Leptospora NC-K143 for preventing and treating pathogenic bacteria infection, bacteriostatic agent and application thereof

By screening and developing NC-K143 of Nordic NC-K143 as a bacteriostatic agent, the prevention and treatment problems of drug-resistant Staphylococcus aureus were solved, safe and effective control of pathogen infections was achieved, and antibiotic use and environmental pollution were reduced.

CN120272381AActive Publication Date: 2025-07-08JIANGXI PROVINCIAL PEOPLES HOSPITAL

Patent Information

Application Number
CN202510685515.8
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-05-27
Publication Date
2025-07-08
Estimated Expiration
2045-05-27

AI Technical Summary

Technical Problem

The prior art lacks effective means of preventing and treating drug-resistant Staphylococcus aureus, especially the problem of multidrug resistance to MRSA, resulting in increased antibiotic use and environmental pollution.

Method used

The NC-K143, which has antagonistic effect on Staphylococcus aureus, was screened out and developed as an antibacterial agent to prepare drugs to prevent and treat pathogenic infection.

Benefits of technology

It provides a safe and effective biological control factor, which reduces the use of antibiotics and reduces the risk of environmental pollution and drug-resistant strains.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120272381A_ABST
    Figure CN120272381A_ABST
Patent Text Reader

Abstract

The invention discloses a pathogenic bacterium infection prevention and treatment krill NC-K143, a bacteriostatic agent and application of the pathogenic bacterium infection prevention and treatment krill NC-K143 and the bacteriostatic agent. According to the present invention, the classification name of the Leptospora sp. NC-K143 is Kitasatospora sp.NC-K143, the strain has been preserved in the China Center for Type Culture Collection on March 27, 2025, and the preservation number is CCTCC NO: M 2025616. The invention further provides the application of the Leptospora sp. NC-K143, and the Leptospora sp. NC-K143 and the application of the Leptospora sp. NC-K143, according to the present invention, the Leptospora kurtosis NC-K143 provides inhibition effects for a variety of bacteria and yeast-like fungi, and particularly provides the best inhibition effects for gram-positive bacteria, such as staphylococcus aureus; the krill NC-K143 disclosed by the invention can be used for preparing a medicine for preventing and treating pathogenic bacteria infection of a human body, and has important significance on reducing the use of a large amount of antibiotics, reducing environmental pollution and reducing the generation of drug-resistant bacteria.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to the field of microorganisms, and particularly to a Bacillus kitasatoi NC-K143 for preventing and treating pathogenic bacterial infections, an antibacterial agent and its application. Background Art

[0002] Staphylococcus aureus is an important human pathogen, belonging to the genus Staphylococcus, and is a representative of Gram-positive bacteria. Penicillin has played an important role in controlling Staphylococcus aureus infections. However, with the use of antibiotics, different drug-resistant strains have emerged one after another, including penicillin-resistant Staphylococcus aureus (PRSA), methicillin-resistant Staphylococcus aureus (MRSA), and vancomycin-resistant Staphylococcus aureus (VRSA). As a typical representative of superbugs, MRSA has developed into multi-drug resistance and has become one of the multi-drug resistant bacteria that are key targets for clinical drug resistance monitoring.

[0003] Therefore, it is urgent to develop different prevention and treatment technologies, especially for drug-resistant strains. Using biocontrol strains and their active products as a new type of biocontrol microbial factor to prevent and treat pathogenic bacteria has attracted more and more attention. Therefore, screening and identifying biocontrol strains with significant antagonistic effects against Staphylococcus aureus is of great significance for the treatment of Staphylococcus aureus infections, especially drug-resistant Staphylococcus aureus infections. Summary of the Invention

[0004] In order to solve the above technical problems, the present invention provides a Bacillus kitasatoi NC-K143 for preventing and treating pathogenic bacterial infections, an antibacterial agent and its application.

[0005] In a first aspect, the present invention provides a Bacillus kitasatoi NC-K143 for preventing and treating pathogenic bacterial infections, which is achieved through the following technical solutions.

[0006] A Bacillus kitasatoi NC-K143 for preventing and treating pathogenic bacterial infections, classified and named Kitasatospora sp. NC-K143. This strain was deposited at the China Center for Type Culture Collection on March 27, 2025, with the deposit number CCTCC NO: M2025616, and the deposit address is No. 299, Bayi Road, Wuchang District, Wuhan City, Hubei Province.

[0007] Furthermore, Kitasatospora sp. NC-K143 grows well on Gao's No. 1 medium, and the strain cells are rod-shaped; when cultured on an LB agar plate, the colonies are circular, reddish-brown, opaque, with a dry and wrinkled surface, irregular edges, a sunken center, and are embedded in the surface of the solid medium.

[0008] Furthermore, the fermentation medium of Kitasatospora sp. NC-K143 comprises 20.0 g / L of sucrose, 30.0 g / L of soluble starch, 2.0 g / L of peptone, 8.0 g / L of soybean powder, 0.5 g / L of MgSO4·7H2O, 0.5 g / L of K2HPO4·7H2O, 2.0 g / L of NaCl, 3.0 g / L of CaCO3, and an initial pH of 8.0.

[0009] In a second aspect, the present invention provides a use of Kitasatospora sp. NC-K143 for preventing and treating pathogen infections, which is achieved through the following technical solutions.

[0010] An application of the above-mentioned Kitasatospora sp. NC-K143 in the preparation of a drug for preventing and treating pathogen infections.

[0011] Furthermore, the pathogens include Candida krusei, Candida guilliermondii, Candida auris, Candida albicans, Pseudomonas aeruginosa, Bacillus velezensis, Bacillus cereus, Staphylococcus aureus, and Clostridium perfringens.

[0012] In a third aspect, the present invention provides an antibacterial agent, which is achieved through the following technical solutions.

[0013] An antibacterial agent comprising the above-mentioned Kitasatospora sp. NC-K143.

[0014] In a fourth aspect, the present invention provides a use of an antibacterial agent, which is achieved through the following technical solutions.

[0015] An application of the above-mentioned antibacterial agent in the preparation of a drug for preventing and treating pathogen infections.

[0016] This application has the following beneficial effects:

[0017] In view of the lack of highly effective and safe drug treatments for current Staphylococcus aureus infections and the fact that Staphylococcus aureus is prone to developing resistance to common methicillin antibiotics, through the isolation, screening, and efficacy tests of Staphylococcus aureus antagonistic bacteria, a new strain of Kitasatospora sp. NC-K143 with antagonistic effects against Staphylococcus aureus was isolated and screened. Based on this, a new type of biological control factor was developed, which is of great significance for reducing the use of a large amount of antibiotics, alleviating environmental pollution, and the generation of drug-resistant bacteria. BRIEF DESCRIPTION OF THE DRAWINGS

[0018] Figure 1It is the colony morphology diagram of Kitasatospora NC-K143 of the present invention; Figure 2 It is the microscopic morphology diagram of Kitasatospora NC-K143 of the present invention; Figure 3 It is the antibacterial effect diagram of Kitasatospora NC-K143 of the present invention; Figure 4 It is the antibacterial effect diagram of Kitasatospora NC-K143 of the present invention in different culture media; Figure 5 It is the cytotoxicity result diagram of different concentrations of supernatant of Kitasatospora NC-K143 of the present invention; Figure 6 It is the molecular identification result diagram of Kitasatospora NC-K143 of the present invention; Figure 7 It is the phylogenetic tree diagram of Kitasatospora NC-K143 of the present invention; Figure 8 It is the result diagram of the growth curve of Staphylococcus aureus inhibited by different concentrations of supernatant of Kitasatospora NC-K143 of the present invention. Detailed implementation manners

[0019] The invention will be further described below in conjunction with the drawings and embodiments. Unless otherwise specified, the experimental methods adopted in the present invention are conventional methods, and the experimental equipment, materials, reagents, etc. used can be purchased from relevant material sales companies.

[0020] Example 1: Separation and purification of strains 1. Culture medium Gause's No. 1 medium: KNO3 1.0 g, K2HPO4·3H2O 0.5 g, MgSO4·7H2O 0.5 g, NaCl 0.5 g, FeSO4·7H2O 0.01 g, soluble starch 20.0 g, agar 20.0 g, distilled water 1.0 L, pH 7.2 - 7.4, sterilized at 121°C for 20 minutes.

[0021] 2. Experimental steps 2.1 Preparation of culture medium Prepare Gause's No. 1 agar medium and prepare bacterial culture medium plates.

[0022] 2.2 Sample collection Collect rhizosphere soil of plants from schools, hospitals, parks and other places in different regions, put it into bags and make records.

[0023] 2.3 Grind the soil and prepare a suspension Grind the soil into small pieces, cut and resuspend it in sterile water, and prepare a soil dilution (10 -1), take the supernatant and dilute it by 10-fold gradient (10 -2 , 10 -3 , 10 -4 , 10 -5 ) for later use.

[0024] 2.4 Bacterial isolation Select 0.1 ml each from the above four concentrations of 10 -2 , 10 -3 , 10 -4 and 10 -5 and spread them onto the prepared Gause's No. 1 solid medium plates respectively. Invert the inoculated petri dishes and incubate them at 28°C for 3 days. Then, pick as many monoclonal colonies with different morphologies as possible.

[0025] 3. Results 500 strains of bacteria were isolated by the above method.

[0026] Example 2: Plate antagonism test of the isolated bacteria against Staphylococcus aureus 1. Culture media 1.1 Solid medium LB solid medium: 10 g of tryptone, 5 g of yeast extract, 10 g of sodium chloride, 15 g of agar powder. Add distilled water and make up to 1 L. Sterilize at 121°C for 20 minutes.

[0027] 1.2 Liquid medium LB liquid medium: That is, without adding agar, and the other components are the same as those of LB solid medium.

[0028] 2. Experimental procedures 2.1 Plate antagonism test - primary screening 2.1.1 Bacterial strain activation Activate the strains of Staphylococcus aureus and bacteria: Transfer Staphylococcus aureus and the isolated bacteria to LB medium plates and Gause's No. 1 medium plates respectively, and incubate them at 35°C and 28°C for 2 days for later use.

[0029] 2.1.2 Preparation of Staphylococcus aureus plates Inoculate the activated Staphylococcus aureus into the liquid medium for shake flask culture at 35°C and 200 rpm. On the second day, pour LB medium into plates. After the medium cools to 45°C, add 0.1 ml (OD 600 about 2.0) of Staphylococcus aureus fermentation broth to every 15 ml of solid LB medium, mix well and pour into plates, and dry them for later use.

[0030] Note: OD 600 refers to the absorbance value of a certain solution at a wavelength of 600 nm.

[0031] 2.1.3 Preliminary Screening by Plate Antagonism Test Pick up the activated isolated bacterial single colonies with a sterilized toothpick and spot-inoculate them on the Staphylococcus aureus plate. Conduct 3 replicates for each strain and incubate at 35°C. Observe the experimental results at 24 h, 36 h, and 48 h respectively, mainly observing the presence or absence of the inhibition zone.

[0032] 2.2 Plate Antagonism Test - Re-screening 2.2.1 Strain Activation Same as 2.1.1, activate the isolated bacteria with inhibition zones in the preliminary screening.

[0033] 2.1.2 Preparation of Staphylococcus aureus Plate Same as 2.1.2. After the plate is air-dried, punch holes with a 5-mm diameter puncher for standby.

[0034] 2.2.3 Liquid Fermentation of Isolated Bacteria Transfer the activated isolated bacteria into the liquid Czapek-Dox medium for shake flask culture at 28°C and 200 rpm for 48 hours (OD 600 about 2.0).

[0035] 2.2.4 Re-screening by Plate Antagonism Test Use a pipette to aspirate 10 μl of the isolated bacteria fermentation broth and place it into the holes of the Staphylococcus aureus plate. Air-dry it, conduct 3 replicates, and incubate at 35°C. Observe the experimental results at 24 h, 36 h, and 48 h respectively, mainly observing the presence, absence, and size of the inhibition zone.

[0036] 3. Results Bacteria with antagonistic effects were obtained through the preliminary screening test, and then through the re-screening by punching holes in the plate antagonism test, bacteria with better antagonistic effects were obtained. Strain NC-K143 is one of them. See Figure 1 and Figure 2 for the colony morphology and microscopic morphology diagrams of strain NC-K143. Figure 3 0.1 ml of Staphylococcus aureus fermentation broth was added to the plate, then punched holes with a puncher, and the fermentation broth of strain NC-K143 was placed into the holes and air-dried, and then incubated at 35°C.

[0037] From Figure 3 it can be seen that the inhibition zone is obvious, indicating that strain NC-K143 has an obvious antagonistic effect on Staphylococcus aureus.

[0038] Example 3: Optimization of Fermentation Conditions for the Isolated Strain NC-K143 1. Experimental Procedures: 1.1 Preparation of NC-K143 Strain Seed Liquid Pick a single colony of NC-K143 with an inoculation loop and inoculate it into Gao's No. 1 liquid medium. Incubate at 28 °C and 200 rpm for 48 hours for standby.

[0039] 1.2 Prepare a series of culture media with the following formulas and sterilize them by autoclaving for standby.

[0040] Formula of ISP1 medium: 5 g of casein peptone, 3 g of yeast extract, 15 g of agar (not added for liquid medium), pH 7.0 ± 0.2, add 1 L of deionized water, boil until completely dissolved. Sterilize at 121 °C for 15 min.

[0041] Formula of ISP2 medium: 10 g of malt extract, 4 g of yeast extract, 4 g of D-glucose, pH 7.2 ± 0.2, add 1 L of deionized water, boil until completely dissolved. Sterilize at 121 °C for 15 min.

[0042] Formula of ISP3 medium: 20 g of oatmeal, 0.001 g of ferrous sulfate heptahydrate, 0.001 g of manganese chloride tetrahydrate, 0.001 g of zinc sulfate heptahydrate, pH 7.3 ± 0.2, add 1 L of deionized water, boil until completely dissolved. Sterilize at 121 °C for 15 min.

[0043] Formula of ISP4 medium: 10 g of soluble starch, 1 g of dipotassium hydrogen phosphate, 1 g of magnesium sulfate heptahydrate, 1 g of sodium chloride, 2 g of ammonium sulfate, 2 g of calcium carbonate, 0.001 g of ferrous sulfate heptahydrate, 0.001 g of manganese chloride tetrahydrate, 0.001 g of zinc sulfate heptahydrate, pH 7.2 ± 0.2, add 1 L of deionized water, boil until completely dissolved. Sterilize at 121 °C for 15 min.

[0044] Formula of No. 6 medium: 20.0 g of sucrose, 30.0 g of soluble starch, 2.0 g of peptone, 8.0 g of soybean powder, 0.5 g of MgSO4·7H2O, 0.5 g of K2HPO4·7H2O, 2.0 g of NaCl, 3.0 g of CaCO3, add 1 L of deionized water, initial pH 8.0, boil until completely dissolved. Sterilize at 121 °C for 15 min.

[0045] Formula of No. 7 medium: 20 g / L of soybean cake powder, 2 g / L of soy peptone, 20 g / L of glucose, 5 g / L of soluble starch, 2 g / L of yeast powder, 4 g / L of NaCl, 0.5 g / L of K2HPO3, 0.5 g / L of MgSO4·H2O, 2 g / L of CaCO3, add 1 L of deionized water, sterilize at 121 °C for 15 min.

[0046] 1.3 Preparation of fermentation broths of NC-K143 strain in different culture media Add 2 ml of the prepared medium into 10-ml centrifuge tubes respectively, and then add 10 μl of the seed liquid of strain NC-K143 respectively. Incubate at 28 °C and 200 rpm for 5 days. Take the fermentation broth and centrifuge it at 12000 rpm for 10 minutes, and collect the supernatant for standby.

[0047] 1.4 Preparation of Staphylococcus aureus plate Same as 2.1.2 in Example 2. After the plate is dried, punch holes with a puncher with a diameter of 5 mm for standby.

[0048] 1.5 Detection of antibacterial activity Take 50 μl of the supernatant of different media prepared in 1.3 and add it into the holes of the plate prepared in 1.4. Incubate at 37 °C for 24 hours, and observe the presence and size of the antibacterial circle. Select the medium with the largest antibacterial circle as the optimal medium for subsequent experiments.

[0049] 2. Experimental results: As Figure 4 shown, the fermentation broths of ISP1, ISP2, and ISP3 media have almost no activity, and the activities of ISP4, No. 6, and No. 7 media are acceptable. By measuring the diameter of the antibacterial circle, it is found that the fermentation broth of No. 6 medium has the strongest activity. Therefore, No. 6 is used as the optimal fermentation medium for strain NC-K143.

[0050] Example 4: Cytotoxicity detection of the fermentation broth of strain NC-K143 1. Experimental procedure: 1.1 Resuscitation of A549 cells Take out the cryopreservation tube from the liquid nitrogen tank and directly immerse it in warm water at 37 °C, and shake it from time to time to make it melt as soon as possible; centrifuge at 1000 rpm for 5 minutes to collect the cells, then resuspend the cells with DMEM containing 10 (v / v)% FBS, and inoculate them into a culture flask. Incubate at 37 °C in a 5 (v / v)% carbon dioxide incubator; change the culture medium once the next day and continue to culture.

[0051] 1.2 Seeding of A549 cells Prepare an A549 cell suspension and count it. Finally, seed it in a 96-well plate, and add 100 μl of DMEM containing 1 (v / v)% FBS to each well, containing 1×10 4 cells. Incubate at 37 °C in a 5 (v / v)% carbon dioxide incubator overnight.

[0052] 1.3 Preparation of the fermentation broth of strain NC-K143 Add 2 ml of No. 6 medium into 10-ml centrifuge tubes respectively, and then add 10 μl of the seed liquid of strain NC-K143 respectively. Incubate at 28 °C and 200 rpm for 5 days. Take the fermentation broth and centrifuge it at 12000 rpm for 10 minutes, and collect the supernatant for standby.

[0053] 1.4 Toxicity Test of Antagonistic Bacteria Fermentation Broth In this experiment, a cell-free blank control group was set up, that is, DMEM with only 1 (v / v)% FBS; a sample control (natural release) well, that is, only cells without treatment; a well with maximum cell enzyme activity, that is, a well with lysis buffer added; treatment of strain NC-K143: The fermentation broth prepared in 1.3 was used to treat the cells at final concentrations of 0% (adding the same volume of blank medium as the experimental group), 5%, 10%, and 20%.

[0054] 1.5 Detection of LDH Released by Cells After 12 hours, the supernatant was taken from each group to detect the LDH release amount (the specific method refers to the Lactic Dehydrogenase Cytotoxicity Detection Kit C0017 of Beyotime Biotechnology Co., Ltd.).

[0055] Calculation formula: Cytotoxicity or mortality (%) = (absorbance of treated sample - absorbance of sample control well) / (absorbance of maximum cell enzyme activity - absorbance of sample control well) × 100. Note: The absorbance measured for each group should be subtracted by the absorbance of the background blank control well.

[0056] 2. Results As Figure 5 shown in the figure. In the figure, 0%, 5%, 10%, and 20% are the amounts of LDH released by cells after treating the cells with the supernatant of the strain of the present invention. The more LDH is released, the more cell death occurs. Therefore, the toxicity of a certain substance to cells can be detected by detecting the amount of LDH released by cells. In this figure, after treating the cells with the supernatant of the strain at different concentrations, the amount of LDH released is very small (less than 10%), indicating that the biocontrol bacterium has very weak toxicity to cells or can even be said to be non-toxic. This shows that the fermentation broth of this strain can be made into a biological agent, which is safe and has good repeatability.

[0057] Example 5: Identification of the Isolated Bacterial Strain 1 Physiological and Biochemical Experiments of the Strain (1) Salt Tolerance Determination: The strain was inoculated onto a medium with an NaCl concentration range of 0 - 13% (w / v) and an interval concentration gradient of 1%, and cultured at 28°C for 7 - 14 d, and the growth status of the test strain was observed and recorded.

[0058] (2) Temperature Tolerance Determination: The test strain was inoculated onto the sterilized Gao's No. 1 medium and incubated at a constant temperature of 4, 10, 16, 20, 25, 28, 30, 37, 40, and 45°C for 2 weeks, and the growth status of the strain under different temperature conditions was observed and recorded.

[0059] (3) pH Tolerance Determination: Use Gao's No. 1 medium as the basal medium for pH tolerance determination. Use NaOH solution and HCl solution to adjust the pH value of the medium, with the pH range between 4.0 - 13.0 and an interval gradient of 1.0 pH. Inoculate the strain to be tested onto the medium, and observe and record the pH growth range of the strain.

[0060] (4) Utilization experiment of sole carbon source: Add a single carbon source (0.5%, w / v) to the basal medium for carbon source utilization respectively, set a blank control, and sterilize at 115 °C for 10 min. The tested single carbon sources are inositol, D - trehalose, D - fructose, D - raffinose, D - sorbitol, D - galactose, D - mannitol, D - glucose, rhamnose, xylose, sucrose, ribose, etc. After inoculating the strain, culture it in a shaker flask at 28 °C for 1 - 2 weeks, and observe and record whether the strain grows.

[0061] (5) Utilization experiment of sole nitrogen source: Add a single nitrogen source (0.5%, w / v) to the basal medium for nitrogen source utilization respectively, set a blank control, and sterilize at 112 °C for 20 min. The tested single nitrogen sources are L - asparagine, L - lysine, L - cysteine, L - threonine, L - valine, L - methionine, L - serine, D - arginine, creatine, etc. Inoculate the strain and culture it in a shaker flask at 28 °C for 1 - 2 weeks, and observe and record whether the strain grows.

[0062] (6) Nitrate reduction test: Inoculate the strain to be tested onto the nitrate reduction medium, and culture it at 28 °C for 1 - 2 weeks. After culturing, take a little culture solution, add a drop of Griess reagent solution A and solution B and observe. If the solution turns pink, orange, etc., the result is positive. If there is no color change, add a small amount of zinc powder to the solution. If it turns red, the result is negative. If there is no color change, it is considered that the nitrate has been reduced to other substances, and it is regarded as a positive result.

[0063] (7) Gelatin liquefaction test: Inoculate the strain to be tested onto the gelatin liquefaction medium, and culture it at 30 °C for 1 - 3 weeks. Observe the gelatin liquefaction situation on the 7th day, 14th day, and 21st day respectively. First, cool the test tube in a refrigerator at 4 °C for 15 - 20 min, then take out the test tube and observe the liquefaction situation. If the upper layer of the gelatin liquefaction medium is in a liquid state, the result is positive; otherwise, the result is negative.

[0064] (8) Milk coagulation and peptization test: Inoculate the strain to be tested into milk coagulation and peptone medium, culture at 28°C, and observe once on the 5th, 10th, 20th, and 30th days. If clots appear in the medium, it is a coagulation phenomenon, and if liquid appears after coagulation, it is a peptone phenomenon.

[0065] (9) Esculin hydrolysis test: The strain to be tested was inoculated into a esculin culture medium and cultured at 28°C for 1-3 weeks. If it turns black, it is positive, otherwise it is negative. A culture medium without inoculation of the strain was set as a control.

[0066] (10) H2S generation test: Inoculate the strain to be tested on Chessner medium and culture at 28℃ for 5-14 days. If it turns black, it means that the generated H2S combines with ferric citrate to form FeS, which is positive. If it does not change color, it is negative and a control is set.

[0067] (11) Catalase test: Add 3% H2O2 to the colonies of the strain to be tested that have grown well after being cultured for a period of time and observe the results. If a large number of bubbles are generated within 30 seconds, the result is positive, and if no bubbles are generated, the result is negative.

[0068] (12) Melanin production test: The strain to be tested is inoculated into ISP6 and ISP7 culture media and cultured at 28°C for 1-2 weeks. If black diffusible pigment is observed on the culture medium, the result is positive, otherwise it is negative.

[0069] Among them, the formula of ISP6 medium (peptone-yeast extract iron medium) is: peptone 15.0 g, peptone 5.0 g, ammonium ferric citrate 0.5 g, K2HPO4 1.0 g, Na2S2O3 0.08 g, agar 15.0 g, distilled water 1.0 L, pH 7.0-7.2.

[0070] ISP7 Medium (Tyrosine Medium) Formula: L-Tyrosine 0.5 g, Glycerol 15.0 g, K2HPO4 0.5 g, MgSO4·7H2O 0.5 g, L-Asparagine 1.0 g, NaCl 0.5 g, FeSO4·7H2O 0.01 g, Trace Salt (Ho-Le Trace Elements) 1.0 mL, Agar 20.0 g, Distilled Water 1.0 L, pH 7.2 - 7.4. The formula of 1L Trace Element Solution Ho-Le is as follows: Boric Acid 2.85 g, Manganese(II) Chloride Tetrahydrate 1.8 g, Iron(II) Sulfate Heptahydrate 1.36 g, Sodium Tartrate 1.77 g, Copper(II) Chloride Dihydrate 26.9 mg, Zinc Chloride 20.8 mg, Cobalt(II) Chloride Hexahydrate 40.4 mg.

[0071] The morphological, cultural, physiological, biochemical and other characteristics of this strain are shown in Table 1: NC-K143: Grows well on Gause's No. 1 Medium. The strain cells are rod-shaped. When cultured on an LB agar plate, the colonies are round, reddish-brown, opaque, with a dry and wrinkled surface, irregular edges, a central depression, and are embedded in the surface of the solid medium. The total table of biochemical identification results is shown in Table 1; Table 1. Physicochemical Experiment Results of Strain NC-K143

[0072] Note: "++" represents very good growth, "+" represents growth or positive, and "-" represents no growth or negative 2 Molecular Identification of the Strain 2.1 Genomic DNA Extraction of the Strain Pick a single colony from the Gause's No. 1 plate and inoculate it into fresh Gause's No. 1 liquid medium. Incubate it at 28°C with shaking at 200 rpm for 2 days. Take 1 mL of the bacterial solution and centrifuge to collect the bacterial cells. Extract genomic DNA according to the instruction manual of the Fungal Genomic DNA Extraction Kit (CW0552S, ComWin Biotech, China).

[0073] 2.2 16S rDNA Gene Amplification Use Tsingke Biological 2 × Taq Master Mix (Dye Plus) (Product No.: P112-01). Using genomic DNA as a template, and using 16S-F / 16S-R, atpD-F / atpD-R, gyrB-F / gyrB-R, recA-F / recA-R, rpoB-F / rpoB-R, trpB-F / trpB-R as primers respectively, amplify 16S rDNA, atpD, gyrB, recA, rpoB, and trpB genes. The amplification system was as follows: 50 ng of genomic DNA, 0.4 μM of forward primer, 0.4 μM of reverse primer, 25 μL of 2× Taq Master Mix, and supplemented with H2O to 50 μL. DNA amplification program: pre-denaturation at 95°C for 3 minutes, denaturation at 95°C for 10 seconds, annealing at Tm for 10 seconds, extension at 72°C for 1 min / Kb, 35 cycles, and final extension at 72°C for 5 minutes. After the amplified fragments were detected as a single band by 1 (g / ml)% agarose gel electrophoresis (the fragment lengths were approximately 1360 bp, 1400 bp, 2100 bp, 1131 bp, 3486 bp, 822 bp respectively, and the results were as Figure 6 shown), they were sent to a sequencing company (Hunan Qingke Biotechnology Co., Ltd., China) for sequencing. After obtaining the sequenced sequences, the sequences were compared and analyzed in GenBank (http: / / www.ncbi.nlm.nih.gov) to obtain the names of the closely related identified strains and identify the bacterial species.

[0074] Table 2. Primer Information

[0075] 2.3 16S rDNA , atpD, gyrB, recA, rpoB, and trpB Gene Sequencing and Comparative Analysis The gene sequence determination results of strain NC-K143 are as follows: 16S rDNA Gene sequence (SEQ ID NO.13) atpD gene sequence (SEQ ID NO.14) gyrB gene sequence (SEQ ID NO.15) recA gene sequence (SEQ ID NO.16) GATCGAGCGGCAGTTCGGCAAGGGCTCGGTGATGCGCCTCGGCGAGAAGGCCAACGAGCCGATCGAGGTGATCCCCACGGGGTCCACCGCCCTGGACGTCGCCCTCGGGGTCGGCGGCATCCCGCGCGGCCGGGTGATCGAGATCTACGGCCCCGAGTCCTCCGGCAAGACCACGCTGACCCTGCACCTGGCGGCCAACGCCCAGCGGGCCGGCGGCACGGTCGCCTTCGTCGACGCGGAGCACGCGCTCGACCCGGAGTACGCCAAGAAGCTCGGCGTGGACACCGACGCCCTGCTGGTCAGCCAGCCGGACACCGGTGAGCAGGCCCTGGAGATCACCGACATGCTGATCCGCTCCGGCGCGATCGACCTGGTGATCATCGACTCCGTCGCGGCGCTCGTGCCGCGCGCGGAGATCGAGGGCGAGATGGGCGACTCGCACGTCGGTCTGCAGGCCCGTCTGATGAGCCAGGCGCTGCGGAAGATCGCCGGTGCGCTGAACCAGTCGAACACCACTGCGATCTTCATCAACCAGCTGCGCGAGAAGATCGGGGTCATGTTCGGCTCGCCGGAGACCACGACCGGTGGCCGGGCGCTGAAGTTCTACGCCTCGGTCCGGCTGGACATCCGCCGGATCGAGACCCTGAAGGACGGCACCGAGGCGGTCGGTAACCGCACCCGCGTCAAGGTCGTCAAGAACAAGGTCGCCGCGCCGTTCAAGCAGGCCGAGTTCGACATCCTCTACGGCGTCGGCATCAGCCGCGAGGGCGGCCTGATCGACATGGGTGTGGAGCACGGCTTCATCCGCAAGTCGGGTGCCTGGTACACCTACGAGGGCGACCAGCTCGGCCAGGGCAAGGAGAACGCCCGCAACTTCCTGCGGGACAACCCGCAGCTGGCCGACGAGATCGAGCGGAAGATCAAGGGCAAGCTGGGCATCGGCCCGAAGGT rpoB gene sequence (SEQ ID NO.17) trpB gene sequence (SEQ ID NO.18) ACAGCAGCCGCAGCGCCTGCATGGCGGCGTCGTCCGGTGGCCGGACGGTACTCGGCCCGGCCGGTGTCCTTCAGCCAGGCGTGCTCCGGGCCGACGCCCGGGTAGTCCAGGCCGGCCGAGATCGAGTGCGACTCGATGGTCTGCCCGTCCTCGTCCTGCAGGACGTAGGTGCGCGAGCCGTGCAGCACGCCCGGGTCGCCCTTGGTGAGGGTCGCGGCGTGCTTCGGGGTCTCGGCGCCCTCGCCGGCCGCCTCGCAGCCGATCAGCCGCACCCCGGCGTCCGGGATGAACTCGTGGAAGATGCCCATCGCGTTGGAGCCGCCGCCGACGCAGGCGACGACCGCGTCGGGCAGCCGCCCGGTGCGGTCCAGCACCTGCTGCCGGGCCTCGACGCCGATCACCCGGTGGAAGTCGCGGACCATCATCGGGAAGGGGTGCGGGCCGGCGACGGTGCCGAACAGGTAGTGGGTGGAGTCGACGTTGGCGACCCAGTCCCGGAACGCCTCGTTGATGGCGTCCTTGAGGGTGCGGCTGCCGGAGGTCACGGCCACCACCTCGGCGCCGAGCATCCGCATCCGGGCCACGTTCAGCGCCTGGCGCTGGGTGTCGACCTCGCCCATGTAGATGGTGCAGTCGAAGCCGAACAGCGCGCAGGCGGTGGCGGTGGCCACGCCGTGCTGGCCGGCGCCGGTCTCGGCGATGATCCGGGTCTTGCCCATCCG 3 Phylogenetic tree construction and analysis The obtained 16S rDNA, after the original sequences of atpD, gyrB, recA, rpoB, and trpB genes were spliced and verified using DNAStar analysis software, they were submitted to GenBank to obtain sequence accession numbers, and the Blast program was run in NCBI (http: / / www.ncbi.nlm.nih.gov) for sequence homology search. The corresponding gene sequences of related strains were downloaded, assembled into a single sequence in the order of atpD, gyrB, recA, rpoB, and trpB genes, and a phylogenetic tree based on the combined gene sequences of atpD, gyrB, recA, rpoB, and trpB was constructed using the Neighbour-joining method in MEGA 7.0 software. According to the sequence homology and phylogenetic relationship, the species attribution of the strain was determined. The results are shown in Figure 7 .

[0076] Through physiological and biochemical analysis and Blast result analysis of 6 gene sequences in this application, no strains with high similarity were identified. By constructing a phylogenetic tree with multiple sequences, it was found that this strain belongs to a new species, and it was named Kitasatospora sp. NC-K143.

[0077] Example 6: Determination of the antibacterial spectrum of strain NC-K143 and the growth inhibition curve of Staphylococcus aureus The antibacterial activity of NC-K143 against Gram-negative bacteria, Gram-positive bacteria, and yeast-like fungi (4 strains each, a total of 12 strains) was detected in vitro using the hole diffusion method. The selected fungi and antibacterial results are shown in Table 3. The larger the diameter of the inhibition zone, the better the antibacterial effect.

[0078] 1. Experimental method 1.1 Strain activation Each glycerol stock stored at -80°C was streaked on an LB plate, and the 12 pathogenic bacteria were cultured at 37°C for 24 hours for standby. Among them, Clostridium perfringens (number: ATCC13124) was anaerobically cultured.

[0079] 1.2 Preparation of NC-K143 fermentation supernatant The No. 6 fermentation medium with the best antibacterial effect was selected. The specific method was as follows: 2 ml of the No. 6 medium was added to a 10 ml centrifuge tube, and then 10 μl of the NC-K143 strain seed solution was added respectively. It was cultured at 28°C and 200 rpm for 5 days. The fermentation broth was centrifuged at 12000 rpm for 10 minutes, and the supernatant was collected for standby.

[0080] 1.3 Antibacterial experiment Hole diffusion method: Prepare the bacterial suspensions of each pathogen (grown to the logarithmic phase with OD600 approximately equal to 2.0). When the LB solid medium cools to 45 °C, take 100 μL of the bacterial suspension and add it to 15 ml of the medium, quickly mix well and pour into plates. Make holes (hole diameter 6 mm) in the middle of the medium, and then add 50 μL of the fermentation supernatant of the test strain NC-K143 into the holes. Repeat 3 times for each petri dish, culture at 37 °C, and measure the diameter of the inhibition zone after 24 hours.

[0081] 1.4 Determination of growth inhibition curve Culture Staphylococcus aureus in LB liquid medium until OD 600 is approximately equal to 2.0, then dilute it 100 times with LB liquid medium for standby. Add the prepared fermentation supernatant of NC-K143 into the diluted bacterial suspension to make the final concentrations of the fermentation supernatant of NC-K143 be 0%, 5%, 10%, and 20% respectively, and then culture. Measure OD 600 at regular intervals, and plot a growth curve with time as the abscissa and OD 600 as the ordinate.

[0082] 2. Results and analysis 2.1 The antibacterial activities of strain NC-K143 against human pathogens are shown in Table 3.

[0083] Table 3 Summary of the antibacterial spectrum of strain NC-K143

[0084] As can be seen from the above table, this strain can produce inhibitory effects on a variety of bacteria and yeast-like fungi, especially on Gram-positive bacteria, and can be promoted for use. Among them, the inhibitory effect on Staphylococcus aureus is the best.

[0085] 2.2 The inhibitory effects of the fermentation supernatant of NC-K143 at different final concentrations on the growth curve of Staphylococcus aureus are shown in Figure 8 . The abscissa represents time, and the ordinate represents OD600 (i.e., the turbidity of Staphylococcus aureus). The larger the OD600 value, the more turbid the bacterial suspension and the better the growth of the bacteria. Compared with the 0% group, the growth of Staphylococcus aureus in the 5%, 10%, and 20% groups was significantly inhibited, and the higher the concentration of the fermentation supernatant of NC-K143, the more obvious the inhibitory effect.

[0086] The embodiments of this specific implementation manner are all preferred embodiments of the present invention, and do not limit the protection scope of the present invention accordingly. Therefore, all equivalent changes made according to the structure, shape, and principle of the present invention should be covered within the protection scope of the present invention.

Claims

1. A Kitasatospora NC-K143 for preventing and treating pathogen infections, classified and named as Kitasatospora sp. NC-K143. This strain was deposited at the China Center for Type Culture Collection on March 27, 2025, with the deposit number CCTCC NO: M2025616.

2. The Kitasatospora NC-K143 according to claim 1, wherein: Kitasatospora sp. NC-K143 grows well on Czapek's agar No. 1 medium, and the strain cells are rod-shaped; when cultured on an LB agar plate, the colonies are circular, reddish-brown, opaque, with a dry and wrinkled surface, irregular edges, a central depression, and are embedded in the surface of the solid medium.

3. The Kitasatospora NC-K143 according to claim 1, characterized in that: The fermentation medium of Kitasatospora sp. NC-K143 comprises 20.0 g / L of sucrose, 30.0 g / L of soluble starch, 2.0 g / L of peptone, 8.0 g / L of soybean powder, 0.5 g / L of MgSO4·7H2O, 0.5 g / L of K2HPO4·7H2O, 2.0 g / L of NaCl, 3.0 g / L of CaCO3, and an initial pH of 8.

0.

4. Use of Kitasatospora sp. NC-K143 according to claim 1 in the preparation of a drug for preventing and treating pathogen infections.

5. The application according to claim 4, characterized in that: The pathogens include Candida krusei, Candida guilliermondii, Candida auris, Candida albicans, Pseudomonas aeruginosa, Bacillus velezensis, Bacillus cereus, Staphylococcus aureus, Clostridium perfringens.

6. An antibacterial agent, characterized in that: Comprises Kitasatospora sp. NC-K143 according to claim 1.

7. Use of the bacteriostatic agent according to claim 6 in the preparation of a drug for preventing and treating pathogen infections.

Citation Information

Patent Citations

  • Natural preservative epsilon-polylysine strain and methods for screening, fermenting and identifying same

    CN105112301A

  • Cyclic peptide compound and preparation method and antiviral application thereof

    CN114073757A

  • Streptomyces aureus strain for producing aureomycin through fermentation and application of streptomyces aureus strain

    CN116426439A

  • Bacterial strain for antagonizing pathogenic bacteria of plant diseases, fungicide and application of bacterial strain and fungicide

    CN116855416A

  • Antagonistic actinomycete strain ZZ-48 as well as biocontrol agent and application thereof

    CN117417850A

Cited By

  • Kitasatospora xanthophycea JY01 strain and application thereof

    CN120624310A