A spinal muscular atrophy quality control product, a preparation method and application thereof

Abstract

The application discloses a spinal muscular atrophy quality control product and a preparation method and application thereof. The application aims at the deficiency that the existing method of using Epstein-Barr virus to immortalize lymphocytes cannot efficiently transform spinal muscular atrophy lymphocytes into immortalized cells, and provides a transformation culture medium and a method for constructing immortalized spinal muscular atrophy lymphocytes by using the culture medium. By using the method, the immortalized spinal muscular atrophy lymphocyte strain can be constructed within 30 days, and the corresponding immortalized cell line can be obtained by subculturing the immortalized spinal muscular atrophy lymphocyte strain. When the immortalized spinal muscular atrophy lymphocytes are constructed by using the method, the required time is short, the success rate is high, the genetic background of the obtained immortalized cells is stable, the interoperability with clinical samples is high, the compatibility is good, the immortalized cells can be stably preserved, and the immortalized cells can be used as positive quality control products in gene detection of spinal muscular atrophy, so that the accuracy of detection can be ensured.

Description

TECHNICAL FIELD

[0001] The present application belongs to the technical field of construction of immortalized cells and gene detection. More specifically, it relates to a spinal muscular atrophy quality control product, a preparation method and application thereof. BACKGROUND

[0002] Spinal muscular atrophy (SMA) is an autosomal recessive neuromuscular disease characterized by muscle weakness and atrophy caused by degeneration and denaturation of alpha-motor neurons in the anterior horn of the spinal cord. The survival motor neuron 1 (SMN1) gene on chromosome 5 (5q13.2) is the pathogenic gene of SMA. All SMA patients have double allelic mutations of SMN1, and the main mutation types are 7th (SMN1-7, E7) or 7th and 8th (SMN1-8, E8) exon deletion mutations, which account for about 96% of the mutation types. In addition, there are p.Ser8Lysfs*23 point mutations and other mutation types. In addition to the SMN1 gene, there is a highly homologous survival motor neuron 2 (SMN2) gene, which is a modifier gene of SMA, affecting the severity and progression of the disease, and the increase in the copy number of SMN2 gene is negatively correlated with the severity of SMA symptoms.

[0003] Currently, the diagnosis of SMA mainly relies on gene detection, and the main diagnostic basis is the occurrence of double allelic pathogenic variations in the SMN1 gene. Gene detection is a highly complex detection project. In order to ensure the accuracy of detection, positive quality control products need to be used for quality control. The ideal quality control product should be close to the actual clinical sample in matrix, concentration and composition, and should remain stable under the recommended storage and use conditions to ensure that its composition and concentration do not change significantly. The existing SMA gene detection quality control products are mostly limited to constructed plasmids containing specific mutations. Such quality control products usually do not directly participate in the sample extraction process and cannot effectively monitor the extraction process. Compared with constructed plasmids, immortalized cell strains / cell lines containing specific genetic variations can be further made into quality control products such as paraffin-embedded tissues simulating clinical samples, and therefore are more suitable for indoor quality control and interlaboratory quality evaluation.

[0004] The immortalized cell line refers to a cell line that can survive through subculture for infinite proliferation after the primary culture is successful. The Epstein-Barr virus (EBV) can specifically infect B lymphocytes, and then immortalize the B lymphocytes. The use of EBV to transform B lymphocytes to establish an immortalized cell line is the most commonly used method for cell immortalization. However, when using B lymphocytes from patients with different diseases to construct immortalized cells, due to the different states of the cells and the genes carried by the cells (including the size of the genes, mutant type), etc., the success rate of using EBV to construct an immortalized cell line is quite different. For example, an immortalized cell line A can be successfully constructed by using the conventional EBV transformation method, but an immortalized cell line B cannot be successfully constructed by using the same or similar method, or there are problems such as long time consumption, low success rate, poor stability of the constructed immortalized cell line, etc. At present, there is no report on how to construct an immortalized cell line containing a spinal muscular atrophy related gene mutation. SUMMARY

[0005] The present application is aimed at the problems existing in the prior art, and provides a transformation culture medium, and a method for culturing immortalized spinal muscular atrophy lymphocytes by using the transformation culture medium. The constructed immortalized spinal muscular atrophy lymphocytes can be used as a spinal muscular atrophy quality control product.

[0006] The first object of the present application is to provide a transformation culture medium.

[0007] The second object of the present application is to provide the use of the transformation culture medium and the Epstein-Barr virus in constructing an immortalized lymphocyte or in preparing a preparation for constructing an immortalized lymphocyte.

[0008] The third object of the present application is to provide a method for constructing an immortalized spinal muscular atrophy lymphocyte.

[0009] The fourth object of the present application is to provide an immortalized spinal muscular atrophy lymphocyte constructed by the method.

[0010] The fifth object of the present application is to provide the use of the cell in preparing an immortalized spinal muscular atrophy gene detection positive quality control product.

[0011] The sixth object of the present application is to provide the use of the cell in preparing a spinal muscular atrophy gene detection product.

[0012] The above objects of the present application are achieved by the following technical solutions:

[0013] The present application is discovered in the process of constructing immortal cell lines by using peripheral blood mononuclear cells of patients with spinal muscular atrophy. The lymphocytes of SMA patients are less bright under microscope, grow slowly, and are not clustered or have very few clusters. When the lymphocytes are transformed by using EB virus and cell culture medium containing cyclosporine A, the success rate is low (less than 50%) and the time required for transformation is long (more than 50 days). That is, the existing method of immortalizing lymphocytes by using EB virus cannot efficiently transform the lymphocytes of spinal muscular atrophy into immortal cells. To this end, the present application provides a transformation medium and a method of constructing immortalized spinal muscular atrophy lymphocytes by using the medium. By using the method, the immortalized spinal muscular atrophy lymphocyte strain can be constructed within 30 days. Therefore, the present application claims the transformation medium and the method.

[0014] The present application provides a transformation medium.

[0015] Specifically, the transformation medium is composed of an animal cell basic medium and an additive component; the additive component comprises 15%-25% (v / v) fetal bovine serum, 1-3 μg / mL cyclosporine A, 8.5-11.5 μg / mL phytohemagglutinin, and 1.5-3.5 μg / mL CpG ODN; the nucleotide sequence of the CpG ODN is shown in SEQ ID NO. 1.

[0016] Specifically, the transformation medium further comprises 0.8%-1.2% (v / v) of an ampicillin-streptomycin mixture.

[0017] Specifically, in the ampicillin-streptomycin mixture, the content of ampicillin is 10 kU / mL, and the content of streptomycin is 10 mg / mL.

[0018] Alternatively, the basic medium is 1640-GlutaMAX medium.

[0019] In a specific embodiment of the present application, the transformation medium is composed of a basic medium and an additive component; the basic medium is 1640-GlutaMAX medium; the additive component is fetal bovine serum, an ampicillin-streptomycin mixture, cyclosporine A, phytohemagglutinin, and CpG ODN with a nucleotide sequence shown in SEQ ID NO. 1; wherein the volume fraction of the fetal bovine serum is 15%-25%, the volume fraction of the ampicillin-streptomycin mixture is 0.8%-1.2%, the concentration of the cyclosporine A is 1-3 μg / mL, the concentration of the phytohemagglutinin is 8.5-11.5 μg / mL, and the concentration of the CpG ODN is 1.5-3.5 μg / mL.

[0020] More specifically, the volume fraction of fetal bovine serum in the transformation medium is 18% to 22%, the volume fraction of the mixture of penicillin and streptomycin is 0.9% to 1.1%, the concentration of cyclosporin A is 1.5 to 2.5 μg / mL, the concentration of phytohemagglutinin is 9 to 11 μg / mL, and the concentration of CpG ODN is 2 to 3 μg / mL.

[0021] Preferably, the volume fraction of fetal bovine serum in the transformation medium is 20%, the volume fraction of the mixture of penicillin and streptomycin is 1%, the concentration of cyclosporin A is 2 μg / mL, the concentration of phytohemagglutinin is 10 μg / mL, and the concentration of CpG ODN is 2.5 μg / mL. Under this concentration, the success rate of immortalization of spinal muscular atrophy lymphocytes using the medium is 100%.

[0022] In a specific embodiment of the present application, the phytohemagglutinin is M-type phytohemagglutinin (PHA-M).

[0023] In view of the fact that lymphocytes can be immortalized using the transformation medium and the Epstein-Barr virus of the present application, the present application also claims the use of the transformation medium and the Epstein-Barr virus in the construction of immortalized lymphocytes or in the preparation of a preparation for the construction of immortalized lymphocytes.

[0024] Specifically, the immortalized lymphocytes are immortalized spinal muscular atrophy lymphocytes.

[0025] Specifically, the lymphocytes are B lymphocytes.

[0026] The present application also provides a method for constructing immortalized spinal muscular atrophy lymphocytes, which comprises the following steps:

[0027] Specifically, the method comprises the following steps:

[0028] S1. Resuspend the isolated peripheral blood mononuclear cells with the transformation medium of the present application, then add the Epstein-Barr virus liquid to obtain a mixed system of the Epstein-Barr virus and the cells;

[0029] S2. Shake the mixed system obtained in S1 for 1.5 to 3 hours, then collect the cells, resuspend them with an equal volume of the transformation medium, and continue to culture;

[0030] S3. Continue to culture the cells until 115-125 hours, half-volume replacement of the liquid, and supplement with EB virus liquid; continue to culture for 115-125 hours, half-volume replacement of the liquid, and supplement with EB virus liquid, and continue to culture; and then carry out half-volume replacement of the liquid every 115-125 hours of culture, until the lymphocytes of spinal muscular atrophy are successfully immortalized, and the immortalized lymphocyte strain of spinal muscular atrophy is obtained.

[0031] Specifically, the transformation culture medium is fresh transformation culture medium, and it is recommended to be prepared for use.

[0032] Specifically, in S1, the cells extracted from 5-10 mL of whole blood are added with 0.25-0.5 mL of the transformation culture medium and 0.25-0.5 mL of EB virus liquid, and the concentration of the EB virus liquid is 1×10^7 copies / mL-3×10^7 copies / mL.

[0033] Specifically, in S3, the half-volume replacement of the liquid refers to discarding 0.5 volumes of old culture medium and supplementing with 0.5 volumes of fresh transformation culture medium.

[0034] Specifically, in S3, the volume of the supplemented EB virus liquid is half of the volume of the EB virus liquid used in S1. More specifically, the concentration of the EB virus liquid is 2×10^7 copies / mL.

[0035] Based on the immortalized lymphocytes of spinal muscular atrophy obtained by the method, the corresponding immortalized cell line can be obtained by subculture.

[0036] The application also protects the immortalized lymphocytes of spinal muscular atrophy obtained by the construction method.

[0037] Specifically, the immortalized lymphocytes include immortalized lymphocyte strains and immortalized lymphocyte lines.

[0038] Specifically, the lymphocytes are B lymphocytes.

[0039] The application also provides a method for constructing a corresponding immortalized lymphocyte line by using the obtained immortalized lymphocyte strain and a method for obtaining an immortalized lymphocyte quality control raw material by long-term culture.

[0040] Specifically, the method for constructing an immortalized lymphocyte line is as follows:

[0041] Take the immortalized cell line, 37℃ water bath, transfer the cell suspension to the centrifuge tube, centrifuge at 800 rpm for 5 min, discard the supernatant, resuspend the precipitate to 5×10^5-7.5×10^5 cells / mL with 15% FBS 1640 complete medium (containing 1.25 μg / mL CpG ODN), culture at 37℃, 5% CO2 for 3-4 days, and subculture according to 1:3 (v / v) when the cell density reaches 1×10^6-2×10^6 cells / mL; subsequent culture is the same as before until the cells reach the desired number.

[0042] Specifically, the method for obtaining the immortalized lymphocyte quality control product through long-term culture is as follows:

[0043] Take the immortalized cell line, 37℃ water bath, transfer the cell suspension to the centrifuge tube, centrifuge at 800 rpm for 5 min, discard the supernatant, resuspend the precipitate to 5×10^5-7.5×10^5 cells / mL with 15% FBS 1640 complete medium (containing 1.25 μg / mL CpG ODN), culture at 37℃, 5% CO2 for 3-4 days, and subculture according to 1:3 (v / v) when the cell density reaches 1×10^6-2×10^6 cells / mL; subsequent culture is the same as before until the cells reach the desired number.

[0044] In specific embodiments of the present application, the immortalized lymphocyte is an immortalized spinal muscular atrophy lymphocyte strain or an immortalized spinal muscular atrophy lymphocyte line.

[0045] In specific embodiments of the present application, the genotype of the immortalized spinal muscular atrophy lymphocyte includes SMN1 / SMN2=0 / 3, SMN1 / SMN2=1 / 2, and SMN1 / SMN2=0 / 2. That is, regardless of the genotype of the spinal muscular atrophy lymphocyte, the corresponding immortalized cell can be constructed using the construction method of the present application. Therefore, other genotypes of immortalized spinal muscular atrophy lymphocytes can be constructed using the construction method of the present application.

[0046] In addition to the above genotypes, the genotype of the immortalized spinal muscular atrophy lymphocyte also includes SMA microdot mutations: c.22dupA, c.683T>A, c.689C>T, c.863G>T, c.400G>A, c.463_464delAA, and c.835-5T>G.

[0047] The immortalized spinal muscular atrophy (SMA) lymphocytes constructed in this invention have a stable genetic background, high interoperability with clinical samples, strong compatibility, and can be stably preserved. Therefore, this invention also seeks protection for the use of the aforementioned immortalized SMA lymphocytes in the preparation of immortalized SMA gene detection positive quality control products.

[0048] The present invention also seeks protection for the use of immortalized spinal muscular atrophy lymphocytes in the preparation of spinal muscular atrophy gene detection products.

[0049] Specifically, the cells are used as a positive quality control for spinal muscular atrophy gene testing.

[0050] The present invention has the following beneficial effects:

[0051] This invention addresses the shortcomings of existing methods using Epstein-Barr virus (EBV) to immortalize lymphocytes, which cannot efficiently convert spinal muscular atrophy (SMAD) lymphocytes into immortalized cells. It provides a conversion culture medium and a method for constructing immortalized SMAD lymphocytes using the culture medium. Using this method, immortalized SMAD lymphocyte lines can be constructed within 30 days, and these lines can be passaged to obtain the corresponding immortalized cell lines. The method for constructing immortalized SMAD lymphocytes is not only time-efficient and has a high success rate, but also produces immortalized cells with stable genetic backgrounds, high interoperability with clinical samples, good compatibility, and stable preservation. These cells can be used as positive control samples in gene detection for SMAD, ensuring the accuracy of the detection. Attached Figure Description

[0052] Figure 1 Microscopic images of cells after transfection for different days during the construction of immortalized spinal muscular atrophy lymphocytes in Example 1; in the figure, a is at day 0 after transfection, b is at day 10 after transfection, and c is at day 20 after transfection.

[0053] Figure 2 The results of genotyping of immortalized spinal muscular atrophy lymphocytes constructed in Example 1 using time-of-flight mass spectrometry are shown in Figure a, which represents the detection results of SMN1-E7 and SMN2-E7 genes, and Figure b represents the detection results of SMN1-E8 and SMN2-E8 genes.

[0054] Figure 3 The results of the detection of immortalized spinal muscular atrophy lymphocytes constructed in Example 1 using the Five-Color Stone SMN1 exon deletion detection kit are shown in the figure. Figure a represents the detection result of the SMN1-E7 gene, and figure b represents the detection result of the SMN1-E8 gene. The green curve in the figure is the amplification curve of the internal standard gene, and the blue curve is the amplification curve of the target gene.

[0055] Figure 4 The detection result of the immortalized spinal muscular atrophy lymphocytes constructed in Example 1 by using the SMN1 detection kit of Kapp; the red curve in the figure is the internal standard gene amplification curve, the blue curve is the SMN1-E7 gene amplification curve, and the green curve is the SMN1-E8 gene detection result.

[0056] Figure 5 The detection result of the SMN1-E7 gene of the immortalized spinal muscular atrophy lymphocytes constructed in Example 1 by using the SMN1 detection kit of Willingcrowd; the red curve in the figure is the internal standard gene amplification curve, and the green curve is the target gene amplification curve.

[0057] Figure 6 The detection result of the immortalized spinal muscular atrophy lymphocytes constructed in Example 1 by using the multiple ligation probe amplification (MLPA) detection kit of MRC. DETAILED DESCRIPTION

[0058] The present application will be further described below in combination with the drawings and specific examples, but the examples do not limit the present application in any form. Unless otherwise specified, the reagents, methods and devices used in the present application are conventional reagents, methods and devices in the technical field.

[0059] Unless otherwise specified, the reagents and materials used in the following examples are commercially available.

[0060] The EB virus used in the examples of the present application is derived from B95-8 cells, which is derived from the EB virus extracted from the white blood cells of a marmoset exposed to human white blood cells, and the EB virus is EBV type I.

[0061] The 1640 basic medium in the examples of the present application refers to RPMI-1640 medium without FBS (fetal bovine serum) and double antibiotics (mixed solution of ampicillin and streptomycin); the 1640 complete medium refers to RPMI-1640 medium added with a certain proportion of FBS and 1% (v / v) double antibiotics, such as 20% FBS-containing 1640 complete medium; the ampicillin and streptomycin mixed solution is from Aibixing, and the product number is abs9244.

[0062] The nucleotide sequence of the CpG ODN in the examples of the present application is TCGTCGTTTTGTCGTTTTGT

[0063] CGTT, as shown in SEQ ID NO. 1.

[0064] Example 1 Construction of immortalized spinal muscular atrophy lymphocytes

[0065] This embodiment takes peripheral blood mononuclear cells (PBMCs; containing lymphocytes and monocytes, mainly lymphocytes) extracted from the blood (5 mL of whole blood) of an SMA patient with a genotype of SMN1 / SMN2 = 1 / 2 (SMN (1:2)) as an example to illustrate the method for constructing immortalized spinal muscular atrophy lymphocytes.

[0066] 1. Construction of immortalized cell lines

[0067] The method comprises the following steps:

[0068] S1. Resuspend the peripheral blood mononuclear cells obtained from 5 mL of whole blood with 0.25 mL of transformation medium, and then add 0.25 mL of EBV working solution with a concentration of 2×10^7 copies / mL to obtain a mixed system of EB virus and cells;

[0069] S2. Resuspend the cells in the mixed system by blowing, and place them on a cell shaker for culture under the conditions of 70 rpm, 37 °C and 5% CO2. After 2 h of culture, centrifuge to obtain a precipitate, resuspend the precipitate with 0.5 mL of fresh transformation medium, and continue to culture the resuspended cells under the conditions of 37 °C and 5% CO2.

[0070] S3. Continue to culture the cells until the 5th day, replace half of the medium, and supplement 0.25 mL of EBV working solution with a concentration of 2×10^7 copies / mL. Continue to culture until the 10th day, replace half of the medium, and supplement 0.25 mL of EBV working solution with a concentration of 2×10^7 copies / mL. In the subsequent culture process, replace half of the medium every 5 days for 3 times every 2 weeks until the immortalization is successful. At this time, the obtained cells are immortalized cell lines. The sign of successful immortalization is that the cells aggregate into clusters and proliferate rapidly. Under a microscope, the outer wall of the cells is found to have irregular spicule-like protrusions.

[0071] The transformation medium is based on 1640-GlutaMAX medium (manufacturer: gibco; item number: 72400047) containing 20% (v / v) FBS and 1% (v / v) streptomycin-aztreonam mixture, and further added with PHA-M (phytohemagglutinin M type; manufacturer: Yixing Biological; item number: 40110ES08) with a final concentration of 10 μg / mL, cyclosporin A (manufacturer: Shenguo Biological; item number: A600352-0005) with a final concentration of 2 μg / mL, and CpG ODN with a final concentration of 2.5 μg / mL.

[0072] In the process of constructing immortalized spinal muscular atrophy lymphocytes in this embodiment, the microscope images of the cells after different days of transfection are as shown in Figure 1 .Figure 1 Figure a shows the result at day 0 after transfection, figure b shows the result at day 10 after transfection, and figure c shows the result at day 20 after transfection. (Combined with...) Figure 1 It can be seen that on the 20th day of co-culturing with the aforementioned transformation medium and EB virus, a large number of cells were observed to aggregate, the cells became larger, and spiky structures were formed around them, indicating that the cells were successfully immortalized.

[0073] 2. Construction of immortalized cell lines

[0074] Based on the obtained immortalized cell line, it can be expanded and passaged to obtain the corresponding immortalized cell line.

[0075] The method for constructing immortalized cell lines is as follows:

[0076] The cell lines that have been successfully immortalized are used as P0 primary cells;

[0077] P1-P2 generation: When the cell density reaches 1-2×10^6 cells / mL, add 1-2 times the volume of 20% FBS 1640 complete medium (containing 2.5 μg / mL CpG ODN) to the original culture medium, and culture for 3-5 days. Then, centrifuge and culture to T75 culture flasks.

[0078] P3-P4 generation: When the cell density reaches 1-2×10^6 cells / mL, add 1-2 times the volume of 20% FBS 1640 complete medium (containing 2.5 μg / mL CpG ODN) to the original culture medium for subculture. Depending on the cell growth rate, subculture to T175 culture flasks in 3-5 days.

[0079] P5-P6 generation: Same as before (P3-P4 generation);

[0080] After culture, the cell suspension was centrifuged, added to serum-free cryopreservation solution, and then permanently stored in liquid nitrogen.

[0081] Furthermore, the preparation methods for the EBV working solution, B lymphocytes, and transformation medium are as follows.

[0082] 3. Preparation of EBV working solution

[0083] Includes the following steps:

[0084] S1. Resuscitate B95-8 cells: Resuscitate B95-8 cell lines in T75 culture flasks using 1640 complete medium containing 20% ​​FBS and culture at 37℃ and 5% CO2 for 3-4 days. Replace half of the 1640 complete medium containing 10% FBS every two days until the B95-8 cells return to normal.

[0085] S2. Batch culture of B95-8 cells; the B95-8 cell suspension with normal state was transferred to a centrifuge tube, centrifuged at 800 rpm for 5 min, the supernatant was discarded, and the precipitate was resuspended with 1640 complete culture medium containing 10% FBS and then added to a T175 culture bottle, supplemented with 1640 complete culture medium containing 10% FBS to 35 mL, and cultured at 37 ℃, 5% CO2 for 3-4 days;

[0086] S3. Starvation culture of B95-8 cells; the B95-8 cells in the T175 culture bottle were collected, a small amount of suspension was taken for counting, and the B95-8 cell concentration was adjusted to 1×10 6 / mL with 1640 basic culture medium, and starved for 7-10 days;

[0087] S4. Preparation of EB virus liquid; the B95-8 cells and their culture medium at the end of starvation culture were placed in an ultra-low temperature freezer until completely frozen, then thawed at 37 ℃ until completely dissolved, and then repeatedly frozen and thawed for 3 times, centrifuged at 2500 rpm for 15 min, and the supernatant was filtered with a 0.22 μm needle filter to obtain the EB virus stock solution; part (100 μL) of the virus stock solution was taken for concentration determination, and the EB virus stock solution was diluted with 1640 complete culture medium containing 20% FBS to obtain the EBV working solution.

[0088] 4. Isolation of peripheral blood mononuclear cells (PBMC)

[0089] comprising the following steps:

[0090] S1. Isolation of white membrane layer; the whole blood of a spinal muscular atrophy patient collected (the collection time was not more than 24 h) was slowly added to a lymph separation liquid (the peripheral blood lymphocyte separation liquid of Dako, the product number was 7922112), centrifuged at 800 g for 15 min at 20 ℃; the centrifuge tube was slowly taken out, the blood sample was kept in a layered state, the uppermost liquid was discarded, and all the white membrane layer was sucked;

[0091] S2. Isolation of PBMC cells; 1640 basic culture medium was added to the isolated white membrane layer, the cells were washed by blowing, centrifuged at 250 g for 10 min, and the washing was repeated once, the supernatant was discarded, 1640 basic culture medium was added, and the mixture was uniformly mixed by gently blowing, and then centrifuged at 250 g for 5 min, and the obtained precipitate was the required PBMC cells.

[0092] 5. Preparation of transformation culture medium

[0093] comprising the following steps:

[0094] S1. One tube of 100 × CpG ODN stock solution and one tube of 500 × PHA-M stock solution were taken respectively, and after completely melting, the centrifugation was performed by intermittent operation;

[0095] S2. Add 1 mL of 37℃ preheated 20% FBS and 1% double-antibiotic-containing 1640-GlutaMAX complete medium into the CpG ODN stock solution and the PHA-M stock solution respectively, and mix well by blowing;

[0096] S3. Take a sterilized 15 mL centrifuge tube, and add all of the CpG working solution, 800 μL of the PHA-M working solution, and 20 μL of 1000× cyclosporin A stock solution into the tube, and add 20% FBS 1640-GlutaMAX complete medium (containing 1% penicillin-streptomycin mixture) to make up to 10 mL.

[0097] 6. Genotype identification

[0098] The genotype of the immortalized spinal muscular atrophy lymphocytes prepared in the embodiment is also identified.

[0099] Take out 200 μL of the frozen immortalized cells, extract the cell DNA, and then use the kit for detecting spinal muscular atrophy related genes (time-of-flight mass spectrometry) developed by Kapp to perform genotype identification, and the results are shown in Figure 2 ;a in the table is the detection result of the SMN1-E7 and SMN2-E7 genes, Figure 2 b in the table is the detection result of the SMN1-E8 and SMN2-E8 genes. It can be known from the results shown in Figure 2 that the genotype of the immortalized spinal muscular atrophy lymphocytes constructed in the embodiment is SMN1 heterozygous deletion type SMN1 / SMN2 = 1 / 2 (SMN (1:2)). Figure 2 The composition of the kit for detecting spinal muscular atrophy related genes and the use method thereof are disclosed in Chinese Patent No. CN116479103B.

[0100] Example 2. Construction of immortalized spinal muscular atrophy lymphocytes

[0101] In this embodiment, the peripheral blood mononuclear cells extracted from the blood (5 mL of whole blood) of an SMA patient with the genotype SMN1 / SMN2 = 0 / 2 (SMN (0:2)) are immortalized by referring to the method described in Example 1. The difference between this embodiment and Example 1 is that the final concentration of PHA-M in the transformation medium used is 9 μg / mL, the final concentration of cyclosporin A (CyA) is 2.5 μg / mL, and the final concentration of CpG ODN is 2 μg / mL.

[0102]

[0103] Microscopic examination showed that on the 22nd day of co-culturing with the transformation medium and EB virus, the cells in this embodiment had already gathered into a large cluster, the cell morphology was large and the surrounding had formed a spur-like structure, and the cell immortalization was successful.

[0104] Example 3 Construction of immortalized spinal muscular atrophy lymphocytes

[0105] In this embodiment, peripheral blood mononuclear cells extracted from blood (5 mL of whole blood) of an SMA patient with genotype SMN1 / SMN2 = 0 / 3 (SMN (0:3)) were immortalized according to the method described in Example 1. The difference between this embodiment and Example 1 is that the final concentration of PHA-M in the transformation medium used is 11 μg / mL, the final concentration of CyA is 1.5 μg / mL, and the final concentration of CpG ODN is 3 μg / mL.

[0106] Microscopic examination showed that on the 19th day of co-culturing with the transformation medium and EB virus, the cells in this embodiment had already gathered into a large cluster, the cell morphology was large and the surrounding had formed a spur-like structure, and the cell immortalization was successful.

[0107] Comparative Example 1

[0108] The difference between the transformation medium described in this comparative example and the transformation medium described in Example 1 is that the transformation medium described in this comparative example does not contain PHA-M and CpG ODN.

[0109] Comparative Example 2

[0110] The difference between the transformation medium described in this comparative example and the transformation medium described in Example 1 is that the transformation medium described in this comparative example does not contain CpG ODN.

[0111] Comparative Example 3

[0112] The difference between the transformation medium described in this comparative example and the transformation medium described in Example 1 is that the transformation medium described in this comparative example does not contain CyA and PHA-M.

[0113] Test Example 1 Comparison of Immortalization Success Rates of Different Transformation Mediums

[0114] The present application tested the time required and success rate for immortalizing spinal muscular atrophy lymphocytes using the transformation mediums described in Comparative Examples 1-3 (Nos. 1-3) and Example 1 (No. 4) based on the method described in Example 1, respectively, and the results are shown in Table 1. Among them, the average immortalization success time is the time for obtaining an immortalized cell strain, and the number of PBMC cells used for immortalization is 4 x 10^6 per mL.

[0115] Table 1 Success rate and success time of immortalization culture using different transformation medium

[0116]

[0117] From Table 1, it can be seen that the Epstein-Barr virus combined with the transformation medium described in the present application can quickly and efficiently immortalize the lymphocytes of spinal muscular atrophy.

[0118] Test Example 2 Genetic stability test of immortalized cells

[0119] The immortalized cells obtained by constructing Examples 1 and 3 were cultured for a long time to test their genetic stability.

[0120] The long-term culture method of immortalized cells is as follows:

[0121] Take the frozen immortalized cell line, after 37℃ water bath, transfer the cell suspension to a centrifuge tube, centrifuge at 800 rpm for 5 min, discard the supernatant, resuspend the precipitate to 5×10^5-7.5×10^5 cells / mL with 15% FBS 1640 complete culture medium (containing 1.25 μg / mL CpG ODN), culture at 37℃, 5% CO2 for 3-4 days, when the cell density reaches 1×10^6-2×10^6 cells / mL, pass it according to 1:3 (v / v); subsequent culture is the same as before.

[0122] According to the method recorded in the literature (Beijing Medical Society Genetics Branch, Beijing Rare Disease Diagnosis and Treatment and Security Society. Expert consensus on genetic diagnosis of spinal muscular atrophy [J]. Chinese Journal of Medicine, 2020, 100(40): 3130-3140. DOI:10.3760 / cma.j.cn112137-20200803-02267.), MLPA detection was performed on the immortalized cells at 0, 10, 30 and 60 days of culture, respectively, to test the genetic stability of the immortalized spinal muscular atrophy lymphocytes constructed by the present application, and the results are shown in Table 2.

[0123] Table 2 Genetic stability test results of immortalized cells

[0124]

[0125] From the results shown in Table 2, it can be seen that the immortalized cells constructed by the present application can still be genetically stable after 60 days of culture, indicating that they have good genetic stability.

[0126] Test Example 3 Platform compatibility test

[0127] The immortalized cells constructed in Examples 1 and 3 were used as test materials, and the DNA of the above-mentioned immortalized cells was extracted using three different DNA extraction kits. The DNA concentration of the extracted DNA was detected by NanoDrop ultramicro UV spectrophotometer. The DNA extraction kits are as follows: ① nucleic acid extraction kit (DNA-L type magnetic bead method) (Chaozhou Kaipu Biochemical Co., Ltd., Yuechao Machinery Preparation 20140023); ② nucleic acid extraction or purification reagent (magnetic bead method DR-9600-KZ type) (Chaozhou Kaipu Biochemical Co., Ltd., Yuechao Machinery Preparation 20210003); ③ blood / cell / tissue genomic DNA extraction kit (centrifugal column method) (Tiangen Biochemical Technology (Beijing) Co., Ltd., Catalog No. DP304). According to the kit instructions, the DNA was extracted, and the concentration and quality detection results are shown in Table 3.

[0128] Table 3 Detection results of DNA extracted by different DNA extraction kits

[0129]

[0130] The DNA of the extracted immortalized cells A and B was used as a template, and four different gene detection kits were used for detection, respectively, to test the platform compatibility of the immortalized cells of the application. The gene detection kits are as follows: ① survival motor neuron 1 (SMN1) exon deletion detection kit (fluorescence quantitative PCR method) (Shanghai Wuse Stone Medical Research Co., Ltd., Catalog No. YDLC-976); ② Kaipu self-developed survival motor neuron 1 (SMN1) detection kit (fluorescence PCR method) (Guangzhou Kaipu Pharmaceutical Technology Co., Ltd.); ③ human survival motor neuron 1 (SMN1) detection kit (PCR-fluorescence probe method) (Shenzhen Huizhong Biotechnology Co., Ltd., National Medical Equipment Approval 20223400080); ④ multiple ligation probe amplification (MLPA) detection kit (MRC Holland, Catalog No.: P021-B1 SMA). According to the kit instructions, the immortalized cells were detected, and the detection results are shown in Table 4; wherein the detection results of the immortalized cells with genotype SMN (1:2) detected by kits ①-④ are shown in Table 4, respectively. Figures 3-6

[0131] Table 4 Detection results of different gene detection kits

[0132]

[0133] ​Note: the detection range of different detection kits is different, for example, the reagent of five-color stone can only detect E7 and E8 exons of SMN1, and MLPA can detect E7 and E8 exons of SMN1 and SMN2 at the same time, so there are differences in the detection results shown in the table.

[0134] The above results show that the immortalized spinal muscular atrophy lymphocytes prepared by the application have good multi-platform applicability as spinal muscular atrophy quality control products, and can be applied to different principle extraction kits and detection kits.

[0135] The above examples are the preferred embodiments of the present application, but the embodiments of the present application are not limited by the above examples, and any changes, modifications, substitutions, combinations, simplifications made without departing from the spirit and principles of the present application should be equivalent replacement methods, and are all included in the protection scope of the present application.

Claims

1. A transformation medium for constructing immortalized spinal muscular atrophy lymphocytes, characterized in that, The transformation medium is composed of an animal cell basic medium and an additive component; the basic medium is 1640-GlutaMAX medium; the additive component is fetal bovine serum, an amikacin mixture, cyclosporine A, phytohemagglutinin and a CpG ODN with a nucleotide sequence as shown in SEQ ID NO. 1; wherein the volume fraction of the fetal bovine serum is 15% to 25%, the volume fraction of the amikacin mixture is 0.8% to 1.2%, the concentration of the cyclosporine A is 1 to 3 μg / mL, the concentration of the phytohemagglutinin is 8.5 to 11.5 μg / mL, and the concentration of the CpG ODN is 1.5 to 3.5 μg / mL.

2. Use of the transformation medium and Epstein-Barr virus according to claim 1 for the construction of immortalized lymphocytes or for the preparation of a preparation for the construction of immortalized lymphocytes, characterized in that, The immortalized lymphocytes are immortalized spinal muscular atrophy lymphocytes.

3. A method of constructing immortalized spinal muscular atrophy lymphocytes, comprising, Peripheral blood mononuclear cells or lymphocytes are isolated from whole blood of a spinal muscular atrophy patient, and the peripheral blood mononuclear cells are co-cultured with EB virus liquid and the transformation medium of claim 1 until the immortalization of lymphocytes is successful, comprising the following steps: S1. Resuspend the isolated peripheral blood mononuclear cells or lymphocytes with the transformation medium of claim 1, then add EB virus liquid to obtain a mixed system of EB virus and cells; for every 5 to 10 mL of extracted cells, add 0.25 to 0.5 mL of the transformation medium of claim 1 and 0.25 to 0.5 mL of EB virus liquid, and the concentration of the EB virus liquid is 1×10^7 copies / mL to 3×10^7 copies / mL; S2. After the mixed system obtained in S1 is oscillation-cultured for 1.5 to 3 h, collect the cells, resuspend them with an equal volume of the transformation medium of claim 1, and continue to culture; S3. Continue to culture the cells until the 115th to 125th hour, replace half of the liquid, and supplement with EB virus liquid; continue to culture for 115 to 125 h, replace half of the liquid, and supplement with EB virus liquid; then replace half of the liquid every 115 to 125 h until the immortalization of lymphocytes is successful, and obtain an immortalized spinal muscular atrophy lymphocyte strain; the volume of the supplemented EB virus liquid is half of the EB virus liquid used in S1.

Images