligonucleotide for detecting multiple cancers in vitro, comprising: The sequences of SEQ ID NO: 9 and SEQ ID NO:

10.

6. An oligonucleotide for detecting multiple cancers in vitro, comprising: The sequences of SEQ ID NO: 11 and SEQ ID NO:

12.

7. A kit, which comprises the composition according to any one of claims 1 to 3 or the oligonucleotide according to any one of claims 4-6.

8. Use of the composition according to any one of claims 1 to 3 or the oligonucleotide according to any one of claims 4-6 in the preparation of a kit for detecting multiple cancers in vitro.

9. The use according to claim 8, wherein The kit for detecting multiple cancers in vitro detects cancers by a method comprising the following steps: 1) Isolating a DNA sample comprising the target sequence of the target gene or a fragment thereof from a biological sample to be tested; 2) Determining the methylation status of the target sequence of the target gene; 3) Judging the status of the biological sample based on the detection result of the methylation status of the target sequence of the target gene, thereby achieving in vitro detection of cancers.

10. Use of the UBQLN1 gene and / or the UBALD1 gene in the preparation of a kit for detecting multiple cancers in vitro.

Images