FMO3 gene SNP molecular marker and its application in determining cattle ketosis resistance
By detecting the SNP molecular markers of the FMO3 gene of dairy cows, especially the ENSBTAG00000020597:g.-1613T>C site, the problem of judging ketosis resistance in dairy cows was solved, early screening and breeding optimization of ketosis resistance were achieved, the incidence of ketosis was reduced, and the health and benefits of dairy cows were improved.
Patent Information
- Application Number
- CN202510795517.2
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-06-16
- Publication Date
- 2025-09-19
- Estimated Expiration
- 2045-06-16
AI Technical Summary
The existing technology lacks effective molecular markers for determining ketosis resistance in dairy cows, resulting in a high incidence of ketosis, which affects the health of dairy cows and breeding benefits.
The ketosis resistance of dairy cows was determined by detecting SNP molecular markers of the FMO3 gene, especially the SNP site located at ENSBTAG00000020597:g.-1613T>C. PCR amplification and sequencing technology were used to determine that dairy cows with the CC genotype had higher ketosis resistance.
It achieves early prediction of ketosis resistance in dairy cows and screening of high-quality individuals, optimizes the breeding of dairy cow herds, reduces the incidence of ketosis, and improves the health level of dairy cows and breeding efficiency.
Smart Images
Figure CN120290753B_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the technical field of animal disease-resistant molecular breeding, and in particular to an FMO3 gene SNP molecular marker and its application in determining cattle ketosis resistance. Background Art
[0002] With the increasing intensification of dairy farming, the metabolic stress caused by the pursuit of high production is becoming increasingly serious. This is especially true during the early stages of lactation, when negative energy balance in dairy cows is significantly exacerbated, making them highly susceptible to a range of metabolic disorders, most notably ketosis. Ketosis is particularly common in high-yielding dairy cows. Essentially, it results from insufficient carbohydrate intake and excessive fat breakdown, leading to the accumulation of ketone bodies, which in turn causes metabolic disorders and compromises normal body function. Typical clinical manifestations include the "three ketones"—ketones in the blood, ketones in the milk, and ketonuria—and the "three lows"—low blood sugar, decreased digestive function, and decreased milk production.
[0003] Ketosis in dairy cows is primarily diagnosed by measuring blood levels of beta-hydroxybutyrate (BHB). In healthy adult dairy cows, blood levels of BHB should be below 1.2 mmol / L. Levels between 1.2 and 3.0 mmol / L are considered subclinical ketosis, while levels above 3.0 mmol / L are considered clinical ketosis.
[0004] Affected dairy cows often exhibit a putrid pear-smelling breath, neurological symptoms, decreased immunity, and reproductive impairment. They are highly susceptible to secondary diseases such as mastitis and endometritis, ultimately leading to increased culling rates. In recent years, the incidence of ketosis has continued to rise, becoming a key factor restricting dairy cow health and improving farm profitability. Because of its genetic profile, screening for molecular markers associated with ketosis and studying its susceptibility mechanisms are of great significance and potential for establishing early, accurate detection and marker-assisted breeding systems.
[0005] Flavin-containing monooxygenase 3 (FMO3), a key member of the FMO enzyme family, is primarily expressed in the liver and participates in the oxidative metabolism of a variety of nitrogenous and sulfur-containing substrates. Recent studies have shown that FMO3 not only detoxifies xenobiotics but also plays a key role in lipid metabolism regulation. FMO3 expression can influence fatty acid synthesis, cholesterol metabolism, and fat deposition. Studies have shown that reduced FMO3 protease function inhibits lipid deposition in vascular walls and hepatocytes. Reduced FMO3 expression can also help reduce endoplasmic reticulum stress in dairy cows during the periparturient period, thereby alleviating lipid metabolism disorders. The T329S mutation in the FMO3 gene improves lipid metabolism in laying hens and reduces the incidence of atherosclerosis and fatty liver. Therefore, the FMO3 gene plays a crucial role in lipid synthesis and metabolism. Its genetic variation may serve as a regulatory marker for metabolic homeostasis, with broad application prospects in the study of energy metabolism adaptation and molecular breeding in dairy cows.
[0006] There are currently no reports on the association between the FMO3 gene and dairy cow ketosis. In view of this, the present invention is proposed. Summary of the Invention
[0007] The purpose of the present invention is to provide a SNP molecular marker related to the anti-ketosis performance of dairy cows, and to determine the anti-ketosis ability of individual dairy cows by detecting their genotypes, so as to assist breeding.
[0008] The technical solution of the present invention is described in detail as follows:
[0009] In a first aspect, the present invention provides a FMO3 gene SNP molecular marker, wherein the SNP molecular marker is located at ENSBTAG00000020597: g.-1613T>C.
[0010] This SNP molecular marker is located in the core promoter region of the FMO3 gene. The promoter structure generally consists of two parts: an upstream regulatory element and a core promoter element. The inventors discovered that functional genetic variation in the core promoter region of the FMO3 gene is significantly correlated with BHB (β-hydroxybutyrate) concentrations. Cows with the CC genotype for the SNP molecular marker have significantly lower BHB concentrations in their blood than those with the TT genotype, and their resistance to ketosis is significantly higher than that of cows with the TT genotype.
[0011] Optionally or preferably, the above-mentioned SNP molecular marker is located at position 250 as shown in SEQ ID NO: 1 in the sequence listing, and the nucleotide is T or C.
[0012] In a second aspect, the present invention provides the use of the above-mentioned SNP molecular marker in determining ketosis resistance in dairy cows. The ketosis resistance of dairy cows with the SNP molecular marker genotype CC is significantly higher than that of dairy cows with the genotype TT.
[0013] Optionally or preferably, in the above application, the method for determining ketosis resistance in dairy cows comprises the following steps:
[0014] (1) Extraction of dairy cow genomic DNA;
[0015] (2) Using the genomic DNA obtained in step (1) as a template and the nucleotide sequences shown in SEQ ID NOs: 2-3 as primers, PCR amplification is performed to obtain an amplification product containing a SNP molecular marker;
[0016] (3) The amplified products were sequenced and the results showed that the ketosis resistance of dairy cows with CC SNP molecular marker genotype was significantly higher than that of dairy cows with TT SNP molecular marker genotype.
[0017] In a third aspect, the present invention provides an application of the above-mentioned molecular markers in assisted breeding of dairy cows. The ketosis resistance of individual dairy cows with the SNP molecular marker genotype CC is significantly higher than that of individual dairy cows with the genotype TT.
[0018] In a fourth aspect, the present invention provides a product for detecting the above-mentioned SNP molecular marker, wherein the product is a primer pair, and the nucleotide sequence is shown in SEQ ID NO: 2-3.
[0019] In a fifth aspect, the present invention provides another product for detecting SNP molecular markers, which is a detection kit comprising a primer pair, the nucleotide sequence of the primer pair being shown in SEQ ID NO: 2-3.
[0020] In a sixth aspect, the present invention provides an application of the above-mentioned detection product in determining the ketosis resistance of dairy cows, specifically, extracting genomic DNA from dairy cows, using the nucleotide sequences shown in SEQ ID NOs: 2~3 as primers, performing PCR amplification to obtain an amplified product containing a SNP molecular marker; sequencing the amplified product, and the ketosis resistance of individual dairy cows with a SNP molecular marker genotype of CC is significantly higher than that of individual dairy cows with a genotype of TT.
[0021] In a seventh aspect, the present invention provides an application of the above-mentioned detection product in assisted breeding of dairy cows, specifically, extracting genomic DNA of dairy cows, using the nucleotide sequences shown in SEQ ID NOs: 2~3 as primers, performing PCR amplification, and obtaining an amplified product containing a SNP molecular marker; sequencing the amplified product, and the ketosis resistance of individual dairy cows with the SNP molecular marker genotype of CC is significantly higher than that of individual dairy cows with the genotype of TT.
[0022] Compared with the prior art, the present invention has the following beneficial effects:
[0023] (1) The present invention provides a genetic variation SNP molecular marker in the core promoter region of the FMO3 gene, located at ENSBTAG00000020597 g.-1613T>C. Analysis found that it was significantly correlated with the blood BHB concentration of dairy cows. The blood BHB concentration of individuals with CC genotype was significantly lower than that of individuals with TT genotype ( P <0.05). The promoter activity of the FMO3 gene was significantly increased when the SNP molecular marker was the CC genotype, indicating that the CC genotype is a ketosis-resistant genotype.
[0024] (2) By using the SNP molecular markers provided by the present invention and analyzing the genotype of the genetic variation site by sequencing, the ketosis resistance of dairy cows can be predicted and high-quality genotype dairy cows can be screened, which can be used for early marker-assisted selection and assisted breeding of dairy cows to optimize the dairy cow population. BRIEF DESCRIPTION OF THE DRAWINGS
[0025] Figure 1 This is a statistical bar graph of the luciferase activity detection results in Example 1, showing that the core promoter region of the bovine FMO3 gene was identified to be located at g.1862 to g.-1600.
[0026] Figure 2 This is a bar graph showing the statistical data of the effects of different genotypes of SNP molecular markers on the promoter activity of the bovine FMO3 gene in Example 2. DETAILED DESCRIPTION
[0027] In order to enable those skilled in the art to better understand the present application, the present application will be clearly and completely described below in conjunction with the embodiments and drawings. Obviously, the embodiments described are only embodiments of a part of the present application, rather than all embodiments. Based on the embodiments in this application, all other embodiments obtained by those of ordinary skill in the art without making creative work should fall within the scope of protection of this application. The instruments and reagents used in the embodiments are all derived from commercial channels unless otherwise specified.
[0028] Example 1 SNP molecular marker screening and identification
[0029] Identification of genetic variations in the core promoter region of the FMO3 gene.
[0030] 1. DNA Extraction from Blood of Ketotic and Healthy Cows
[0031] (1) Sample collection and processing
[0032] Fresh blood was collected aseptically from dairy cows using 5 mL EDTA-K2 anticoagulant vacuum blood collection tubes. The tubes were immediately mixed by gentle inversion 8–10 times. Whole blood samples were transported to the on-site laboratory in an ice box at 4°C.
[0033] (2) β-hydroxybutyrate (BHB) detection
[0034] The blood BHB concentration was measured using a cow blood ketone body tester and recorded on site.
[0035] According to the international diagnostic criteria for subclinical ketosis (BHB ≥ 1.2 mmol / L), dairy cows are divided into:
[0036] Ketosis group (BHB ≥ 1.2 mmol / L)
[0037] Healthy control group (BHB <1.2 mmol / L)
[0038] (3) Genomic DNA extraction and preservation
[0039] 200 μL of anticoagulated whole blood was collected and extracted according to the DNA extraction kit instructions. The extracted product was tested for concentration, aliquoted, and stored in a -20°C freezer until ready for use.
[0040] 2. Identification of the core promoter region of the bovine FMO3 gene
[0041] (1) Construction of promoter region truncation vector
[0042] A series of primers were designed using Primer Premier 5.0 based on the reference sequence of the bovine FMO3 gene in the Ensembl database (Gene ID: ENSBTAG00000020597).
[0043] The downstream primer PGL3+70 (+70 bp site) was fixed, and the upstream primers were designed by fixing the 3' end and shortening the 5'→3' end in sequence. The upstream primers were PGL3-1862, PGL3-1600, PGL3-1133, PGL3-754, and PGL3-410, respectively.
[0044] The above primers were used to amplify the 2000 bp promoter region upstream of the FMO3 gene, and the lengths of the obtained amplified fragment products were 1932 bp, 1670 bp, 1203 bp, 824 bp, and 480 bp, respectively.
[0045] The amplified product was purified and cloned into the pGL3-basic vector to construct five truncated recombinant vectors: PGL3-1862 (-1862bp~+70bp), PGL3-1600 (-1600bp~+70bp), PGL3-1133 (-1133bp~+70bp), PGL3-754 (-754bp~+70bp), and PGL3-410 (-480bp~+70bp).
[0046] (2) The five truncated recombinant vectors constructed above were co-transfected with the pRL-TK internal reference vector (1:50) into HEK-293T cells (Lipofectamine 3000). Firefly luciferase activity and Renilla luciferase activity were measured 48 hours after transfection using the Dual-Luciferase Reporter Assay System (Promega). The ratio of the two was the relative luciferase activity. The data were validated by three independent experiments (n = 6). The relative luciferase activity was used to determine the core promoter region of the bovine FMO3 gene.
[0047] Statistical analysis showed that the luciferase activity of the PGL3-1862 recombinant vector was significantly higher than that of other truncated vectors ( P <0.05, and g.1862 to g.-1600 were identified as the core promoter region of the bovine FMO3 gene ( Figure 1 ).
[0048] 3. Screening and identification of genetic variations in the core promoter region of the FMO3 gene
[0049] Primers designed for the core promoter region of the bovine FMO3 gene:
[0050] FMO3-F (TCAGTCATATCCGACCCTC, as shown in SEQ ID NO: 2),
[0051] FMO3-R (GGCAGTTTCTGATGGAGGC, as shown in SEQ ID NO: 3),
[0052] Genomic DNA extracted from whole blood of ketotic and healthy cattle was used as a template for PCR amplification using the primers shown in SEQ ID NOs: 2-3. The resulting amplified products were directly sequenced and analyzed. The sequences after PCR amplification are as follows:
[0053] TCAGTCATATCCGACCCTCAGCGACCCCATGGATGGCAGCCCACCAGGCTCCTCCGTCCGTGGGATTTTCCAGGCAAGAGTACTGGAGTGGGGTGCCATTGCCTTCTCCGACATATATATATATATATATATATATGTATGTATGTATAAATATAAATACAAATACATTTATATCCTCTAAGTTTGTGACAATTGAGCAAGAAATAGTAGTAGTGTAGATCTTCATTTGATTAATGAATAAAACAAGAA T
[0054] BLAST comparison of the sequencing results with the Ensembl reference sequence (ENSBTAG00000020597) revealed a T>C base substitution (g.-1613T>C) at position -1613 bp, located at base 250 of the sequence (reference sequence number: NC_037348.1). This was verified as a true SNP site, exhibiting a T / C biallelic polymorphism in the population.
[0055] Sanger sequencing was used to verify the FMO3 gene core promoter region (g.1862 to g.-1600). BLAST alignment of the sequencing results with the Ensembl reference sequence (ENSBTAG00000020597) revealed a T>C base substitution (g.-1613T>C) at position -1613 bp. This site is located at base 250 of the sequence shown in SEQ ID NO:1 (underlined and bolded), confirming it as a true SNP site, exhibiting a T / C biallelic polymorphism in the population.
[0056] Example 2 Verification of the association between SNP molecular markers and ketosis resistance
[0057] Effect of the genetic variation g.-1613T>C in the core promoter region on gene promoter activity and its association with blood BHB concentration.
[0058] 1. Effect of the genetic variation g.-1613T>C in the FMO3 gene promoter region on promoter activity
[0059] Site-directed mutagenesis was used to construct the g.-1613T>C allele reporter plasmids (PGL3-1862-T / C), PGL3-1862-T (before mutation) and PGL3-1862-C (after mutation). These two plasmids were transfected into HEK-293T cells using Lipofectamine 3000, and the dual-luciferase activity was detected 48 hours later using the Dual-Luciferase Reporter Assay System. The experimental results showed that the CC genotype significantly enhanced the promoter activity compared to the TT genotype, and the promoter activity of the FMO3 gene was significantly increased ( P <0.05), see Figure 2 , indicating that this SNP site has a transcriptional regulatory function.
[0060] 2. Genotyping of FMO3 gene promoter genetic variation and association analysis with blood BHB concentration
[0061] Genomic DNA from 285 Holstein cows (both healthy and ketotic) was amplified by PCR using the FMO3 gene promoter primers FMO3-F and FMO3-R. Genotyping for the g.-1613T>C gene was performed after sequencing. Association analysis was performed using SAS software. The results are shown in Table 1.
[0062] Table 1 Results of association analysis between the three genotypes of the genetic variation g.-1613T>C in the promoter region of the FMO3 gene in dairy cows and blood BHB concentration
[0063]
[0064] Note: The same letters on the shoulders indicate no significant difference, and different letters indicate significant difference.
[0065] The results showed that the genetic variation g.-1613T>C was significantly associated with BHB concentration, and the blood BHB concentration of individuals with CC genotype was significantly lower than that of individuals with TT genotype ( P <0.05).
[0066] This document uses specific examples to illustrate the inventive concept in detail. The above embodiments are only intended to help understand the core concept of the present invention. It should be noted that any obvious modifications, equivalent substitutions, or other improvements made by a person skilled in the art without departing from the inventive concept should be included within the scope of protection of the present invention.
Claims
1. The use of a reagent for detecting SNP molecular markers of the FMO3 gene in the preparation of a product for determining ketosis resistance in dairy cows, characterized in that: The SNP molecular marker is located at ENSBTAG00000020597: g.-1613T>C; the ketosis resistance of individual dairy cows with the SNP molecular marker genotype CC is significantly higher than that of individual dairy cows with the SNP molecular marker genotype TT.
2. The use according to claim 1, characterized in that The SNP molecular marker is located at position 250 as shown in SEQ ID NO: 1 in the sequence list, and the nucleotide is T or C.
3. The use according to claim 1, characterized in that The reagents include a primer pair, and the nucleotide sequence of the primer pair is shown in SEQ ID NO: 2-3.
4. The use according to claim 1, characterized in that The product is a detection kit, including a primer pair, the nucleotide sequence of the primer pair is shown in SEQ ID NO: 2-3.