Compound microbial agent and application thereof

Abstract

The invention belongs to the technical field of agriculture and relates to microorganisms, in particular to a compound microbial agent and application thereof. The invention relates to a compound microbial agent, which is prepared from slow-growing rhizobium HS3, pseudomonas Y43, burkholderia Y30 and agrobacterium Y27. The compound microbial agent NBI prepared from efficient rhizobium and beneficial microbial strains adapting to local soil is preferably selected by combining soil types and microbial adaptability of different regions in Hainan province, and can be used for improving nodulation and nitrogen fixation capacity of fresh soybeans, promoting the yield of the soybeans, reducing application of chemical fertilizers and improving the per unit yield of the soybeans.

Description

Technical Field

[0001] The present invention belongs to the technical field of agriculture, relates to microorganisms, and particularly refers to microorganisms used for leguminous plants. Background Art

[0003] The symbiotic nitrogen fixation of soybean and rhizobia can convert nitrogen in the air into ammonia, with an annual global nitrogen fixation amount of up to 16.44 million tons, accounting for 77% of the total nitrogen fixation of leguminous crops. It can not only provide about 68% of the nitrogen for soybean growth, but also improve soil fertility and supply other crops for absorption and utilization. Establishing an efficient symbiotic nitrogen fixation system is a necessary means to improve soybean yield and quality and reduce the use of chemical nitrogen fertilizers. In the natural state, there are phenomena such as few nodules and low efficiency in soybean nodulation. At present, replacing chemical nitrogen fertilizers with rhizobia inoculants is a key measure to reduce non-point source pollution and achieve the sound development of soybean production at home and abroad. Data shows that the utilization rate of rhizobia inoculants in Brazil, the main soybean producing country, is close to 100%, and the annual nitrogen fertilizer input is reduced by about 2.5 billion US dollars on average; in the United States, the main soybean producing country, more than 50% of the soybean planting areas are inoculated with rhizobia, and the nitrogen fertilizer application is reduced by 6.19 million tons on average every year. However, rhizobia have high genetic diversity and certain variety specificity and regional adaptability. Therefore, when developing compound rhizobia inoculants, the screening and application of strains must consider three factors: variety, strain, and local soil conditions.

[0004] Single-type rhizobia inoculants have poor adaptability to the changing soil environment, and there are problems such as poor variety matching and low nodule occupancy rate. Single inoculation of rhizobia inoculants often cannot achieve the expected effect. A variety of beneficial microorganisms living in the soybean rhizosphere can have an important positive regulatory effect on the soybean-rhizobia symbiotic nitrogen fixation system. In Brazil, the method of co-inoculating Azospirillum brasilense and rhizobia has been widely adopted. Compared with single inoculation of rhizobia, co-inoculation significantly improves soybean nodulation and soybean yield. In China, multi-functional compound rhizobia inoculants have entered the stage of research and development and application. For example, the application with the publication number CN119776202A discloses a compound bacterium agent for promoting the growth of leguminous plants, which promotes growth and prevents diseases by combining a variety of compound bacteria with rhizobia and biological reagents. However, there is still a lack of publicly available leguminous crop microbial inoculants with broad adaptability to regional soils and high matching with local cultivated soybean varieties. Therefore, it is very important and necessary to screen and prepare a combination of highly efficient nitrogen-fixing rhizobia and growth-promoting bacteria that are adapted to specific regional soils and matched with specific cultivated varieties to improve soybean nodulation, nitrogen fixation and yield and reduce chemical fertilizer application. Summary of the Invention

[0005] To solve the above technical problems, the present invention proposes a compound microbial inoculant and its application.

[0006] The technical solution of the present invention is realized as follows: This application first preliminarily screened rhizobium strains from the team's rhizobium resource library according to the soil characteristics of Hainan, and then carried out matching screening using representative soils in Hainan and local fresh food soybean cultivars. Taking the number of nodules, nitrogenase activity, above-ground dry weight and other indicators, the nodulation and nitrogen fixation ability and growth promotion effect of rhizobia were compared to screen for efficient rhizobia adapted to local soils and cultivars in Hainan. Through screening, the combination of slow-growing rhizobia HS3 and USDA110 was found to be able to optimally adapt to the representative soils in 8 regions of Hainan and 5 fresh food soybean cultivars.

[0007] Furthermore, the type of soil applied is laterite, red soil or yellow soil, which has characteristics such as strong acidity (pH 4.3 - 5.7), low organic matter content and low phosphorus and potassium content.

[0008] Furthermore, in view of the general infertility of acidic soils and the low content of available phosphorus and available potassium, using beneficial microorganisms with the functions of phosphorus solubilization, potassium solubilization and growth promotion is an effective method to improve the ability of crops to obtain nutrient elements. In the present invention, efficient growth-promoting microbial strains were selected from the team's beneficial microorganism resource library, and a compound microbial inoculant NBI (Nutrient Booster Inoculum) for leguminous crops was provided, which comprises the above-mentioned combination of slow-growing rhizobia HS3 + USDA110, as well as Pseudomonas Y43, Burkholderia Y30 and Agrobacterium Y27. Further, the ratio of each strain in the compound microbial inoculant NBI is 1:1:1:1:1.

[0009] The slow-growing rhizobia HS3, Pseudomonas Y43, Burkholderia Y30 and Agrobacterium Y27 in the compound microbial inoculant NBI were all isolated and screened by the inventor team from soils in different regions of the main soybean production areas across the country.

[0010] The slow-growing rhizobia HS3 can efficiently nodulate and fix nitrogen with local fresh food soybean cultivars in the soils of different main soybean production areas in Hainan. The Latin name of the slow-growing rhizobia HS3 is Bradyrhizobium sp . HS3, and its taxonomic name is Bradyrhizobium sp . It is preserved under the accession number GDMCC No: 66000, the preservation date is March 12, 2025, and the preservation address is on the 5th floor of Building 59, No. 100 Yard, Xianlie Middle Road, Guangzhou, Institute of Microbiology, Guangdong Academy of Sciences;

[0011] Pseudomonas Y43 has the ability to efficiently produce indole-3-acetic acid (IAA) and can significantly promote the growth of soybeans in acidic soils. The Latin name of Pseudomonas Y43 is Pseudomonas sp .Y43, and its taxonomic name is Pseudomonas sp . It is preserved under the accession number GDMCC No: 66004, the preservation date is March 12, 2025, and the preservation address is on the 5th floor of Building 59, No. 100 Yard, Xianlie Middle Road, Guangzhou, Institute of Microbiology, Guangdong Academy of Sciences; Burkholderia sp. Y30 has the ability to efficiently dissolve phosphorus and can inhibit pathogenic fungi such as Phytophthora sojae and Fusarium oxysporum. It can significantly promote the growth of soybeans in acidic soil. The Latin name of Burkholderia sp. Y30 is Burkholderia sp. Y30, and its taxonomic name is Burkholderia sp. , with the deposit number GDMCC No: 66002, the deposit date is March 12, 2025, and the deposit address is the 5th floor of Building 59, No. 100 compound, Xianlie Middle Road, Guangzhou, Institute of Microbiology, Guangdong Academy of Sciences; Agrobacterium sp. Y27 has the ability to efficiently dissolve potassium and can significantly promote the growth of soybeans in acidic soil. The Latin name of Agrobacterium sp. Y27 is Agrobacterium sp. Y27, and its taxonomic name is Agrobacterium sp. , with the deposit number GDMCC No: 66001, the deposit date is March 26, 2025, and the deposit address is the 5th floor of Building 59, No. 100 compound, Xianlie Middle Road, Guangzhou, Institute of Microbiology, Guangdong Academy of Sciences; According to the above scheme, the compound microbial inoculant of the present invention can significantly promote the symbiotic nodulation phenotype of fresh-eating soybeans, and promote the above-ground biomass, pod number and yield of fresh-eating soybeans in greenhouses and fields in Hainan.

[0012] According to the above scheme, the above compound microbial inoculant is a liquid compound microbial inoculant, which includes the bacterial liquids after fermentation and culture of Bradyrhizobium sp. HS3, Bradyrhizobium sp. USDA110, Pseudomonas sp. Y43, Burkholderia sp. Y30 and Agrobacterium sp. Y27, and they are mixed in a ratio of 1:1:1:1:1. The mixed bacterial liquid is added with a binder, a 2% arabinose solution, to prepare a liquid inoculant.

[0013] Preferably, the liquid compound microbial inoculant NBI contains 150 - 300 million cfu / mL of viable Bradyrhizobium sp. HS3, 150 - 300 million cfu / mL of Bradyrhizobium sp. USDA110, 100 - 250 million cfu / mL of Pseudomonas sp. Y43, 100 - 250 million cfu / mL of Burkholderia sp. Y30, and 100 - 250 million cfu / mL of Agrobacterium sp. Y27.

[0014] According to the above scheme, the application method is seed coating before sowing soybeans. Seed dressing and coating are carried out within 12 hours before sowing soybeans. The seed dressing location should be in a shady place to avoid direct sunlight. The compound microbial inoculant NBI is mixed with soybean seeds and gently stirred until the surface of all seeds is attached with the rhizobial inoculant. After the seeds are air-dried, they are sown.

[0015] According to the above scheme, the application of the microbial inoculant on leguminous crops includes but is not limited to fresh-eating soybeans, soybeans, etc.

[0016] The present invention has the following beneficial effects: 1. The present invention combines the physical and chemical properties of different types of soils in Hainan and the adaptability of microorganisms to optimize the composite microbial inoculant NBI prepared from highly efficient rhizobia and beneficial microbial strains suitable for local soils, which can be used to improve the nodulation and nitrogen fixation ability of fresh-eating soybeans, promote soybean yield, facilitate the reduction of chemical fertilizer application, and increase the per-unit yield of soybeans.

[0017] 2. The composite microbial inoculant NBI of the present application adopts the application method of seed dressing and coating, which is simple to apply.

[0018] 3. The present invention is applicable to the cultivation of fresh-eating soybeans in Hainan Island and can be used as one of the important measures for the cultivation of fresh-eating soybeans, which is of great significance for promoting the sustainable development of local and even national green agriculture. BRIEF DESCRIPTION OF THE DRAWINGS

[0019] In order to more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the following will briefly introduce the drawings required for use in the description of the embodiments or the prior art. Obviously, the following drawings are only some embodiments of the present invention. For those of ordinary skill in the art, other drawings can be obtained based on these drawings without creative efforts.

[0020] Figure 1 It is a heat map of the nodule numbers of fresh-eating soybeans inoculated with candidate strains under representative soil conditions in different regions of Hainan in Example 1 of the present invention.

[0021] Figure 2 It is the variety matching of the optimized highly efficient rhizobial strains with fresh-eating soybeans under representative soil conditions in different regions of Hainan in Example 1 of the present invention.

[0022] Figure 3 It is the phosphorus-solubilizing, potassium-solubilizing, IAA-producing and acid-tolerant abilities of the optimized beneficial microbial strains in Examples 2, 3 and 4 of the present invention.

[0023] Figure 4 It is the phylogenetic tree of the optimized highly efficient rhizobial strains and beneficial microbial strains in Examples 1, 2, 3 and 4 of the present invention.

[0024] Figure 5 It is the effect of the optimized beneficial microbial strains in promoting soybean growth in the greenhouse in Example 2 of the present invention.

[0025] Figure 6 It is the effect of the composite microbial inoculant NBI in promoting nodulation and yield of fresh-eating soybeans in the field in Example 3 of the present invention. DETAILED DESCRIPTION OF THE EMBODIMENTS

[0026] Next, in combination with the embodiments of the present invention, the technical solutions of the present invention will be described clearly and completely. Obviously, the described embodiments are only a part of the embodiments of the present invention, rather than all the embodiments. All other embodiments obtained by those of ordinary skill in the art based on the embodiments of the present invention without creative efforts shall fall within the protection scope of the present invention.

[0027] Unless otherwise specified, the test methods used in the following experimental examples are all conventional methods; the materials, reagents, etc. used, unless otherwise specified, are reagents and materials that can be obtained from commercial channels.

[0028] The specific culture media required in the process of screening beneficial microorganisms are as follows: Meng Jinna inorganic phosphorus bacteria screening medium: Glucose 10.0 g / L, (NH4)2SO4 0.5 g / L, MgSO4·7H2O 0.3 g / L, KCl 0.3 g / L, FeSO4·7H2O 0.03 g / L, NaCl 0.3 g / L, MnSO4·4H2O 0.03 g / L, Ca3(PO4)2 5.0 g / L, Agar 15.0 g / L, adjust the pH to 7.0 - 7.5.

[0029] Meng Jinna organic phosphorus bacteria screening medium: Glucose 10.0 g / L, (NH4)2SO4 0.5 g / L, NaCl 0.3 g / L, KCl 0.3 g / L, FeSO4·7H2O 0.03 g / L, MnSO4·4H2O 0.03 g / L, lecithin 0.2 g / L, CaCO3 5.0 g / L, yeast extract 0.4 g / L. Adjust the pH to 7.0 - 7.2.

[0030] Silicate bacteria medium: Glucose 5.0 g, MgSO4 0.5 g / L, CaCO3 0.1 g / L, Na2HPO4 2.0 g / L, FeCl3 0.005 g / L, glass powder 1.0 g / L. Adjust the pH to 6.9 - 7.1.

[0031] HM medium formula: Na2HPO4 0.125 g / L, Na2SO4 0.125 g / L, NH4Cl 0.125 g / L, MgSO4·7H2O 0.18 g / L, yeast extract 0.25 g / L, D - Arbinose 1 g / L, Sodium Gluconate 1 g, FeCl3 0.004 g, CaCl2 0.013 g, HEPES 1.30 g, MES 1.30 g, adjust the pH to 6.6 - 7.0 with NaOH.

[0032] LB medium formula: Tryptone 10.0 g, Yeast extract 5.0 g, NaCl 10.0 g.

[0033] Example 1: Screening of highly efficient rhizobia adapted to Hainan soil and local edible soybean varieties (1) The inventors collected soil from fresh soybean producing areas in different regions of Hainan Province and sieved it through a 1 mm sieve for later use. The physical and chemical properties of the soil in various regions were measured, as shown in the following table:

[0034] It was found that the local soil in Hainan is generally strongly acidic (pH 4.3-5.7), and the organic matter content and nitrogen, phosphorus and potassium content are all low. The total nitrogen and organic matter were determined by elemental analyzer. The total potassium content was determined by flame photometry, and the total phosphorus content was determined by sodium hydroxide fusion-molybdenum antimony colorimetry. The methods are all common methods in the industry. According to the soil type and acidic soil characteristics of Hainan, the inventors preliminarily selected 20 strains of rhizobia for testing from the rhizobia library preserved by the team, among which USDA110 is an efficient nitrogen-fixing rhizobium commonly used internationally. Using representative soils from eight local areas in Hainan as the matrix, efficient rhizobia with broad-spectrum adaptability were preliminarily screened. (2) Preparation of rhizobia liquid: The 20 preliminarily selected rhizobia were activated from glycerol bacteria stored at -80°C onto HM solid culture medium plates, and after culturing in the dark at 28°C for 2-4 days, single clones of each strain were selected and inoculated into HM liquid culture medium, and placed on a shaker at 28°C and 200 rpm to culture until OD 600 Use 10mM MgCl2 solution to adjust the OD of each rhizobium solution to 0.5-1. 600 to 0.2. HM medium formula: Na2HPO4 0.125 g / L, Na2SO4 0.125 g / L, NH4Cl 0.125 g / L, MgSO4·7H2O 0.18 g / L, yeast extract 0.25 g / L, D-Arbinose 1 g / L, Sodium Gluconate 1g, FeCl3 0.004g, CaCl2 0.013g, HEPES 1.30g, MES 1.30g, adjust the pH to 6.6-7.0 with NaOH. Add 1.5% agar powder to the solid medium.

[0035] (3) Sterilize the vermiculite, plug tray, flower pot, beaker and other materials required for the experiment at high temperature and high pressure at 121℃ for 30 min. The soybean seeds used in this experiment were sterilized by chlorine gas. The specific operation is as follows: Spread the soybean seeds in a petri dish and place it in a glass desiccator. Quickly add 100 mL of sodium hypochlorite solution and 4.2 mL of concentrated hydrochloric acid to the beaker in sequence, and then seal the glass desiccator and sterilize for 12 h. After sterilization, place the petri dish with soybean seeds on it in a clean bench for more than 2 h, and then close the petri dish for use.

[0036] (4) Representative soils collected from eight regions in Hainan (Sanya, Ledong, Dongfang, Changjiang, Baisha, Danzhou, Qionghai, and Wenchang) were placed in sterilized pots. Sterilized seeds were sown in soils from different regions and cultured in a greenhouse (25°C, 16 h light / 8 h dark). Two seeds were planted in each hole, and after the seedlings emerged, the seedlings were thinned to one seedling per hole. Watering was done regularly to keep the soil moist. After two true leaves of the soybean grew out, 1 mL of the prepared rhizobium solution was inoculated into each seedling, and the number of nodules was observed after 21 days of culture. The nodulation of the candidate rhizobia strains in different soils is shown in the figure. Figure 1 As shown, five rhizobia with the highest nodulation efficiency in soils from different regions were screened for further screening of symbiotic matching for fresh soybean varieties.

[0037] (5) A symbiotic compatibility test was conducted on the main fresh soybean variety cultivated in Hainan, Maodou 64, and four fresh soybean varieties cultivated in the laboratory that are suitable for promotion and cultivation in Hainan (Zhexian 87, Tianyaxian 1, Tianyaxian 2, and Tianyaxian 3). The method is shown in (4). After 30 days after inoculation, the number of nodules, nodule weight, above-ground dry weight, underground dry weight, and nitrogenase activity were measured to evaluate the adaptability and compatibility of rhizobia.

[0038] (6) 30 days after inoculation with rhizobia, the soybean plants were cut horizontally along the upper part of the first lateral root to separate the underground root part and the aboveground part, and the roots were cleaned. The nitrogenase activity index was determined using the traditional acetylene reduction method. After the nitrogenase activity determination was completed, the nodules were separated from the roots, and the number and weight of nodules were counted. After that, the underground roots and aboveground roots of the soybeans were dried in an oven at 65°C to constant weight, and the aboveground dry weight and underground dry weight were determined.

[0039] (7) Statistical analysis was performed on the nodulation and nitrogen fixation phenotypes and growth phenotypes of each strain in different soils and various fresh soybean varieties. The adaptability and compatibility of each strain were assigned based on its nodulation and nitrogen fixation ability and growth promotion ability. The results are as follows: Figure 2As shown in the figure. The results showed that there were significant differences in the matching between rhizobial strains and soybean varieties in different types of soils. Among them, HS3 and USDA110 had better symbiotic matching with the tested soybean varieties. HS3 was the best matching strain for the varieties Maodou 64, Tianya Fresh 1, and Tianya Fresh 3, and USDA110 was the best matching strain for the varieties Zhe Fresh 87 and Tianya Fresh 2. Considering the results of soybean-rhizobia matching in all soils, the combination of USDA110 + HS3 could achieve the best regional adaptability and variety matching.

[0040] The 16S rDNA sequence of the screened HS3 strain is shown in SEQ ID No.1. Through bioinformatics analysis, a phylogenetic tree was constructed as shown in Figure 4 A. The strain HS3 belongs to the genus Bradyrhizobium ( Bradyrhizobium sp.).

[0041] The slow-growing rhizobium HS3 can efficiently nodulate and fix nitrogen with local fresh edible soybean cultivars in the main soybean-producing areas of Hainan. It has been deposited in the Guangdong Microbial Culture Collection Center, with the deposit number GDMCC No: 66000 and the deposit date of March 12, 2025.

[0042] Example 2: Screening of phosphate-solubilizing bacteria The organic acids secreted by inorganic phosphate-solubilizing bacteria during growth can dissolve Ca3(PO4)2 in the medium around the colony, showing transparency; the enzymes secreted by organic phosphate-solubilizing bacteria during growth decompose lecithin in the medium around the colony through enzymatic hydrolysis, showing transparency. All candidate beneficial microbial strains were expanded in LB medium, and the OD 600 of each strain was adjusted to 0.5. In a laminar flow hood, 5 μL of the bacterial solution was respectively pipetted and inoculated into the Meng Jinna inorganic phosphate screening medium and the Meng Jinna organic phosphate screening medium, and then placed in an incubator at 28 °C for 7 days. If a phosphate-solubilizing circle was produced during the growth of the strain, the strain had the ability to solubilize phosphate. High-efficiency phosphate-solubilizing bacteria were screened by comparing the ratio (D / d) of the diameter (D) of the phosphate-solubilizing circle formed by different organic phosphate-solubilizing strains on the organic phosphate solid medium plate to the diameter (d) of the colony.

[0043] The results are shown in Figure 3 As shown. The strain Y30 grew slowly on the medium with pH 4.0, was hardly affected on the medium with pH 4.5, and had high phosphate-solubilizing ability. After full-length 16S rDNA sequencing, the obtained sequence was subjected to BLAST alignment analysis and a phylogenetic tree was constructed ( Figure 4 in B). Analysis showed that the strain Y30 belongs to Burkholderia ( Burkholderia sp.), so it was deposited.

[0044] Burkholderia sp. Y30 has high phosphate-solubilizing ability, and at the same time has inhibitory effects on pathogenic bacteria such as Phytophthora sojae and Fusarium oxysporum, and significantly promotes the growth of soybeans in acidic soil. It has been deposited in the Guangdong Provincial Microbial Culture Collection Center, with the deposit number GDMCC No: 66002 and the deposit date of March 12, 2025.

[0045] Example 3: Screening of potassium-solubilizing bacteria All candidate beneficial microbial strains were cultured in LB medium for expansion, and the OD of each strain was 600 adjusted to 0.5. In a laminar flow hood, 5 μL of the bacterial solution was respectively pipetted and inoculated onto the silicate bacteria medium for screening, and highly efficient potassium-solubilizing bacteria were obtained by comparing the sizes of the colorless and transparent oily rings produced by different potassium-solubilizing bacteria. The results are as Figure 3 shown. Strain Y27 can grow on both the pH 4.0 and pH 4.5 media and has high potassium-solubilizing ability. After full-length 16S rDNA sequencing, the obtained sequence was submitted to NCBI for BLAST alignment analysis and construction of a phylogenetic tree ( Figure 4 in B), and it was analyzed that strain Y27 belongs to Agrobacterium ( Agrobacterium sp.), so it was deposited.

[0046] Agrobacterium sp. Y27 has high potassium-solubilizing ability and significantly promotes the growth of soybeans in acidic soil. It has been deposited in the Guangdong Provincial Microbial Culture Collection Center, with the deposit number GDMCC No: 66001 and the deposit date of March 26, 2025.

[0047] Example 4: Screening of strains with high indole-3-acetic acid (IAA) production All candidate beneficial microbial strains were cultured in LB medium for expansion, and the OD of each strain was 600Adjust to 0.5. Inoculate bacteria at an inoculum size of 2% into 300 µL of TSB liquid medium containing 0.1 g / L L-tryptophan, and grow them in a shaker at 200 rpm and 28 °C for 48 h. Centrifuge at 4000 rpm for 10 min, aspirate 100 µL of the supernatant, add an equal volume of Salkowski colorimetric solution, and place it in the dark at room temperature for 30 min. Observe the color change. If it turns pink, it indicates that the strain has the ability to secrete IAA. Further rescreening is carried out, and the method for obtaining the bacterial solution is the same as that in the primary screening. Aspirate 1 mL of the supernatant after centrifuging the bacterial solution, mix it with an equal volume of Salkowski colorimetric solution, place it in the dark at room temperature for 30 min, and then measure the absorbance at OD530. Using liquid TSB medium as a control, set IAA standard solutions with different concentrations (10 mg / L, 20 mg / L, 40 mg / L, 80 mg / L, 100 mg / L). Make an IAA standard curve with the IAA concentration as the abscissa and OD530 as the ordinate. Calculate the IAA yield through the standard curve. Screen the strains with high IAA production by comparing the IAA yield values. The results are as Figure 3 shown. Strain Y43 can grow normally on media with pH 4.0 and pH 4.5, is almost unaffected by pH changes, and has the ability to efficiently produce the auxin IAA. The quantitatively determined IAA production of it reaches 61.5 mg / L. After full-length 16S rDNA sequencing, the obtained sequence was submitted to NCBI for BLAST alignment analysis and a phylogenetic tree was constructed ( Figure 4 in B), and it can be analyzed that strain Y43 belongs to Pseudomonas ( Pseudomonas sp. ). The primers for full-length identification of 16S rDNA are 27F: AGAGTTTGATCCTGGCTCAG; 1492R: TACGGCTACCTTGTTACGACTT.

[0048] Pseudomonas Y43 has the ability to efficiently produce the auxin IAA and significantly promotes the growth of soybeans in acidic soil. It has been deposited in the Guangdong Provincial Microbial Culture Collection Center, with the deposit number GDMCC No: 66004 and the deposit date of March 12, 2025.

[0049] Example 5: Preparation of compound microbial inoculum Preferred combination of beneficial microorganisms: Considering that the local soil in Hainan is generally acidic with high total phosphorus and total potassium contents, but low available phosphorus and available potassium contents, efficient phosphate-solubilizing bacteria and potassium-solubilizing bacteria can promote the availability of phosphorus and potassium elements in the soil. In addition, high-yield indoleacetic acid (IAA) can promote the growth and development of crop roots, increase the number of root hairs and lateral roots, and promote plant growth. The inventor team screened efficient phosphate-solubilizing bacteria, potassium-solubilizing bacteria, and beneficial microbial strains with high IAA production (the strains in Examples 1 - 4) from the beneficial microbial resource library.

[0050] Greenhouse experiment tests the growth-promoting effect of beneficial bacteria and rhizobia: A total of five treatments were designed in the experiment: only inoculation with the HS3+USDA110 combination rhizobium agent in implementation case 1 (T1), inoculation with HS3+USDA110 rhizobium agent and beneficial bacteria Y30 (Y30), inoculation with HS3+USDA110 rhizobium agent and beneficial bacteria Y27 (Y27), inoculation with HS3+USDA110 rhizobium agent and beneficial bacteria Y43 (Y43), and inoculation with HS3+USDA110 rhizobium agent and the combination of beneficial bacteria Y30+Y27+Y43 (NBI).

[0051] The rhizobium strains (HS3, USDA110) stored at -80°C were streaked on HM plates for activation, and the beneficial bacteria strains (Y30, Y27, Y43) were streaked on LB plates for activation and cultured at 28°C in the dark until a single colony grew out. The cultures were then inoculated into 500 mL of the corresponding liquid culture medium and cultured at 28°C with shaking at 200 rpm until OD 600 = 2. Collect the cells by centrifugation at 4000 rpm for 15 min, resuspend the cells in sterile water and adjust the OD 600 = 1. Prepare the bacterial suspension for each treatment by mixing the bacterial suspension according to the table below.

[0052]

[0053] Seeds of the same size of Edamame 64 soybean varieties were sterilized and inoculated into pots filled with moist soil for greenhouse culture (25°C, 16 h light / 8 h dark). When the soybeans grew two true leaves, each seed was inoculated with 10 mL of the corresponding treatment solution, and 12 replicates were set for each treatment. After that, water was applied regularly, and the number of nodules at the beginning of flowering, soybean aboveground biomass, and underground biomass were measured.

[0054] The results are as follows Figure 5 As shown, compared with single inoculation of rhizobia, the Y43, Y30 and Y27 treatments co-inoculated with beneficial bacteria can significantly promote the number of soybean nodules and growth, while the NBI treatment co-inoculated with rhizobia and Y43+Y30+Y27 showed the best effect of promoting nodulation and growth.

[0055] (2) Preparation of a compound microbial inoculant: Slowly-growing rhizobia HS3, slowly-growing rhizobia USDA110, Pseudomonas Y43, Burkholderia Y30, and Agrobacterium Y27 were activated separately. Slowly-growing rhizobia HS3 and slowly-growing rhizobia USDA110 were inoculated into HM medium for liquid subculture at a rotation speed of 200 rpm and cultured at 28 °C for 72 h. Pseudomonas Y43, Burkholderia Y30, and Agrobacterium Y27 were inoculated into LB medium for subculture at a rotation speed of 200 rpm and cultured at 28 °C for 48 h. After obtaining the culture solutions of each strain, the OD 600 was adjusted to 1, and then 500 mL of each was taken and mixed. The mixed bacterial solution was centrifuged and resuspended with 25 mL of the supernatant. 2% arabic gum powder as an adhesive was added and mixed thoroughly to obtain the compound microbial inoculant NBI.

[0056] The viable counts of slowly-growing rhizobia HS3 in the liquid compound microbial inoculant NBI were 150 - 300 million cfu / mL, those of slowly-growing rhizobia USDA110 were 150 - 300 million cfu / mL, those of Pseudomonas Y43 were 100 - 250 million cfu / mL, those of Burkholderia Y30 were 100 - 250 million cfu / mL, and those of Agrobacterium Y27 were 100 - 250 million cfu / mL.

[0057] Application example: Experiment on the promotion of nodulation, nitrogen fixation, growth, and development of soybeans by the compound microbial inoculant in the field (1)Field experiment: This experiment was conducted at the Southern Crop Improvement Base in Yazhou District, Sanya City, Hainan Province. The soil type of the experimental base was dry red soil, and the basic soil fertility was total nitrogen 0.23 g / kg, total potassium 27.7 g / kg, total phosphorus 0.8 g / kg, available phosphorus 7.20 mg / kg, available potassium 84.3 mg / kg, and pH 4.39.

[0058] Three treatments were set in this experiment: 1. Reducing fertilizer application by 30% without inoculant; 2. Reducing fertilizer application by 30% and inoculating with the compound microbial inoculant NBI; 3. Applying full fertilizer without inoculant.

[0059] The full fertilizer treatment was to apply 25 kg of 15-15-15% (N-P-K) compound fertilizer per mu, and the treatment of reducing fertilizer application by 30% was to apply 17.5 kg of 15-15-15% (N-P-K) compound fertilizer per mu. The fertilizers were uniformly applied as base fertilizers according to the standard.

[0060] The inoculation of the inoculant was carried out by coating the soybean seeds. The specific operation was to coat the seeds within 12 hours before sowing. The coating location should be in a shaded place to avoid direct sunlight. The inoculant was mixed with the soybean seeds, and 15 mL of the inoculant was used to coat 1 kg of fresh food soybean seeds. The seeds were gently stirred until the compound microbial inoculant NBI adhered to the surface of all seeds. After the seeds were air-dried, they were sown. Each treatment was set with 3 replicates of plot experiments.

[0061] Select the local fresh edible soybean variety Maodou 64 in Hainan. In each plot, sowing is carried out by manual line marking, with 2 seeds per hole, and the row and plant spacing configuration is (40 cm × 10 cm); thinning is carried out at the seedling stage, with 1 plant per hole; if there is a seedling shortage, 2 plants are kept in one hole adjacent to the hole with the shortage. The field management of all plots is the same, and measures such as fertilization, sowing, intertillage, and weeding are completed within one day. During this period, drip irrigation is used for watering.

[0062] (2)Field phenotypic investigation: At the full bloom stage of soybeans, investigate the number of nodules and the phenotypic traits of aboveground biomass of soybeans. At the fresh pod stage, investigate phenotypic traits such as the number of pods, pod weight, number of grains, and grain weight.

[0063] The results are as Figure 6 shown. When no inoculant is applied in the field, under the conditions of full fertilization and 30% reduction in fertilization, the fresh edible soybeans have fewer nodules, with an average of 5 nodules per plant. When the compound microbial inoculant NBI is inoculated under the condition of 30% reduction in fertilization, the number of nodules increases significantly, with an average of 35 nodules per plant. At the full bloom stage, compared with the treatment of 30% reduction in fertilization without inoculation and full fertilization without inoculation, the aboveground biomass of soybeans inoculated with the compound microbial inoculant NBI under the condition of 30% reduction in fertilization increases by 50.2% and 20.5% respectively. At the fresh pod stage, compared with the treatment of 30% reduction in fertilization without inoculation and full fertilization without inoculation, the number of pods per plant inoculated with the compound microbial inoculant NBI under the condition of 30% reduction in fertilization increases by 33.3% and 14.3% respectively, and the fresh pod weight increases by 16.7% and 8.7% respectively.

[0064] In summary, the application of the compound microbial inoculant NBI can significantly promote nodulation and nitrogen fixation of fresh edible soybeans, increase the yield per unit area of fresh edible soybeans, and achieve the effect of reducing fertilizer use and increasing production.

[0065] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modification, equivalent replacement, improvement, etc. made within the spirit and principle of the present invention shall be included in the protection scope of the present invention.

Claims

1. A composite microbial inoculum, characterized in that: including Bradyrhizobium sp. HS3, Pseudomonas sp. Y43, Burkholderia sp. Y30, and Agrobacterium sp. Y27; Among them, the Latin name of the slow-growing rhizobium HS3 is Bradyrhizobium sp . HS3, classified and named as Bradyrhizobium sp . The deposit number is GDMCC No: 66000, the deposit date is March 12, 2025, and the deposit address is the 5th floor of Building 59, No. 100 Compound, Xianlie Middle Road, Guangzhou, Institute of Microbiology, Guangdong Academy of Sciences; the Latin name of Pseudomonas Y43 is Pseudomonas sp . Y43, classified and named as Pseudomonas sp . The deposit number is GDMCC No: 66004, the deposit date is March 12, 2025, and the deposit address is the 5th floor of Building 59, No. 100 Compound, Xianlie Middle Road, Guangzhou, Institute of Microbiology, Guangdong Academy of Sciences; the Latin name of Burkholderia Y30 is Burkholderia sp. Y30, classified and named as Burkholderia sp. , the deposit number is GDMCC No: 66002, the deposit date is March 12, 2025, and the deposit address is the 5th floor of Building 59, No. 100 Compound, Xianlie Middle Road, Guangzhou, Institute of Microbiology, Guangdong Academy of Sciences; the Latin name of Agrobacterium Y27 is Agrobacterium sp. Y27, classified and named as Agrobacterium sp. , the deposit number is GDMCC No: 66001, the deposit date is March 26, 2025, and the deposit address is the 5th floor of Building 59, No. 100 Compound, Xianlie Middle Road, Guangzhou, Institute of Microbiology, Guangdong Academy of Sciences.

2. The composite microbial inoculum according to claim 1, wherein: In the composite microbial inoculant, the mass ratio of Bradyrhizobium sp. HS3, Pseudomonas sp. Y43, Burkholderia sp. Y30, and Agrobacterium sp. Y27 is 1:1:1:1:

1.

3. The composite microbial inoculum according to claim 2, wherein: In the composite microbial inoculant, the viable count of Bradyrhizobium sp. HS3 is 150 - 300 million cfu / mL, Bradyrhizobium sp. USDA110 is 150 - 300 million cfu / mL, Pseudomonas sp. Y43 is 100 - 250 million cfu / mL, Burkholderia sp. Y30 is 100 - 250 million cfu / mL, and Agrobacterium sp. Y27 is 100 - 250 million cfu / mL.

4. The composite microbial inoculum according to any one of claims 1 to 3, characterized in that: The composite microbial inoculant also contains an adhesive.

5. The composite microbial inoculum according to claim 4, characterized in that: The adhesive is arabinose.

6. A seed coating agent, characterized in that: Comprising the composite microbial inoculant according to any one of claims 1 - 3.

7. Use of the composite microbial inoculant according to claim 4 or the seed coating agent according to claim 6 in high - yield IAA production, efficient phosphorus and potassium solubilization.

8. Use of the composite microbial inoculant according to claim 4 or the seed coating agent according to claim 6 in enhancing the nodulation and nitrogen - fixation ability of soybeans.

9. The application according to claim 7 or 8, characterized in that: The said use is achieved by attaching the composite microbial inoculant to the surface of soybean seeds and then planting them in the soil.

10. The application according to claim 9, characterized in that: The type of the said soil is laterite, red soil, or yellow soil.

Images