Technology for rapidly detecting influenza B virus by RT-RPA-CRISPR / Cas12a one-step method and application thereof

Abstract

The invention provides a detection system for detecting influenza B virus by a one-tube method, and also provides a corresponding kit and a method for detecting influenza B virus. According to the invention, a one-step detection system is established by optimizing reaction temperature and Cas protein concentration and balancing RPA amplification and CRISPR / Cas cis-cleavage reaction. The detection system provided by the invention can specifically recognize the influenza B virus within 45 minutes, does not need uncovering operation, and avoids cross contamination. The detection limit (LoD) of the detection system is 58 copy / test, and no cross reaction exists. The one-tube method detection system and the one-step method detection system have high specificity (98.21% and 98.67%) on detection of the influenza B virus, and have high consistency (96.74% and 96.38%) in clinical samples.

Description

Technical Field

[0001] The present invention belongs to the field of biotechnology. Specifically, the present invention relates to a technique for rapidly detecting influenza B virus by a one-step RT-RPA-CRISPR / Cas12a method and its applications. Background Art

[0002] Influenza B virus (Flu B) causes highly contagious respiratory diseases accompanied by acute fever, posing serious health problems worldwide. Billions of people are infected with influenza B virus every year, and the number is increasing rapidly. Generally, influenza B often pandemics in winter and causes severe and life-threatening complications, including encephalitis, bacterial pneumonia, sinus infections, myocarditis, etc. Although vaccination and the use of antiviral drugs help reduce the incidence of influenza B virus infection, due to the antigenic variation of influenza B virus to escape, the current treatment effect is far from satisfactory. Therefore, there is an urgent need for a timely, rapid, and accurate method for detecting influenza B virus to prevent the losses caused by influenza B virus and optimize clinical treatment plans.

[0003] Influenza B virus is an RNA virus of the Orthomyxoviridae family. Conventional diagnostic methods include virus isolation, antigen detection, and serological detection. However, these methods are time-consuming and cannot provide rapid diagnosis. In recent years, molecular diagnostic techniques represented by nucleic acid amplification based on PCR have been widely used in the detection of respiratory infectious viruses. In addition, corresponding influenza B virus detection methods based on qPCR have been developed. However, due to requirements such as high instrument costs, well-trained technical personnel, and long reaction times, the application of qPCR-based methods is limited. In contrast, isothermal amplification techniques can be carried out at a constant temperature without the need for specialized temperature controllers, accessory equipment, and reagents, etc. Currently, several detection platforms have been used for detecting influenza B virus, such as loop-mediated isothermal amplification (LAMP) and recombinase polymerase amplification (RPA). However, the non-specific products generated during the amplification process reduce the specificity of these isothermal amplification techniques.

[0004] At present, the CRISPR (clustered regularly interspaced short palindromic repeats) / Cas (CRISPR-associated proteins) system applied to gene editing has been extended to the field of nucleic acid detection. Based on the CRISPR / Cas system, several typical molecular diagnostic platforms have been established, including SHERLOCK based on Cas13a, DETECTR and HOLMES based on Cas12a, HOLMESv2 based on Cas12b, etc. It is worth noting that the CRISPR / Cas system can hardly tolerate any mismatches even in a single base, which ensures extremely high specificity for the target sequence. At the same time, a pre-amplification step is strongly recommended to improve the sensitivity of the CRISPR / Cas detection system. Therefore, the combination of isothermal amplification method and CRISPR / Cas system has high sensitivity and specificity for nucleic acid detection. So far, corresponding CRISPR-based influenza virus typing and detection systems have been established. However, in all these platforms, the amplification products need to be transferred to the CRISPR / Cas12a detection system through an open-cap operation, which is prone to cross-contamination. At present, the establishment of a one-step detection system has become a hot topic in the field of CRISPR / Cas diagnosis research. In addition to having trans-cleavage activity, Cas nuclease also has cis-cleavage activity. Therefore, the cis-cleavage of the template and amplification products greatly limits the detection sensitivity, which is a challenge for the development of a one-step CRISPR / Cas detection system.

[0005] Therefore, there is an urgent need in the art to establish a one-step detection method for influenza B virus by RT-RPA-CRISPR / Cas12a on the basis of the existing one-tube detection system by optimizing the reaction temperature and Cas protein concentration. Summary of the Invention

[0006] An object of the present invention is to provide a one-step detection method for influenza B virus by RT-RPA-CRISPR / Cas12a on the basis of the existing one-tube detection system by optimizing the reaction temperature and Cas protein concentration.

[0007] In the first aspect of the present invention, there is provided a one-tube detection system for detecting influenza B virus, characterized in that the detection system includes:

[0008] (a) Cas12 protein, the Cas12 protein is Cas12 or a Cas protein having bypass single-stranded DNA cleavage activity similar to that of Cas12, and the concentration of the Cas12 protein is 125 nM - 500 nM, preferably 125 nM - 250 nM;

[0009] (b) A guide RNA that guides the Cas12 protein to specifically bind to the nucleic acid molecule of influenza B virus; and

[0010] (c) A nucleic acid probe, which is a single-stranded DNA.

[0011] In another preferred embodiment, the working temperature of the Cas12 protein is 38 - 52 °C, preferably 40 - 46 °C.

[0012] In another preferred embodiment, the one-tube method includes a one-tube two-step method and a one-tube one-step method.

[0013] In another preferred embodiment, when the one-tube method is a one-tube two-step method, the concentration of the Cas12 protein is 125 nM - 500 nM.

[0014] In another preferred embodiment, when the one-tube method is a one-tube one-step method, the concentration of the Cas12 protein is 125 nM - 250 nM.

[0015] In another preferred embodiment, when the one-tube method is a one-tube two-step method, the working temperature of the Cas12 protein is 38 - 52 °C, preferably 40 - 46 °C.

[0016] In another preferred embodiment, when the one-tube method is a one-tube one-step method, the working temperature of the Cas12 protein is 40 - 44 °C.

[0017] In another preferred embodiment, the detection includes: qualitative detection or quantitative detection.

[0018] In another preferred embodiment, the detection includes fluorescence detection method and colloidal gold detection method.

[0019] In another preferred embodiment, the fluorescence detection method is carried out using a microplate reader or a fluorescence spectrophotometer.

[0020] In another preferred embodiment, the detection system further contains (d) buffer.

[0021] In another preferred embodiment, when the one-tube method is a one-tube one-step method, the detection system further contains the nucleic acid molecule of influenza B virus to be detected.

[0022] In another preferred embodiment, the nucleic acid molecule of influenza B virus to be detected is selected from the group consisting of: single-stranded DNA, double-stranded DNA, or a combination thereof.

[0023] In another preferred embodiment, the nucleic acid molecule of influenza B virus to be detected is synthetic DNA.

[0024] In another preferred example, the nucleic acid molecule of the influenza B virus to be detected is derived from a non-cultured sample or a sample obtained by a culturing method selected from the following group: cell culture, bacterial culture, virus culture, fungal culture, microbial culture, organoid culture, in vivo enrichment culture in animals, and plant culture.

[0025] In another preferred example, the nucleic acid molecule of the influenza B virus to be detected includes wild-type or mutant DNA.

[0026] In another preferred example, the nucleic acid molecule of the influenza B virus to be detected includes DNA obtained by reverse transcription or amplification of RNA, such as cDNA, etc.

[0027] In another preferred example, the sample is an in vitro or ex vivo sample.

[0028] In another preferred example, the sample includes a nucleic acid sample prepared from the following sample: throat swab.

[0029] In another preferred example, when the one-tube method is a one-tube one-step method, the detection system further contains:

[0030] (e1) A polymerase for amplifying the nucleic acid molecule of the influenza B virus;

[0031] (e2) A reverse transcriptase for reverse transcription;

[0032] (e3) dNTPs for amplification reaction and / or reverse transcription reaction.

[0033] In another preferred example, when the one-tube method is a one-tube one-step method, the detection system further contains reagents for isothermal amplification reaction.

[0034] In another preferred example, the isothermal amplification includes ERA, RPA, RAA, preferably RPA.

[0035] In another preferred example, the concentration of the nucleic acid molecule of the influenza B virus to be detected in the detection system is 50 - 500 copies / μL, preferably 50 - 200 copies / μL.

[0036] In another preferred example, the guide RNA includes a direct repeat (DR) sequence capable of binding to the Cas12 protein and a guide sequence capable of targeting the target sequence.

[0037] In another preferred example, the guide RNA includes a sequence shown in any one of SEQ ID NO.1 - 6, preferably, the guide RNA includes the sequence shown in SEQ ID NO.6.

[0038] In another preferred embodiment, the concentration of the guide RNA is 100 - 800 nM.

[0039] In another preferred embodiment, when the one-tube method is a two-step one-tube method, the concentration of the guide RNA is 250 - 625 nM.

[0040] In another preferred embodiment, when the one-tube method is a one-step one-tube method, the concentration of the guide RNA is 125 - 313 nM.

[0041] In another preferred embodiment, the nucleic acid probe is labeled with a detectable label.

[0042] In another preferred embodiment, the detectable label includes a fluorescent group and a quenching group.

[0043] In another preferred embodiment, the fluorescent group is selected from the group consisting of: FAM, biotin, HEX, Cy3, Cy5, Cy5.5, Cy7, ROX, VIC, JOE, TET, Texas Red, FITC, LC RED640, RB200, NED, Atto 425, Quasar 670, or a combination thereof.

[0044] In another preferred embodiment, the quenching group is selected from the group consisting of: TAMARA, BHQ1, BHQ2, BHQ3, DABSYL, Dabcyl, eclipse, MGB, or a combination thereof.

[0045] In another preferred embodiment, the fluorescent group and the quenching group are each independently located at the 5'-end, 3'-end, and middle of the nucleic acid of the nucleic acid probe.

[0046] In another preferred embodiment, the length of the nucleic acid probe is 5 - 50 nt, preferably 5 - 30 nt, more preferably 5 - 20 nt, still more preferably 5 - 15 nt, still more preferably 8 - 10 nt.

[0047] In another preferred embodiment, the structure of the nucleic acid probe is 5'Z1-N m -3′Z2 (Formula I);

[0048] Wherein, N represents any base selected from A, T, C, and G. Preferably, N is T or C, and more preferably, N is C. 5′Z1 represents Z1 located at the 5', where Z1 is a fluorescent group selected from the group consisting of: FAM, biotin, HEX, Cy3, Cy5, Cy5.5, Cy7, ROX, VIC, JOE, TET, Texas Red, FITC, LC RED640, RB200, NED, Atto 425, Quasar 670, or a combination thereof. And 3′Z2 represents Z2 located at the 3' end, and Z2 is a quenching group selected from the group consisting of: TAMARA, BHQ1, BHQ2, BHQ3, DABSYL, Dabcyl, eclipse, MGB, or a combination thereof. m is a positive integer from 5 to 20, preferably a positive integer from 5 to 15, and more preferably a positive integer from 8 to 10.

[0049] In another preferred embodiment, the concentration of the nucleic acid probe is 8 - 15 μM, preferably 10 μM.

[0050] In another preferred embodiment, the nucleic acid probe comprises single-stranded DNA.

[0051] In another preferred embodiment, the nucleic acid probe comprises single-stranded DNA with a detectable label.

[0052] In another preferred embodiment, the nucleic acid probe is single-stranded DNA labeled with a fluorescent group and a quenching group.

[0053] In another preferred embodiment, the Cas12 protein is selected from the group consisting of: Cas12a, Cas12b, Cas12c, Cas12d, Cas12e, Cas12f, Cas12g, Cas12h, Cas12i, Cas12j, Cas12k, Cas12l, or a combination thereof.

[0054] In another preferred example, the Cas12a is selected from the group consisting of: FnCas12a, AsCas12a, LbCas12a, Lb5Cas12a, HkCas12a, OsCas12a, TsCas12a, BbCas12a, BoCas12a, Lb4Cas12a, CeCas12a, PrCas12a, CsbCas12a, BhCas12a, SsCas12a, Lb3Cas12a, BpCas12a, PdCas12a, BfCas12a, PcCas12a, cMtCas12a, PeCas12a, LiCas12a, Lb2Cas12a, PmCas12a, MbCas12a, EeCas12a, CsbCas12a, ErCas12a, ArCas12a, BsCas12a, AbCas12a or a combination thereof.

[0055] In another preferred example, the source of the Cas12a is selected from the group consisting of: Leptotrichia, Listeria, Corynebacterium, Sutterella, Legionella, Treponema, Lineola, Eubacterium, Streptococcus, Lactobacillus, Mycoplasma, Bacteroides, Flaviivola, Flavobacterium, Azospirillum, Sphaerochaeta, Gluconacetobacter, Neisseria, Rothia, Parvibaculum, Staphylococcus, Nitratifractor, Mycoplasma, Campylobacter, Lachnospira, or a combination thereof.

[0056] In another preferred example, the source of the Cas12a is selected from the following group: Francisella tularensis (FnCas12a), Acidaminococcus sp. BV3L6 (AsCas12a), Lachnospiraceae bacterium ND2006 (LbCas12a), Lachnospiraceae bacterium NC2008 (Lb5Cas12a), Helcococcus sp kunzii (HkCas12a), Oribacterium sp. NK2B42 (OsCas12a), Thiomicrospira sp. XS5 (TsCas12a), Bacteroidales bacterium KA00251 (BbCas12a), Bacteroidetes oral taxon 274 (BoCas12a), Lachnospiraceae bacterium MC2017 (Lb4Cas12a), Coprococcus eutactus (CeCas12a), Prevotella ruminicola strain BPI-34 (PrCas12a), Candidatus Saccharibacteria bacterium (CsbCas12a), Butyrivibrio hungatei strain MB2003 (BhCas12a), Smithella sp. SC_K08D17SC_K08D17) (SsCas12a), Lachnospiraceae bacterium MC2017 (Lb3Cas12a), Butyrivibrio proteoclasticus (BpCas12a), Prevotella disens (PdCas12a), Butyrivibrio fibrisolvens MD2001 (BfCas12a), Porphyromonas crevioricanis PcCas12a, Candidatus Methanoplasma termitum (CMtCas12a), Peregrinibacteria bacterium (PeCas12a), Leptospira inadai serovar Lyme (LiCas12a), Lachnospiraceae bacterium MA2020 (Lb2Cas12a), Porphyromonas macaca (PmCas12a), Moraxella bovoculi 237 (MbCas12a), Eubacterium eligens (EeCas12a), Candidatus Saccharibacteria bacterium (CsbCas12a), Eubacterium rectale (ErCas12a), Agathobacter rectalis strain (ArCas12a), Butyrivibrio sp. NC3005 (BsCas12a), Arcobacter butzleri (AbCas12a), or a combination thereof.

[0057] In another preferred example, when the one-tube method is a one-tube one-step method, the detection system further contains specific nucleic acid amplification primers.

[0058] In another preferred example, the amplification primers include: SEQ ID NO.7 and SEQ ID NO.8.

[0059] In another preferred example, the concentration of the amplification primers is 8 - 15 μM, preferably 10 μM.

[0060] In another preferred example, when the one-tube one-step method is used, the reaction volume of the detection system is 8 - 30 μl, preferably 20 - 30 μl, more preferably 25 μl.

[0061] In another preferred example, when there is no nucleic acid molecule of influenza B virus in the system, the nucleic acid probe is not cleaved by the collateral cleavage of Cas12 protein; while when there is a nucleic acid molecule of influenza B virus in the system, the nucleic acid probe is cleaved by the collateral cleavage of Cas12 protein.

[0062] The second aspect of the present invention provides a kit for detecting influenza B virus by a one-tube two-step method, and the kit includes:

[0063] (i) A first container and Cas12 protein located in the first container, where the Cas12 protein is Cas12 or a Cas protein having collateral single-stranded DNA cleavage activity similar to that of Cas12, and the concentration of the Cas12 protein is 125 nM - 500 nM;

[0064] (ii) Optionally, a second container and guide RNA located in the second container, where the guide RNA guides the Cas12 protein to specifically bind to the nucleic acid molecule of influenza B virus;

[0065] (iii) A third container and a nucleic acid probe located in the third container, where the nucleic acid probe is single-stranded DNA. Preferably, the structure of the nucleic acid probe is 5'Z1-N m -3′Z2 (Formula I);

[0066] wherein, N represents any base selected from A, T, C, G, preferably N is T or C, more preferably N is C, 5′Z1 represents Z1 located at the 5' end, where Z1 is a fluorescent group, and the fluorescent group is selected from the following group: FAM, biotin, HEX, Cy3, Cy5, Cy5.5, Cy7, ROX, VIC, JOE, TET, Texas Red, FITC, LC RED640, RB200, NED, Atto 425, Quasar 670, or a combination thereof, and 3'Z2 represents Z2 located at the 3' end, and Z2 is a quenching group, and the quenching group is selected from the following group: TAMARA, BHQ1, BHQ2, BHQ3, DABSYL, Dabcyl, eclipse, MGB, or a combination thereof, and m is a positive integer of 5 - 20, preferably 5 - 15, more preferably 8 - 10;

[0067] (iv) A fourth container and amplification primers for amplifying the nucleic acid molecule of the influenza B virus to be detected located in the fourth container;

[0068] (v) A fifth container and reagents for the isothermal amplification reaction of nucleic acid molecules of influenza B virus to be detected located within the fifth container;

[0069] (vi) A PCR tube;

[0070] And a label or an instruction manual.

[0071] In another preferred example, the guide RNA includes a sequence shown in any one of SEQ ID NO.1 - 6, and preferably, the guide RNA includes the sequence shown in SEQ ID NO.6.

[0072] In another preferred example, the concentration of the guide RNA is 250 - 625 nM.

[0073] In another preferred example, the components in the first container, the second container, the third container, the fourth container, and the fifth container are all located in the PCR tube. The components in the first container, the second container, and the third container are located in the tube cap, and the components in the fifth container and the sixth container are located at the bottom of the tube.

[0074] In another preferred example, the kit further includes:

[0075] (vii) A sixth container and nucleic acid molecules of influenza B virus to be detected located within the sixth container.

[0076] In another preferred example, the components in the sixth container are located at the bottom of the tube.

[0077] The third aspect of the present invention provides a one - tube one - step method kit for detecting influenza B virus, and the kit includes:

[0078] (i) A first container and a Cas12 protein located within the first container. The Cas12 protein is Cas12 or a Cas protein having a bypass single - stranded DNA cleavage activity similar to that of Cas12, and the concentration of the Cas12 protein is 125 nM - 250 nM;

[0079] (ii) Optionally, a second container and a guide RNA located within the second container. The guide RNA guides the Cas12 protein to specifically bind to the nucleic acid molecule of influenza B virus;

[0080] (iii) A third container and a nucleic acid probe located within the third container. The nucleic acid probe is a single - stranded DNA. Preferably, the structure of the nucleic acid probe is 5'Z1 - N m - 3′Z2 (Formula I);

[0081] Wherein, N represents any one of the bases selected from A, T, C, and G. Preferably, N is T or C, and more preferably, N is C. 5′Z1 represents Z1 located at the 5′ end, where Z1 is a fluorescent group selected from the group consisting of: FAM, biotin, HEX, Cy3, Cy5, Cy5.5, Cy7, ROX, VIC, JOE, TET, Texas Red, FITC, LC RED640, RB200, NED, Atto 425, Quasar 670, or a combination thereof. And 3′Z2 represents Z2 located at the 3′ end. Z2 is a quenching group selected from the group consisting of: TAMARA, BHQ1, BHQ2, BHQ3, DABSYL, Dabcyl, eclipse, MGB, or a combination thereof. m is a positive integer from 5 to 20, preferably from 5 to 15, and more preferably from 8 to 10.

[0082] (iv) A fourth container and amplification primers located within the fourth container for amplifying nucleic acid molecules of the influenza B virus to be detected.

[0083] (v) A fifth container and reagents for the isothermal amplification reaction of nucleic acid molecules of the influenza B virus to be detected located within the fifth container.

[0084] (vi) A PCR tube.

[0085] And a label or instruction manual.

[0086] In another preferred example, the guide RNA includes the sequence shown in any one of SEQ ID NO.1-6. Preferably, the guide RNA includes the sequence shown in SEQ ID NO.6.

[0087] In another preferred example, the concentration of the guide RNA is 125-313 nM.

[0088] In another preferred example, the components in the first container, second container, third container, fourth container, and fifth container are all located in the PCR tube, preferably at the bottom of the PCR tube.

[0089] In another preferred example, the kit further includes:

[0090] (vii) A sixth container and nucleic acid molecules of the influenza B virus to be detected located within the sixth container.

[0091] In another preferred example, the components in the sixth container are located in the PCR tube, preferably at the bottom of the PCR tube.

[0092] The fourth aspect of the present invention provides a method for detecting whether there is an influenza B virus in a sample by a one-tube two-step method. The detection method includes:

[0093] (a) Provide a reaction system, which includes: the detection system and the amplification system described in the first aspect of the present invention. The detection system and the amplification system are located in the same tube. The detection system is located on the tube cap, and the amplification system is located at the bottom of the tube. The amplification system contains the nucleic acid molecules of the influenza B virus to be detected from the sample and amplification primers for isothermal amplification reaction to amplify the nucleic acid molecules of the influenza B virus to be detected;

[0094] (b) At the bottom of the same tube, perform nucleic acid amplification on the nucleic acid molecules of the influenza B virus in the amplification system to obtain an amplification product of the nucleic acid molecules of the influenza B virus;

[0095] (c) In the same tube, add the detection system on the tube cap to the amplification system containing the amplification product at the bottom of the tube, and detect the detectable signal emitted by the nucleic acid probe;

[0096] Among them, if the nucleic acid probe is cleaved by Cas12 protein, it indicates that there is influenza B virus in the sample; if the nucleic acid probe is not cleaved by Cas12 protein, it indicates that there is no influenza B virus in the sample.

[0097] In another preferred example, the concentration of the Cas12 protein is 125 nM - 500 nM.

[0098] In another preferred example, the working temperature of the Cas12 protein is 38 - 52 °C, preferably 40 - 46 °C.

[0099] In another preferred example, the detection includes: qualitative detection or quantitative detection.

[0100] In another preferred example, the detection includes fluorescence detection method and colloidal gold detection method.

[0101] In another preferred example, the fluorescence detection method is performed using a microplate reader or a fluorescence spectrophotometer.

[0102] In another preferred example, the detection system further contains (d) buffer.

[0103] In another preferred example, the amplification system further contains:

[0104] (e1) A polymerase for amplifying the nucleic acid molecules of the influenza B virus;

[0105] (e2) A reverse transcriptase for reverse transcription;

[0106] (e3) dNTPs for amplification reaction and / or reverse transcription reaction.

[0107] In another preferred example, the concentration of the nucleic acid molecule of the influenza B virus to be detected is 50 - 500 copies / μL, preferably 50 - 200 copies / μL.

[0108] In another preferred example, the guide RNA includes the sequence shown in any one of SEQ ID NO.1 - 6. Preferably, the guide RNA includes the sequence shown in SEQ ID NO.6.

[0109] In another preferred example, the concentration of the guide RNA is 250 - 625 nM.

[0110] In another preferred example, the structure of the nucleic acid probe is 5'Z1 - N m -3′Z2 (Formula I);

[0111] Wherein, N represents any base selected from A, T, C, G. Preferably, N is T or C, and more preferably N is C. 5′Z1 represents Z1 located at the 5' end, where Z1 is a fluorescent group, and the fluorescent group is selected from the following group: FAM, biotin, HEX, Cy3, Cy5, Cy5.5, Cy7, ROX, VIC, JOE, TET, Texas Red, FITC, LC RED640, RB200, NED, Atto 425, Quasar 670, or a combination thereof. And 3′Z2 represents Z2 located at the 3' end, and Z2 is a quenching group, and the quenching group is selected from the following group: TAMARA, BHQ1, BHQ2, BHQ3, DABSYL, Dabcyl, eclipse, MGB, or a combination thereof. m is a positive integer of 5 - 20, preferably 5 - 15, and more preferably 8 - 10.

[0112] In another preferred example, the amplification primers include: SEQ ID NO.7 and SEQ ID NO.8.

[0113] The fifth aspect of the present invention provides a method for detecting whether there is an influenza B virus in a sample by a one - tube one - step method. The detection method includes:

[0114] (a) Providing a reaction system, the reaction system includes: the detection system described in the first aspect of the present invention, an amplification system, and a detection sample containing the nucleic acid molecule of the influenza B virus to be detected. Wherein the detection system, the amplification system, and the detection sample containing the nucleic acid molecule of the influenza B virus to be detected are in the same tube. Preferably, the detection system, the amplification system, and the detection sample containing the nucleic acid molecule of the influenza B virus to be detected are at the bottom of the tube. The amplification system contains amplification primers for isothermal amplification reaction to amplify the nucleic acid molecule of the influenza B virus to be detected;

[0115] (b) At the bottom of the same tube, nucleic acid amplification of the influenza B virus nucleic acid molecule is performed to obtain an amplification product of the influenza B virus nucleic acid molecule, and at the same time, a detectable signal emitted by the nucleic acid probe is detected;

[0116] Among them, if the nucleic acid probe is cleaved by Cas12 protein, it indicates the presence of influenza B virus in the sample; if the nucleic acid probe is not cleaved by Cas12 protein, it indicates the absence of influenza B virus in the sample.

[0117] In another preferred example, the concentration of the Cas12 protein is 125 nM - 250 nM.

[0118] In another preferred example, the working temperature of the Cas12 protein is 40 - 44 °C.

[0119] In another preferred example, the detection includes: qualitative detection or quantitative detection.

[0120] In another preferred example, the detection includes fluorescence detection method and colloidal gold detection method.

[0121] In another preferred example, the fluorescence detection method is performed using a microplate reader or a fluorescence spectrophotometer.

[0122] In another preferred example, the detection system further contains buffer (d).

[0123] In another preferred example, the amplification system further contains:

[0124] (e1) A polymerase for amplifying the nucleic acid molecule of influenza B virus;

[0125] (e2) A reverse transcriptase for reverse transcription;

[0126] (e3) dNTP for amplification reaction and / or reverse transcription reaction.

[0127] In another preferred example, the concentration of the nucleic acid molecule of the influenza B virus to be detected is 50 - 500 copies / μL, preferably 50 - 200 copies / μL.

[0128] In another preferred example, the guide RNA includes the sequence shown in any one of SEQ ID NO.1 - 6, preferably, the guide RNA includes the sequence shown in SEQ ID NO.6.

[0129] In another preferred example, the concentration of the guide RNA is 125 - 313 nM.

[0130] In another preferred example, the structure of the nucleic acid probe is 5'Z1 - N m -3′Z2 (Formula I);

[0131] Wherein, N represents any base selected from A, T, C, and G. Preferably, N is T or C, and more preferably, N is C. 5′Z1 represents Z1 located at the 5′ end, where Z1 is a fluorescent group selected from the group consisting of: FAM, biotin, HEX, Cy3, Cy5, Cy5.5, Cy7, ROX, VIC, JOE, TET, Texas Red, FITC, LC RED640, RB200, NED, Atto 425, Quasar 670, or a combination thereof. And 3′Z2 represents Z2 located at the 3′ end. Z2 is a quenching group selected from the group consisting of: TAMARA, BHQ1, BHQ2, BHQ3, DABSYL, Dabcyl, eclipse, MGB, or a combination thereof. m is a positive integer from 5 to 20, preferably from 5 to 15, and more preferably from 8 to 10.

[0132] In another preferred example, the amplification primers include: SEQ ID NO.7 and SEQ ID NO.8.

[0133] In another preferred example, the reaction volume of the detection system is 8 - 30 μl, preferably 20 - 30 μl, and more preferably 25 μl.

[0134] It should be understood that within the scope of the present invention, the above-mentioned technical features of the present invention and the technical features specifically described below (such as in the examples) can be combined with each other to form new or preferred technical solutions. Due to space limitations, they will not be elaborated one by one here. BRIEF DESCRIPTION OF THE DRAWINGS

[0135] Figure 1 : Workflow of one-tube and one-step RT-RPA-CRISPR / Cas12a systems for detecting influenza B virus. A. One-tube detection system: Prepare the RT-RPA amplification system at the bottom of the tube and the CRISPR / Cas12a detection system on the tube cap. After amplification, the CRISPR / Cas12a system is added to the RT-RPA system and mixed by transient centrifugation. Cas12a is activated in the presence of the target sequence and releases a fluorescent signal by trans-cleaving the FAM-labeled ssDNA probe. B. For the one-step influenza B virus detection system, the RT-RPA amplification system is mixed with the CRISPR / Cas12a detection system at the bottom of the tube, and a constant temperature reaction is carried out on a fluorescence signal detector. Influenza B virus positive samples will release significant fluorescent signals, while no significant fluorescent signals are observed for influenza B virus negative samples.

[0136] Figure 2: Selection of primers for amplification of influenza B virus in RT-RPA amplification reaction. According to the conserved regions of the nucleic acid sequence of influenza B virus, 3 forward primers (F1-F3) were designed and combined with 3 reverse primers (R1-R3) respectively. The RNA extracted from influenza B pseudovirus was used as the amplification template (1000 copies per reaction), and RPA amplification was carried out at 38 °C according to the kit recommendations. The amplification products were detected by 2% agarose gel electrophoresis.

[0137] Figure 3 : Selection of crRNA for the RT-RPA-CRISPR / Cas12a one-tube detection system. A total of 6 kinds of crRNA (crRNA1-crRNA 6) were designed according to the target nucleic acid sequence, and they were evaluated and selected for the one-tube detection system of influenza B virus. In a 10 μL reaction system, it was incubated at 38 °C for 30 min, and the RNA template of influenza B pseudovirus (500 copies per reaction) was amplified by the RPA method. The CRISPR / Cas12a detection system was incubated at 48 °C for 10 min in a 10 μL reaction system.

[0138] Figure 4 : Optimization of the conditions for the one-tube detection system of influenza B virus.

[0139] A. Select the optimal working temperature of Lb5Cas12a. Using 500 copies / test RNA as the template, the RT-RPA amplification reaction was carried out at 38 °C for 30 min, and the CRISPR / Cas12a cleavage reaction was maintained at 48 °C for 10 min (n = 3 replicates, Student's t-test; *p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001; columns represent mean ± SD; ns represents no significant difference).

[0140] B. Analyze the optimal concentration of Lb5Cas12a. Using 500 copies / test RNA as the template, the RT-RPA amplification was carried out at 38 °C for 30 min, and the CRISPR / Cas12a reaction was maintained at 48 °C for 10 min (n = 3 replicates, Student's t-test; *p < 0.05; columns represent mean ± SD; ns represents no significant difference).

[0141] C. Detect the performance of different probes. Using 500 copies / test RNA as a template, the RT-RPA amplification reaction was carried out at 38 °C for 30 min, and the CRISPR / Cas12a reaction was maintained at 48 °C for 10 min (n = 3 replicates, Student t-test; **p < 0.01, ***p < 0.001, ***p < 0.001, ****p < 0.0001; columns represent mean ± SD; nd indicates that no fluorescence signal was detected).

[0142] Figure 5 : Performance test of the one-step influenza B detection system. Using 400 copies of influenza B pseudovirus RNA per test as a template, the reaction system was 10 μL.

[0143] A. Fluorescence intensity detected by Lb5Cas12a at different working temperatures.

[0144] B. Select the optimal working temperature of Lb5Cas12a (n = 3 replicates, Student t-test; *p < 0.05; columns represent mean ± SD; ns indicates no significant difference).

[0145] C. Analyze the optimal concentration of Lb5Cas12a (n = 3 replicates, Student t-test; *p < 0.05, ***p < 0.001; columns represent mean ± SD; ns indicates no significant difference; nd indicates that no fluorescence signal was detected).

[0146] Figure 6 : Optimization of the conditions of the one-tube and one-step influenza B virus detection systems. A. Detect the fluorescence intensity of template plasmids at different doses using the one-tube influenza B virus detection system (n = 10 replicates). B. Predict the limit of detection (LoD) of the one-tube influenza B virus detection system using the Sigmoid function. C. Detect the fluorescence intensity of template plasmids at different doses using the one-step influenza B virus detection system (n = 10 replicates). D. Predict the LoD of the one-step influenza B virus detection system using the Sigmoid function.

[0147] Figure 7 : Specificity determination of the RT-RPA-CRISPR / Cas12a system for detecting influenza B virus. Using 6 interfering nucleic acid samples, with influenza B pseudovirus nucleic acid as the positive control (PC) and nuclease-free water as the no-template control (NTC), analyze the specificity of the one-step RT-RPA CRISPR / Cas12a system for detecting influenza B virus. Detailed implementation method

[0148] After extensive and in-depth research, the present inventor has developed for the first time a one-tube two-step method or a one-tube one-step method for detecting influenza B virus, combining the RT-RPA method with the CRISPR / Cas12a system to establish a new rapid influenza B detection system (named Fast-Flu). By optimizing the reaction temperature and Cas protein concentration and balancing the RPA amplification and CRISPR / Cas cis-cleavage reaction, a one-step detection system was established. The detection system of the present invention can specifically identify influenza B virus within 45 minutes, without opening the lid operation and avoiding cross-contamination. The limit of detection (LoD) of the detection system of the present invention is 58 copies / time, and there is no cross-reaction. The one-tube method and one-step method detection systems of the present invention have high specificity for the detection of influenza B virus (98.21% and 98.67%), and have high consistency in clinical samples (96.74% and 96.38%). The establishment of the RT-RPA-CRISPR / Cas12a one-step method system of the present invention realizes the timely, rapid and accurate detection of influenza B virus, and has potential clinical diagnostic value. The detection system of the present invention also provides a promising tool and reference for the rapid nucleic acid detection of other RNA viruses. On this basis, the present inventor has completed the present invention.

[0149] Term

[0150] The term "PCR" refers to the polymerase chain reaction technology, which is a technology suitable for amplifying target nucleic acids.

[0151] As used herein, the term "CRISPR" refers to Clustered regularly interspaced short palindromic repeats, which are derived from the immune system of microorganisms.

[0152] CRISPR-Cas: A unique genomic element derived from bacteria and archaea, serving as an adaptive immune defense system to resist invading phages or foreign nucleic acids. This system consists of Clustered regularly interspaced short palindromic repeats (CRISPR) and CRISPR-associated proteins (abbreviated as Cas proteins, Cas).

[0153] The term "Cas protein" refers to CRISPR-associated protein, which is a related protein in the CRISPR system.

[0154] The term "Cas12a" (formerly known as "Cpf1") refers to a crRNA-dependent endonuclease, which is an enzyme of type V-A in the CRISPR system classification.

[0155] The terms "Cas12b" and "C2c1" are used interchangeably and refer to an sgRNA-dependent endonuclease, which is an enzyme of type V-B in the CRISPR system classification.

[0156] The term "PAM" refers to a protospacer-adjacent motif, which is a short DNA sequence directly adjacent to the DNA sequence targeted by a CRISPR effector protein and is essential for Cas12a or Cas12b to cleave double-stranded DNA. For example, the PAM of Cas12a is TTTV.

[0157] The term "target DNA or RNA molecule", when the nucleic acid molecule is to be detected, refers to the DNA or RNA to be detected or its specific part; when the non-nucleic acid molecule is to be detected, the target DNA or RNA molecule is a pre-designed nucleic acid sequence.

[0158] Cas protein

[0159] As used herein, the "Cas protein" refers to a CRISPR-associated protein (which is translated as CRISPR-Cas effector protein, CRISPR / Cas effector protein, CRISPR-Cas effector, or CRISPR / Cas effector in some literatures), and can be a type V Cas protein or a type VI Cas protein. Once a type V Cas protein binds to a cis-cleavage substrate under the guidance of a guide RNA to form a ternary complex of Cas protein-guide RNA-cis-cleavage substrate, it can induce its trans-cleavage activity, that is, randomly cleave single-stranded nucleic acids and their equivalents (nucleic acid equivalents such as nucleic acid analogs).

[0160] The Cas protein described in this specific embodiment is a protein with trans-cleavage activity. In particular, it still has activity, especially trans-cleavage activity, at a temperature higher than the temperature of the system for performing the isothermal amplification reaction.

[0161] The Cas protein described in this specific embodiment can be a type V Cas protein; the Cas protein is selected from the following groups: type V-A Cas protein, type V-B Cas protein, type V-C Cas protein, type V-D Cas protein, type V-E Cas protein, type V-F Cas protein, type V-G Cas protein, type V-H Cas protein, type V-I Cas protein, type V-J Cas protein, type V-L, type V-M Cas protein or a combination thereof; the Cas protein described in this specific embodiment includes Cas12, such as Cas12a, Cas12b, Cas12c, Cas12d, Cas12e, Cas12f, Cas12g, Cas12h, Cas12i, Cas12j, Cas12l, Cas12m or a combination thereof.

[0162] In a specific embodiment, the Cas protein referred to herein has trans-cleavage activity, such as Cas12, and also encompasses functional variants of the Cas protein or its homologs or orthologs. As used herein, a "functional variant" of a protein refers to a variant of such a protein that retains at least partially the trans-cleavage activity of the protein. Functional variants can include mutants (which can be insertion, deletion, or substitution mutants), including polymorphs, etc. Also included among functional variants are fusion products of such a protein with another nucleic acid, protein, polypeptide, or peptide that is not normally related. Functional variants can be naturally occurring or can be artificial. Advantageous embodiments can involve engineered or non-naturally occurring type V DNA-targeting effector proteins.

[0163] In one embodiment, the type V Cas protein or its ortholog or homolog can comprise one or more mutations, and thus the nucleic acid molecule encoding it can have one or more mutations. The mutations can be artificially introduced mutations and can include, but are not limited to, one or more mutations in the catalytic domain.

[0164] In one embodiment, the type V Cas protein can be from: Leptotrichia, Listeria, Corynebacterium, Sutterella, Legionella, Treponema, Lineola, Eubacterium, Streptococcus, Lactobacillus, Mycoplasma, Bacteroides, Flaviivola, Flavobacterium, Azospirillum, Sphaerochaeta, Gluconacetobacter, Neisseria, Rothia, Parvibaculum, Staphylococcus, Nitratifractor, Mycoplasma, Campylobacter, Lachnospira, or a combination thereof.

[0165] Table I Type V family effector properties (from: doi:10.3389 / fcell.2020.622103)

[0166]

[0167] a V represents A, C, and G.

[0168] b R represents A and G C B represents C, G, and T.

[0169] Guide RNA

[0170] As used herein, the "guide RNA" is a mature crRNA fused with a tracrRNA as a guide RNA, or a mature crRNA fused with a scoutRNA as a guide RNA, or the crRNA alone as a guide RNA.

[0171] Generally, a guide RNA can contain direct repeat sequences (also known as DR sequences) and a guide sequence, or can consist essentially of or consist of direct repeat sequences and a guide sequence (also known as a spacer in the context of an endogenous CRISPR system). In different CRISPR systems, depending on the Cas protein it relies on, the gRNA can include a crRNA and a tracrRNA, can also include a crRNA and a scoutRNA, or can contain only a crRNA. The crRNA and tracrRNA can be artificially engineered and fused to form a single guide RNA (sgRNA). In some cases, the guide sequence is a polynucleotide sequence that has sufficient complementarity with the cis-cleavage substrate DNA to hybridize with the cis-cleavage substrate DNA and guide the specific binding of the CRISPR / Cas protein-guide RNA complex to the cis-cleavage substrate DNA, and usually has a sequence length of 15-28 nt. The aforementioned direct repeat sequences can fold into a specific structure (such as a stem-loop structure) for Cas protein recognition to form a complex. The guide sequence does not need to be 100% complementary to the cis-cleavage substrate DNA. The guide sequence is not complementary to the nucleic acid in the trans-cleavage reporter molecule.

[0172] In certain embodiments, when optimally aligned, the degree of complementarity (match) between the guide sequence and its corresponding cis-cleavage substrate DNA is at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, or at least 99%. Determining the optimal alignment is within the ability of those of ordinary skill in the art. For example, there are publicly available and commercially available alignment algorithms and programs, such as but not limited to ClustalW, the Smith-Waterman algorithm in matlab, Bowtie, Geneious, Biopython, and SeqMan.

[0173] The terms "polynucleotide", "nucleotide sequence", "nucleic acid sequence", "nucleic acid molecule", and "nucleic acid" can be used interchangeably and include DNA, RNA, or their hybrids, and can be double-stranded or single-stranded.

[0174] The terms "homology" or "identity" are used to refer to the sequence match between two polypeptides or two nucleic acids. When a position in two sequences being compared is occupied by the same base or amino acid monomer subunit (e.g., a position in each of two DNA molecules is occupied by adenine, or a position in each of two polypeptides is occupied by lysine), then the molecules are identical at that position between the two sequences. Generally, the comparison is made by aligning the two sequences to yield maximum identity. Such alignments can be performed by using, for example, the identity of amino acid sequences can be determined by conventional methods, referring to the teachings of, for example, Smith and Waterman, 1981, Adv. Appl. Math. 2:482; Pearson & Lipman, 1988, Proc. Natl. Acad. Sci. USA 85:244; Thompson et al., 1994, Nucleic Acids Res 22:467380, etc., by computerized running algorithms (GAP, BESTFIT, FASTA, and TFASTA in the Wisconsin Genetics software package, Genetics Computer Group). The BLAST algorithm available from the National Center for Biotechnology Information (NCBI, www.ncbi.nlm.nih.gov / ) can also be used with default parameters to determine it.

[0175] Target nucleic acid molecule (nucleic acid molecule of influenza B virus to be detected)

[0176] As used herein, when the nucleic acid molecule is to be detected, the "target nucleic acid molecule" refers to a polynucleotide molecule extracted from a biological sample (sample to be tested) or its amplification product, transcription product, or reverse transcription product. When the non-nucleic acid molecule is to be detected, the "target nucleic acid molecule" is a nucleic acid sequence designed in advance. The biological sample is any solid or fluid sample obtained, excreted, or secreted from any organism, including but not limited to single-celled organisms such as bacteria, yeast, protozoa, and amoeba, etc., and multicellular organisms (such as plants or animals, including samples from healthy or seemingly healthy human subjects or human patients affected by a disorder or disease to be diagnosed or investigated, such as infections by pathogenic microorganisms such as pathogenic bacteria or viruses). For example, the biological sample can be a biological fluid obtained from, for example, blood, plasma, serum, urine, feces, sputum, mucus, lymph fluid, synovial fluid, bile, ascites, pleural effusion, seroma, saliva, cerebrospinal fluid, aqueous or vitreous humor, or any body secretion, exudate, or effusion (e.g., a fluid obtained from an abscess or any other infected or inflamed site), or a fluid obtained from a joint (e.g., a normal joint or a joint affected by a disease such as rheumatoid arthritis, osteoarthritis, gout, or septic arthritis), or a swab of the skin or mucosal surface. The sample can also be a sample obtained from any organ or tissue (including biopsy or autopsy specimens such as tumor biopsies) or can contain cells (primary cells or cultured cells) or a culture medium conditioned by any cell, tissue, or organ. Exemplary samples include but are not limited to cells, cell lysates, blood smears, cytocentrifugation preparations, cytology smears, body fluids (such as blood, plasma, serum, saliva, sputum, urine, bronchoalveolar lavage, semen, etc.), tissue biopsies (such as tumor biopsies), fine needle aspirates, and / or tissue sections (such as cryostat tissue sections and / or paraffin-embedded tissue sections).

[0177] In other embodiments, the biological sample can be plant cells, callus, tissues, or organs (such as roots, stems, leaves, flowers, seeds, fruits), etc.

[0178] In the present invention, the target nucleic acid molecule includes a DNA molecule, and also includes an RNA molecule or a DNA molecule formed by reverse transcribing RNA. Or further, the target nucleic acid molecule is amplified by a technique well-known in the art, and the amplification technique is an isothermal amplification technique. The isothermal amplification can be ERA, RPA, or RAA.

[0179] In the present invention, the target nucleic acid molecule is amplified with an isothermal amplification reagent, and the isothermal amplification reagent includes an isothermal amplification kit from Suzhou Xianda Gene Technology Co., Ltd.

[0180] A method for amplification and detection in a one-tube two-step manner without opening the lid

[0181] This specific embodiment discloses a detection method for amplifying and detecting a target nucleic acid molecule (the nucleic acid molecule of influenza B virus to be detected) in a one-tube two-step manner without opening the lid.

[0182] In a preferred embodiment, this specific embodiment provides a method for detecting whether influenza B virus is present in a sample by a one-tube two-step method, and the detection method includes:

[0183] (a) Provide a reaction system, and the reaction system includes: the detection system and the amplification system described in the first aspect of the present invention. Among them, the detection system and the amplification system are located in the same tube. The detection system is located on the tube lid, and the amplification system is located at the bottom of the tube. The amplification system contains the nucleic acid molecule of the influenza B virus to be detected from the sample and amplification primers for isothermal amplification reaction to amplify the nucleic acid molecule of the influenza B virus to be detected;

[0184] (b) At the bottom of the same tube, perform nucleic acid amplification on the nucleic acid molecule of the influenza B virus in the amplification system to obtain an amplification product of the nucleic acid molecule of the influenza B virus;

[0185] (c) In the same tube, add the detection system on the tube lid to the amplification system containing the amplification product at the bottom of the tube, and detect the detectable signal emitted by the nucleic acid probe;

[0186] Among them, if the nucleic acid probe is cleaved by Cas12 protein, it indicates that influenza B virus is present in the sample; if the nucleic acid probe is not cleaved by Cas12 protein, it indicates that influenza B virus is not present in the sample.

[0187] In the present invention, a representative nucleic acid probe is single-stranded DNA or single-stranded RNA with a luminescent group and a quenching group connected to both ends, and single-stranded DNA or single-stranded RNA with a luminescent group and biotin connected to both ends. Therefore, once the probe is cleaved, the luminescent group can emit light or form a band on the T line.

[0188] In this specific embodiment, it can be known whether the sample contains a target nucleic acid molecule, such as the nucleic acid molecule of influenza B virus, by detecting fluorescence.

[0189] In this specific embodiment, a suitable Cas protein is a type V Cas protein with trans-cleavage activity, preferably Cas12a or Cas12b. More preferably, the Cas12a is preferably FnCas12a, LbCas12a, ErCas12a, Evcas12a, Lb5Cas12a, HkCas12a, OsCas12a, TsCas12a, BbCas12a, BoCas12a, Lb4Cas12a, CeCas12a, PrCas12a, CsbCas12a, BhCas12a, SsCas12a, Lb3Cas12a, BpCas12a, PdCas12a, BfCas12a, PcCas12a, cMtCas12a, PeCas12a, LiCas12a, Lb2Cas12a, PmCas12a, MbCas12a, EeCas12a, CsbCas12a, ArCas12a, BsCas12a, AbCas12a, AsCas12a, or a combination thereof.

[0190] The method of this specific embodiment can be used to quickly detect whether a sample contains a target nucleic acid molecule (Mycoplasma pneumoniae). In addition, by combining with isothermal amplification techniques (such as any one of ERA, RPA, and RAA), the sensitivity and specificity of this detection method can be greatly improved. Various isothermal amplification techniques in the prior art can theoretically be used in the present invention, and only preferred embodiments are listed in this specific embodiment. Components used in various amplification techniques in this application, such as:

[0191] NTP, buffer, Mg required for RNA amplification 2+ etc., and RNase H required when the reverse transcriptase has no function of digesting single-stranded RNA;

[0192] dNTP, buffer, Mg required for DNA amplification 2+ etc.;

[0193] These contents are common general knowledge in the art, so they are not specifically described in this application.

[0194] A method of performing amplification and detection in one tube and one step without opening the lid

[0195] This specific embodiment discloses a method for detecting a target nucleic acid molecule (nucleic acid molecule of influenza B virus to be detected) by performing amplification and detection in one tube and one step without opening the lid.

[0196] In a preferred embodiment, this specific embodiment provides a method for detecting whether influenza B virus exists in a sample by one tube and one step. The detection method includes:

[0197] (a) Provide a reaction system, the reaction system comprising: the detection system, amplification system, and a test sample containing nucleic acid molecules of influenza B virus to be detected according to the first aspect of the present invention, wherein the detection system, amplification system, and the test sample containing nucleic acid molecules of influenza B virus to be detected are located in the same tube. Preferably, the detection system, amplification system, and the test sample containing nucleic acid molecules of influenza B virus to be detected are located at the bottom of the tube, and the amplification system contains amplification primers for isothermal amplification reaction to amplify the nucleic acid molecules of influenza B virus to be detected;

[0198] (b) At the bottom of the same tube, perform nucleic acid amplification on the nucleic acid molecules of influenza B virus to obtain an amplification product of the nucleic acid molecules of influenza B virus, and simultaneously detect the detectable signal emitted by the nucleic acid probe;

[0199] Wherein, if the nucleic acid probe is cleaved by Cas12 protein, it indicates the presence of influenza B virus in the sample; if the nucleic acid probe is not cleaved by Cas12 protein, it indicates the absence of influenza B virus in the sample.

[0200] Based on the existing one-tube detection system, the present invention has established a one-step detection method for influenza B virus by RT-RPA-CRISPR / Cas12a by optimizing the reaction temperature and Cas protein concentration. The transformation from a two-step to a one-step method in one tube has been completed, making the operation more convenient. This idea will also provide a reference for constructing CRISPR / Cas systems to detect other pathogens and targets.

[0201] The main advantages of the present invention include:

[0202] (1) The present invention for the first time develops a one-tube two-step method or one-tube one-step method for detecting influenza B virus, combines the RT-RPA method with the CRISPR / Cas12a system, and establishes a new rapid detection system for influenza B (named Fast-Flu). By optimizing the reaction temperature and Cas protein concentration and balancing the RPA amplification and CRISPR / Cas cis-cleavage reaction, a one-step detection system is established. The detection system of the present invention can specifically identify influenza B virus within 45 minutes, without opening the lid operation and avoiding cross-contamination. The limit of detection (LoD) of the detection system of the present invention is 58 copies / time, and there is no cross-reaction. The one-tube method and one-step method detection systems of the present invention have high specificity for the detection of influenza B virus (98.21% and 98.67%), and have high consistency in clinical samples (96.74% and 96.38%). The establishment of the RT-RPA-CRISPR / Cas12a one-step method system of the present invention realizes the timely, rapid and accurate detection of influenza B virus, and has potential clinical diagnostic value. The detection system of the present invention also provides a promising tool and reference for the rapid nucleic acid detection of other RNA viruses.

[0203] (2) The present invention combines the RT-RPA amplification and the CRISPR / Cas12a cleavage reaction in a single tube, and establishes a one-tube method and one-step method detection system for influenza B virus. This reaction can be carried out under constant temperature conditions, does not require expensive precision equipment and complex operations, and has the advantages of simplicity, rapidity, accuracy and no pollution, and can be used for the diagnosis of human influenza B virus. Timely and accurate diagnosis of influenza B virus is a necessary condition for preventing the pandemic of influenza B virus. These findings of this study provide a new perspective for the development of one-step CRISPR / Cas systems for detecting other pathogens and targets.

[0204] 1. Materials and Methods

[0205] 1.1 Design and Selection of RPA Primers for Influenza B Virus

[0206] Download the nucleic acid sequences of influenza B virus from the NCBI database (https: / / www.ncbi.nlm.nih.gov / ) and perform BLAST analysis. Design PRA primers based on the conserved region (CTTGTTGCYACTGATGATCTTACAGTGGAGGATGAAAAAGATGGCCATCGGATCCTCAACTCACTCTTCGAGCGTTTTGATGAAGGACATTCAAAGCCAATTCGAGCAGCTGAAACTGCGGTGGGAGTCTTATCCCAATTTGGTCAAGAGCACCGATTATCACCAGA, SEQ ID NO.9). Three pairs of forward primers (F1 - F3) and reverse primers (R1 - R3) were designed and synthesized by Shanghai Sangon Biotech Co., Ltd. The primers are shown in Table 1. In addition, the RNA extracted from the purchased influenza B pseudovirus (DP315, Beyotime, China) was used as a template. Then, the corresponding forward and reverse primer combinations (Table 2) were used for RPA amplification with a commercial kit (KS102), 1000 copies of RNA template per reaction, incubated at 38 °C for 30 min, and the product quality was detected by agarose gel electrophoresis to select the best primer combination.

[0207] Table 1 PRA primer sequences, positions, and entropy values

[0208]

[0209]

[0210] F1 to F3: forward primers; R1 to R3: reverse primers.

[0211] Table 2 Amplification product lengths and Tm values of different primer pairs

[0212]

[0213] 1.2 Design and selection of crRNA in the one - tube RT - RPA - CRISPR / Cas12a system

[0214] According to the selected primer sequences, 6 kinds of Cas 12a crRNAs (crRNA1 - crRNA6) were designed and screened in the one - tube and one - step detection systems. The sequences of the crRNAs are as follows, with the target sequences underlined: crRNA1: 5’ - UAAUUUCUACUAAGUGUAGAU AAAGCCAAUUCGAGCAGC UG-3’(SEQ ID NO.1), crRNA2: 5’ - UAAUUCUACUAAGUGUAGAU GAGCAGCUGAAACU GCGGUG-3’(SEQ ID NO.2),crRNA3: 5’-UAAUUUCUACUAAGUGUAGAU CACCGCAGUUUCAGCUGCUC-3’(SEQ ID NO.3), crRNA4: 5’-AAUUUCUACUAAGUGUAGAU CAGCUGCUCGAAUUGGCUUU-3’(SEQ ID NO.4), crRNA5: 5’-UAAUUUCUACUAAGUGUAGAU CAGCUGCU CGAAUUGGCUUU-3’(SEQ ID NO.5), crRNA6: 5’-UAAUUUCUACUAAGUGUAGAU AGCUGCUCGAAUU GGCUUUG-3’(SEQ ID NO.6) All crRNAs were synthesized using a commercial high-yield Cas12a crRNA synthesis and purification kit (31903-01, TOLOBIO, China) according to the manufacturer's instructions. In a 10 μL reaction system, it was incubated at 38 °C for 30 min, and the RNA template of influenza B pseudovirus (500 copies per time) was amplified by the RPA method. The CRISPR / Cas12a system was incubated at 48 °C for 10 min in a 10 μL reaction system, and the availability of crRNAs was evaluated based on the threshold time, and the fluorescence intensity was collected every 30 s.

[0215] 1.3 Condition optimization of the one-tube RT-RPA-CRISPR / Cas12a (i.e., one-tube two-step) detection system

[0216] The one-tube influenza B virus detection system includes two parts: RT-RPA amplification and CRISPR / Cas12a detection. The total volume of the RT-RPA detection is 24 μL, including 1.05 μL of FluB-F (10 μL), 1.05 μL of FluB-R (10 μL) (F1R2, 10 μM), 5 μL of RNA template (100 copies / μL), 1 μL of activator (Xinda Gene), and 15.9 μL of nuclease-free water. In the one-tube influenza B virus detection system, the RT-RPA reaction was carried out on a QuantStudio 3 real-time fluorescence quantitative PCR system (QuantStudio 3, ThermoFisher, USA) at a temperature of 38 °C, with 500 copies per time of RNA (from influenza B pseudovirus) for 30 minutes.

[0217] The CRISPR / Cas12a detection system contains 3.0 μL HOLMES Buffer (Tolo Biotech, Hong Kong Science Park) (10x), 0.75 μL Lb5Cas12a (10 μM, 32110, ToLo Biotech, China), 0.75 μL crRNA (10 μM), and 1.5 μL ssDNA Reporter (10 μM, 31101, ToLo Biotech, China). The CRISPR / Cas12a system was incubated for 10 minutes. The settings of Cas12a, crRNA6, ssDNA probe reporter, protein concentration, working temperature, and concentration are shown in Table 3. The CRISPR / Cas12a system was maintained at different temperatures for 10 min under a reaction volume of 10 μL. Then, the fluorescence intensity was collected every 30 s.

[0218] Table 3 Optimization of the conditions of the one-tube two-step RT-RPA-CRISPR / Cas12a system

[0219]

[0220] 1.4 Optimization of the conditions of the one-step RT-RPA-CRISPR / Cas12a detection system

[0221] The total volume of the one-step detection system is 25 μL, including 1.05 μL FluB-F (10 μL), 1.05 μL FluB-R (10 μL) (F1R2, 10 μM), 5 μL RNA template (500 copies / μL), 1 μL RNA template, 1 μL activator, 1.25 μL Lb5Cas12a (10 μM), 2.5 μL crRNA (10 μM), 0.5 μL Reporter (10 μL) (probe concentration 10 μM), and 12.65 μL nuclease-free water. The reaction was carried out at 40 °C for 45 min, and the fluorescence signal was collected every 1 min. At the same time, the reaction temperatures were set at 36 °C, 38 °C, 40 °C, 42 °C, and 44 °C. The concentrations of Cas12a were 62.5 nM (10 μM, 0.1625 μL), 125 nM (10 μM, 0.325 μL), 250 nM (10 μM, 0.75 μL), and 500 nM (10 μM, 1.5 μL), respectively. The concentrations of crRNA6 were adjusted to 125 nM (10 μM, 0.325 μL), 188 nM (10 μM, 0.489 μL), 250 nM (10 μM, 0.75 μL), and 313 nM (10 μM, 0.939 μL), respectively. Next, the ssDNA probe reporter gene was selected according to the method of the one-tube detection system.

[0222] The total volume of the one-step detection system is 25 μL, including 1.05 μL FluB-F (10 μM), 1.05 μL FluB-R (10 μM) (the primers are F1R2), 5 μL RNA template (500 copies / μL), 1 μL RNA template, 1 μL activator, 1.25 μL Lb5Cas12a (10 μM), 2.5 μL crRNA (10 μM), 0.5 μL reporter protein (10 μL), and 12.65 μL nuclease-free water.

[0223] Set the working temperatures and concentrations of Cas12a, crRNA6, and ssDNA probe under different conditions, as shown in Table 4 in detail. React at different temperature gradients for 45 min, and collect fluorescence signals every 1 min.

[0224] Table 4 Condition optimization of the one-step RT-RPA-CRISPR / Cas12a system

[0225]

[0226] 1.5 Sensitivity analysis of one-step RT-RPA-CRISPR / Cas12a for detecting influenza B

[0227] To determine the limit of detection (LoD) of one-tube and one-step influenza B virus detection, the recombinant plasmid of influenza B virus was serially diluted to 200 copies / time, 100 copies / time, 50 copies / time, and 25 copies / time. At each dose, each reaction required 10 replicates. According to the positive results at each dose, the LoD was determined using the Sigmoid function prediction method.

[0228] 1.6 Specificity detection of one-step RT-RPA-CRISPR / Cas12a for influenza B virus

[0229] To determine the specificity of the detection, six interfering samples of Streptococcus pyogenes (GAS), Acinetobacter baumannii (AB), human parainfluenza virus (HPIV), Mycoplasma pneumoniae (MP), Klebsiella pneumoniae (KP), and H1N1 avian influenza (H1N) (purchased from Beina Chuanglian Biotechnology Co., Ltd. in the mall) were collected for detection. The nucleic acid of influenza B pseudovirus was used as the positive control (PC), and nuclease-free water was used as the no-template control (NTC). All samples were detected using the one-step RT-RPA CRISPR / Cas12a detection system, and the reaction was carried out three times.

[0230] 1.7 Verification of the RT-RPA-CRISPR / Cas12a system in human clinical samples

[0231] To verify the detection performance of the RT-RPA-CRISPR / Cas12a system for influenza B virus, 101 throat swab samples were provided by Huaibei People's Hospital. The samples were from 101 patients, including 60 males and 41 females, aged from 5 days to 91 years. All patients provided written informed consent for this study. This study was approved by the Ethics Committee of Huaibei People's Hospital (No. 2024-052).

[0232] RNA samples were extracted from human throat swab samples using a commercial kit (DP315, Beyotime, China) according to the instructions and used as templates for target sequence amplification in the RT-RPA reaction. All samples were simultaneously detected by the one-tube method and one-step method of RT-RPA-CRISPR / Cas12a described in this article. The results determined by the qPCR method were used as the gold standard for comparison. According to the detection results, the consistency between the one-tube method or one-step method and the qPCR method was analyzed.

[0233] 1.8 Data processing and statistical analysis

[0234] The detection results were expressed as the relative fluorescence intensity of the samples. Each sample was detected with at least 3 biological replicates, and the data were expressed as mean±SD. Statistical analysis was performed using GraphPad Prism 10 software (GraphPad software Inc., CA, USA). Statistical differences were evaluated by t-test. The LoD was predicted using the Sigmoid function. p<0.05 was considered statistically significant.

[0235] Example 1 Workflow of one-tube method and one-step method of RT-RPA-CRISPR / Cas12a system for detecting influenza B virus

[0236] The workflow of the one-tube method of RT-RPA-CRISPR / Cas12a for detecting influenza B virus is shown in Figure 1 (A, B). Briefly, the RT-RPA amplification and CRISPR / Cas12a detection were prepared in one tube. The RT-RPA amplification reaction was carried out at the bottom of the tube, and the CRISPR / Cas12a detection system was prepared in the tube cap. After the RT-RPA reaction amplified the target sequence of influenza B virus, the CRISPR / Cas12a detection system was centrifuged into the RT-RPA reaction system by transient centrifugation. With the help of the FAM-labeled single-stranded DNA (ssDNA) probe, the fluorescence signal would be released and displayed on the fluorescence signal detector. When a positive sample of influenza B virus was detected, a significant fluorescence signal could appear, while when a negative sample of influenza B virus was detected, no significant fluorescence signal was detected. This one-tube detection system could be completed within 40 minutes, including 30 minutes for RT-RPA amplification reaction and 10 minutes for CRISPR / Cas12a detection.

[0237] Correspondingly, the RT-RPA-CRISPR / Cas12a one-step detection system for influenza B virus refers to the simultaneous mixing of the RT-RPA and CRISPR / Cas12a systems at the bottom of the tube in one reaction. In the RT-RPA-CRISPR / Cas12a one-step system, the reaction is completed within 45 minutes and analyzed on a fluorescence signal detector. Graphical abstract B shows the workflow of the RT-RPA-CRISPR / Cas12a one-step detection of influenza B virus.

[0238] Example 2 Screening of RT-RPA primers for influenza B virus

[0239] According to the specific conserved regions of the influenza B virus nucleic acid sequence, 3 forward primers (F1-F3) and 3 reverse primers (R1-R3) were designed for RT-RPA amplification. They were paired to form 9 primer combinations for RT-RPA amplification of the target sequence of influenza B virus. To select the best primer combination, the amplification products were detected by agarose gel electrophoresis for quality. According to the product yield, F1 / R2 was determined as the optimal primer combination ( Figure 2 ).

[0240] Example 3 Selection of crRNA in the RT-RPA-CRISPR / Cas12a one-tube system

[0241] According to the amplified influenza B virus nucleic acid sequence, 6 Cas12a crRNAs (crRNA1-crRNA 6) were synthesized for screening. When performing one-tube detection of influenza B virus, we found that the detection efficiency was the highest when using crRNA6 ( Figure 3 ). Therefore, crRNA6 was selected for the one-tube influenza B virus detection system.

[0242] Example 4 Condition optimization of the RT-RPA-CRISPR / Cas12a one-tube system

[0243] According to our previous results, the RT-RPA amplification reaction temperature was set at 38 °C. Next, the working temperature of Cas12a ranged from 38 °C to 54 °C, increasing by 2 °C each time. As Figure 4 shown in A, when the working temperature of Cas12a was 42 °C, the fluorescence intensity was the highest, and 42 °C was determined as the optimal temperature.

[0244] In the one-tube influenza B virus detection system, the Cas12a concentration was diluted to 62.5 nM, 125 nM, 250 nM, and 500 nM, respectively. The results showed that Cas12a performed best at a concentration of 250 nM ( Figure 4 B).

[0245] Afterwards, the ssDNA FAM-labeled probe of P8C showed better performance than the other three probes, and P8C was selected as the probe used in the one-tube detection reaction of influenza B virus( Figure 4 C).

[0246] Example 5 Optimization of the reaction conditions of the one-step RT-RPA-CRISPR / Cas12a system

[0247] According to the above conditions, we further optimized the reaction conditions of the one-step influenza B virus detection system, including the optimal reaction temperature and Cas12a concentration. First, the reaction temperature of Cas12a was set at 36 - 44 °C, increasing by 2 °C each time. Obviously, the fluorescence intensity at 40 °C was significantly higher than that at 38 °C, and there was no significant difference between 40 °C and 42 °C. Therefore, the temperature of the one-step influenza B virus detection system was set at 40 °C( Figure 5 A and 5B).

[0248] The Lb5Cas12a concentration was diluted to 62.5 nM, 125 nM, 250 nM, and 500 nM respectively. The data showed that the fluorescence intensity was the highest at a concentration of 125 nM( Figure 5 C). When the Lb5Cas12a concentration exceeded 125 nM, the fluorescence intensity decreased, indicating that the trans-cleavage reaction weakened and the cis-cleavage reaction enhanced.

[0249] Example 6 Sensitivity analysis of the one-tube and one-step RT-RPA-CRISPR / Cas12a methods for detecting influenza B virus

[0250] To determine the sensitivity of the one-tube and one-step RT-RPA-CRISPR / Cas12a methods for detecting influenza B virus, the recombinant plasmids were diluted to 200 copies / time, 100 copies / time, 50 copies / time, and 25 copies / time respectively. Ten replicates were performed at each gradient. Ten positive results were detected at 200 copies / time and 100 copies / time, nine positive results were detected at 50 copies / time, and six positive results were detected at 25 copies / time( Figure 6 A and 6C), and the detection rates were 100%, 100%, 90%, and 60% respectively. By using the one-tube and one-step RT-RPA-CRISPR / Cas12a detection systems, the Sigmoid function showed that the LoD was 58 copies / time( Figure 6 B and 6D), with a probability of 95%.

[0251] Example 7 Specificity of the RT-RPA-CRISPR / Cas12a one-step system for detecting influenza B virus To verify the specificity of the one-step method for detecting influenza B virus, a total of 6 interfering samples, namely Streptococcus pyogenes (GAS), Acinetobacter baumannii (AB), human parainfluenza virus (HPIV), Mycoplasma pneumoniae (MP), Klebsiella pneumoniae (KP), and H1N1 avian influenza (H1N), were collected for detection. The nucleic acid of influenza B pseudovirus was used as the positive control (PC), and nuclease-free water was used as the no-template control (NTC). As Figure 7 shown, only the PC sample produced obvious fluorescence intensity, and no obvious signal was observed in the interfering samples. The results indicate that the one-step detection system has high specificity for influenza B virus and has no cross-reaction with other nucleic acid samples.

[0252] Example 8 Performance determination of the RT-RPA-CRISPR / Cas12a one-tube method and one-step method detection systems for detecting influenza B virus in clinical samples

[0253] To test the performance of the RT-RPA-CRISPR / Cas12a one-tube method and one-step method detection systems in actual clinical samples, a total of 276 throat swab samples were collected for determination. All samples were simultaneously detected for influenza B virus using the RT-RPA-CRISPR / Cas12a one-tube method and one-step method. At the same time, the results of a commercial influenza B virus detection kit based on qPCR were used as a reference. As shown in Table 5, 52 positive and 224 negative influenza B viruses were identified by the qPCR method. Using the one-tube method detection system, the positive and negative samples were 51 and 225 respectively, with a sensitivity of 90.38% and a specificity of 98.21%; a total of 267 samples were consistent between the two methods, and the consistency between the one-tube method and the qPCR method was 96.74% (267 / 276). Using the one-step method detection system, a total of 48 positive and 228 negative samples were identified, with a sensitivity of 86.54% and a specificity of 98.67% (Table 6); among them, 266 samples were consistent with the qPCR-based method, 45 positive and 221 negative; in 276 samples, the consistency between the one-step method and the qPCR method was 96.38% (266 / 276).

[0254] Table 5 Comparison of the performance of the RPA-CRISPR / Cas12a one-tube method and qPCR for detecting FluB

[0255]

[0256] Table 6: Comparison of the performance of the RPA-CRISPR / Cas12a one-step method and qPCR for detecting FluB

[0257]

[0258] Discussion

[0259] In this study, we established a one-step method for the detection of influenza B virus by combining RT-RPA amplification and CRISPR / Cas12a detection in a single tube. It can specifically identify influenza B virus within 45 minutes, with a LoD of 58 copies per test. Compared with the qPCR method, we determined the performance of the one-step influenza B virus detection system in 276 clinical throat swab samples. The results showed that the sensitivity of this method was 86.54%, the specificity was 98.67%, and the consistency between the two methods was 96.38%. In summary, the one-step detection system we established can detect influenza B virus timely, rapidly, and accurately, thus contributing to the early diagnosis and precise treatment of influenza B.

[0260] So far, isothermal amplification-mediated technologies have mainly focused on the field of molecular diagnosis. Using an RT-RPA-based method combined with a lateral flow strip, simultaneous detection of SARS-CoV-2 and influenza viruses (influenza A virus and influenza B virus) was achieved within 1 hour, with a sensitivity as low as 10 copies of viral RNA. Nathan A Tanner and his colleagues established a multi-channel RT-LAMP that can detect influenza virus RNA (influenza A virus / influenza B virus) and SARS-CoV-2 in a single reaction. However, up to 6 primers are required for target sequence amplification in the LAMP reaction, which can lead to an increase in primer dimer formation and result in false positive results. Compared with LAMP, only a pair of primers is sufficient for target sequence amplification based on our PRA method. In addition, the one-tube and one-step method for detecting influenza B virus completes the whole detection process within 45 minutes under isothermal conditions and can be used for rapid detection of influenza B virus in resource-limited areas. Most importantly, all reagents used for the reaction can be prepared in advance by freeze-drying, providing sufficient scientific basis for the development of point-of-care diagnosis of influenza B virus.

[0261] However, false positive results caused by non-specific products limit the application of isothermal amplification technology. To improve sensitivity and specificity, the CRISPR / Cas system was introduced, and an RPA-CRISPR / Cas nucleic acid detection method was established, especially for pathogen identification. By coupling RPA with CRISPR / Cas12a, an influenza B detection method was developed with a sensitivity of 1 plaque-forming unit per reaction and no cross-reaction. Unfortunately, all these platforms involve two separate steps, isothermal amplification of the target sequence and CRISPR / Cas12a detection, which means that the amplification products need to be transferred to the CRISPR / Cas12a detection system through an open-cap operation. In this case, the high risk of aerosol contamination is inevitable. In addition, reagent preparation and centrifugation operations are required at the tube cap, increasing the procedural complexity of the two-step system. Therefore, it is difficult to achieve the clinical translational application of in vitro diagnostic products based on a one-tube two-step operation mode. To solve the above problems, we developed a one-step RT-RPA-CRISPR / Cas12a system for the detection of influenza B virus, which allows all reactions to be carried out in a single reaction tube, thus avoiding the open-cap operation and therefore avoiding aerosol contamination. Compared with the one-tube influenza B virus detection system, the cost of the one-step influenza B virus detection system was reduced by 75%. First, the reaction volume of the one-step detection system was reduced from 20 μl to 10 μl. Second, the concentration of Cas12a was reduced from 250 nM to 125 nM, which also helped to inhibit cis-cleavage induced by high Cas12a concentrations. These advantages are of great significance for reducing medical costs and achieving clinical translational application.

[0262] The nucleic acid detection method based on qPCR is recognized as the gold standard for nucleic acid detection. However, high Ct values often result in uncertain negative or positive results, known as the "gray zone" problem. Compared with qPCR results, our one-tube and one-step detection systems have higher specificity (98.21% and 98.67%) for the detection of influenza B virus and higher consistency (96.74% and 96.38%) in clinical samples. Therefore, when using our one-tube and one-step RT-RPA-CRISPR / Cas12a detection systems, the "gray zone" problem in the qPCR method is avoided. That is to say, our CRISPR-based one-step influenza B virus detection system is reliable, specific for the detection of influenza B virus, and the LoD per detection is 58 copies.

[0263] In summary, we combined the RT-RPA amplification and CRISPR / Cas12a cleavage reactions in a single tube to establish a one-tube and one-step detection system for influenza B virus. This reaction can be carried out under isothermal conditions, without the need for expensive precision equipment and complex operations, and has the advantages of simplicity, rapidity, accuracy, and pollution-free, and can be used for the diagnosis of human influenza B virus. Timely and accurate diagnosis of influenza B virus is a prerequisite for preventing the pandemic of influenza B virus. These findings of this study provide a new perspective for the development of one-step CRISPR / Cas systems for detecting other pathogens and targets.

[0264] All documents mentioned in this invention are incorporated herein by reference as if each individual document was specifically and individually incorporated by reference. In addition, it should be understood that after reading the above teachings of this invention, those skilled in the art can make various changes or modifications to this invention, and these equivalent forms also fall within the scope defined by the appended claims of this application.

Claims

1. A one-tube method for detecting influenza B virus detection system, characterized in that, The detection system includes: (a) A Cas12 protein, which is Cas12 or a Cas protein having bypass single-stranded DNA cleavage activity similar to that of Cas12, and the concentration of the Cas12 protein is 125 nM - 500 nM, preferably 125 nM - 250 nM; (b) A guide RNA that guides the Cas12 protein to specifically bind to the nucleic acid molecule of influenza B virus; and (c) A nucleic acid probe, which is a single-stranded DNA.

2. The detection system according to claim 1, characterized in that, The working temperature of the Cas12 protein is 38 - 52 °C, preferably 40 - 46 °C.

3. The detection system according to claim 1, wherein The guide RNA includes the sequence shown in any one of SEQ ID NO.1 - 6. Preferably, the guide RNA includes the sequence shown in SEQ ID NO.

6.

4. The detection system according to claim 1, characterized in that, When the one-tube method is a two-step one-tube method, the concentration of the guide RNA is 250 - 625 nM.

5. The detection system according to claim 1, wherein When the one-tube method is a one-step one-tube method, the concentration of the guide RNA is 125 - 313 nM.

6. The detection system according to claim 1, wherein, The structure of the nucleic acid probe is 5′Z1-N m -3′Z2 (Formula I); Wherein, N represents any base selected from A, T, C, G. Preferably, N is T or C, more preferably N is C. 5′Z1 represents Z1 located at the 5', and Z1 is a fluorescent group selected from the group consisting of: FAM, biotin, HEX, Cy3, Cy5, Cy5.5, Cy7, ROX, VIC, JOE, TET, Texas Red, FITC, LC RED640, RB200, NED, Atto 425, Quasar 670, or a combination thereof. And 3′Z2 represents Z2 located at the 3' end, and Z2 is a quenching group selected from the group consisting of: TAMARA, BHQ1, BHQ2, BHQ3, DABSYL, Dabcyl, eclipse, MGB, or a combination thereof. m is a positive integer of 5 - 20, preferably a positive integer of 5 - 15, more preferably a positive integer of 8 - 10.

7. A kit for detecting influenza B virus by a one-tube two-step method, characterized in that, The kit includes: (i) A first container and the Cas12 protein located in the first container, which is Cas12 or a Cas protein having bypass single-stranded DNA cleavage activity similar to that of Cas12, and the concentration of the Cas12 protein is 125 nM - 500 nM; (ii) Optionally, a second container and the guide RNA located in the second container, which guides the Cas12 protein to specifically bind to the nucleic acid molecule of influenza B virus; (iii) The third container and the nucleic acid probe located within the third container, the nucleic acid probe being single-stranded DNA, preferably, the structure of the nucleic acid probe being 5'Z1-N m -3′Z2 (Formula I); Wherein, N represents any base selected from A, T, C, and G. Preferably, N is T or C, and more preferably, N is C. 5′Z1 represents Z1 located at the 5', where Z1 is a fluorescent group, and the fluorescent group is selected from the group consisting of: FAM, biotin, HEX, Cy3, Cy5, Cy5.5, Cy7, ROX, VIC, JOE, TET, Texas Red, FITC, LC RED640, RB200, NED, Atto 425, Quasar 670, or a combination thereof. And 3'Z2 represents Z2 located at the 3' end, and Z2 is a quenching group, and the quenching group is selected from the group consisting of: TAMARA, BHQ1, BHQ2, BHQ3, DABSYL, Dabcyl, eclipse, MGB, or a combination thereof. m is a positive integer of 5-20, preferably 5-15, and more preferably 8-10; (iv) A fourth container and amplification primers located in the fourth container for amplifying the nucleic acid molecule of the influenza B virus to be detected; (v) A fifth container and reagents for the isothermal amplification reaction of the nucleic acid molecule of the influenza B virus to be detected located in the fifth container; (vi) A PCR tube; And a label or an instruction manual; Preferably, the components in the first container, the second container, the third container, the fourth container, and the fifth container are all located in the PCR tube. The components in the first container, the second container, and the third container are located in the tube cap, and the components in the fifth container and the sixth container are located at the bottom of the tube.

8. A kit for detecting influenza B virus by a one-tube one-step method, characterized in that, The kit includes: (i) A first container and a Cas12 protein located in the first container. The Cas12 protein is Cas12 or a Cas protein having a bypass single-stranded DNA cleavage activity similar to that of Cas12, and the concentration of the Cas12 protein is 125 nM - 250 nM; (ii) Optionally, a second container and a guide RNA located in the second container. The guide RNA guides the Cas12 protein to specifically bind to the nucleic acid molecule of the influenza B virus; (iii) The third container and the nucleic acid probe located within the third container, the nucleic acid probe being single-stranded DNA, preferably, the structure of the nucleic acid probe being 5'Z1-N m -3′Z2 (Formula I); Wherein, N represents any base selected from A, T, C, and G. Preferably, N is T or C, and more preferably, N is C. 5′Z1 represents Z1 located at the 5', where Z1 is a fluorescent group, and the fluorescent group is selected from the group consisting of: FAM, biotin, HEX, Cy3, Cy5, Cy5.5, Cy7, ROX, VIC, JOE, TET, Texas Red, FITC, LC RED640, RB200, NED, Atto 425, Quasar 670, or a combination thereof. And 3'Z2 represents Z2 located at the 3' end, and Z2 is a quenching group, and the quenching group is selected from the group consisting of: TAMARA, BHQ1, BHQ2, BHQ3, DABSYL, Dabcyl, eclipse, MGB, or a combination thereof. m is a positive integer of 5-20, preferably 5-15, and more preferably 8-10; (iv) A fourth container and amplification primers located in the fourth container for amplifying the nucleic acid molecule of the influenza B virus to be detected; (v) A fifth container and reagents for isothermal amplification reaction of nucleic acid molecules of influenza B virus to be detected, which are located in the fifth container; (vi) PCR tubes; And labels or instructions; Preferably, the components in the first container, the second container, the third container, the fourth container, and the fifth container are all located in the PCR tube, and preferably, at the bottom of the PCR tube.

9. A method for detecting the presence of influenza B virus in a sample by a one-tube two-step method, characterized in that, The detection method includes: (a) Providing a reaction system, the reaction system includes: the detection system and the amplification system according to claim 1, wherein the detection system and the amplification system are located in the same tube, the detection system is located on the tube cap, and the amplification system is located at the bottom of the tube. The amplification system contains nucleic acid molecules of influenza B virus to be detected from the sample source and amplification primers for isothermal amplification reaction to amplify the nucleic acid molecules of influenza B virus to be detected; (b) Nucleic acid amplification of the nucleic acid molecules of influenza B virus is carried out at the bottom of the same tube to obtain an amplification product of the nucleic acid molecules of influenza B virus; (c) In the same tube, the detection system on the tube cap is added to the amplification system containing the amplification product at the bottom of the tube to detect the detectable signal emitted by the nucleic acid probe; Among them, if the nucleic acid probe is cleaved by Cas12 protein, it indicates that influenza B virus exists in the sample; if the nucleic acid probe is not cleaved by Cas12 protein, it indicates that influenza B virus does not exist in the sample.

10. A method for detecting the presence of influenza B virus in a sample by a one-tube one-step method, characterized in that, The detection method includes: (a) Providing a reaction system, the reaction system includes: the detection system, the amplification system and a test sample containing nucleic acid molecules of influenza B virus to be detected, wherein the detection system, the amplification system and the test sample containing nucleic acid molecules of influenza B virus to be detected are located in the same tube. Preferably, the detection system, the amplification system and the test sample containing nucleic acid molecules of influenza B virus to be detected are located at the bottom of the tube. The amplification system contains amplification primers for isothermal amplification reaction to amplify the nucleic acid molecules of influenza B virus to be detected; (b) Nucleic acid amplification of the nucleic acid molecules of influenza B virus is carried out at the bottom of the same tube to obtain an amplification product of the nucleic acid molecules of influenza B virus, and at the same time, the detectable signal emitted by the nucleic acid probe is detected; Among them, if the nucleic acid probe is cleaved by Cas12 protein, it indicates that influenza B virus exists in the sample; if the nucleic acid probe is not cleaved by Cas12 protein, it indicates that influenza B virus does not exist in the sample.

Images