DsRNA of targeted phosphoenolpyruvate carboxykinase gene PEPCK and application of dsRNA

Abstract

The invention discloses dsRNA of a targeted phosphoenolpyruvate carboxykinase gene PEPCK and application of the dsRNA in prevention and control of spider mites, and relates to the technical field of genetic engineering, and the dsRNA is technically characterized in that the nucleotide sequence of the dsRNA of the phosphoenolpyruvate carboxykinase gene PEPCK is shown as SEQ ID NO: 1, and the dsRNA can be used for preventing and controlling the spider mites or preparing products for preventing and controlling the spider mites. The dsRNA of the phosphoenolpyruvate carboxykinase gene PEPCK, provided by the invention, has a relatively high lethal effect on female adult spider mites, and can be used for effectively controlling the population quantity of the spider mites and reducing the field harm of the spider mites. The acaricidal composition can be applied to development of transgenic anti-mite plants or novel acaricides, can specifically resist specific types of mites, does not influence other beneficial insects and organisms, and also can improve the anti-mite capability of the plants.

Description

Technical Field

[0001] The present invention relates to the technical field of genetic engineering, and relates to a dsRNA targeting the phosphoenolpyruvate carboxykinase gene PEPCK and its application. Specifically, it targets the gluconeogenesis process of spider mites, and the dsRNA of the PEPCK gene can be used to achieve efficient prevention and control of spider mites. Background Art

[0002] Spider mites, commonly known as red spiders, are extremely tiny in size. Usually, they can only be identified after they gather into a web or have already caused damage to plants. There are mainly Tetranychus cinnabarinus, Tetranychus urticae, Tetranychus truncatus, etc. Spider mites have strong adaptability to hosts and can harm hundreds of agricultural and economic crops such as vegetables, cotton, and fruit trees. Applying chemical pesticides is currently the main means of controlling agricultural pest mites. However, due to their short generation cycle, strong reproductive ability, parthenogenesis and other biological characteristics, and the unreasonable and unscientific use of chemical agents, their resistance problem is more prominent than that of other agricultural pests.

[0003] RNA interference (RNAi) is a conserved post-transcriptional specific gene silencing mechanism, mainly caused by the degradation of mRNA triggered by endogenous or exogenous double-stranded RNA (dsRNA), resulting in the phenomenon of specifically hindering the expression of target genes. RNAi has the advantages of high efficiency, specificity, pollution-free and a large number of target genes to choose from. The new nucleic acid pesticides developed based on this technology are considered the third revolution in the history of pesticides, which can target and precisely control pest mites, and are also considered an ideal means to solve the problem of pest mite resistance. Currently, the United States has developed and launched the world's first nucleic acid pesticide, CalanthaTM, for controlling the Colorado potato beetle. The journal Science also reported in 2024 that the application of nucleic acid pesticides is a major breakthrough in agricultural science.

[0004] Spider mites have a high affinity for exogenous dsRNA, and dsRNA can be delivered to them by simple feeding or spraying, indicating that nucleic acid pesticides developed based on the RNAi technology for controlling spider mites have broad prospects. Currently, the research and development of nucleic acid pesticides for spider mites progress slowly, and the core problem lies in the lack of effective target information.

[0005] Therefore, in view of the biological characteristics of spider mites, which have strong digestive ability and can quickly adapt to adversity, the present invention discovers and proposes a dsRNA targeting the phosphoenolpyruvate carboxykinase gene PEPCK for the efficient control of spider mites, and also provides ideal target information for the research and development of nucleic acid pesticides for spider mites. Summary of the Invention

[0006] To solve the above technical problems, the present invention provides a dsRNA targeting the phosphoenolpyruvate carboxykinase gene PEPCK and its application in the control of spider mites.

[0007] To achieve the above object, the technical solution of the present invention is as follows:

[0008] A dsRNA targeting the phosphoenolpyruvate carboxykinase gene PEPCK, wherein the nucleotide sequence of the dsRNA is as shown in SEQ ID NO: 1.

[0009] The present invention also provides an application of a dsRNA targeting the phosphoenolpyruvate carboxykinase gene PEPCK, and the application includes at least one of the following:

[0010] (5) Preventing and controlling spider mites or preparing a product for preventing and controlling spider mites;

[0011] (6) Promoting the death of spider mites or preparing a product for promoting the death of spider mites;

[0012] (7) Inhibiting the survival of spider mites or preparing a product for inhibiting the survival of spider mites;

[0013] (8) Inhibiting the expression of the PEPCK gene of spider mites or preparing a product for inhibiting the expression of the PEPCK gene of spider mites.

[0014] Preferably, the spider mites include but are not limited to Tetranychus urticae, Tetranychus cinnabarinus, and Tetranychus truncatus.

[0015] Preferably, the composition at least includes the above dsRNA.

[0016] The present invention also provides a preparation method of a dsRNA targeting the phosphoenolpyruvate carboxykinase gene PEPCK, including the following steps:

[0017] S1. Extract the total RNA of spider mites, remove the genomic DNA in the total RNA, and reverse transcribe to synthesize cDNA;

[0018] S2. Design a corresponding primer pair PEPCK-P1, use the cDNA as a template, and perform PCR amplification with the primer pair PEPCK-P1 to obtain the phosphoenolpyruvate carboxykinase gene PEPCK;

[0019] S3. Based on the nucleotide sequence of the phosphoenolpyruvate carboxykinase gene PEPCK, design a primer pair PEPCK-A2;

[0020] S4. Synthesize an RNAi fragment by PCR amplification, recover the amplification product, and perform the synthesis and purification of dsRNA to obtain a dsRNA targeting the phosphoenolpyruvate carboxykinase gene PEPCK.

[0021] Preferably, the primer pair PEPCK-P1 includes an upstream primer PEPCK-P1-F with a nucleotide sequence as shown in SEQ ID NO: 2 and a downstream primer PEPCK-P1-R with a nucleotide sequence as shown in SEQ ID NO: 3.

[0022] Preferably, the nucleotide sequence of the phosphoenolpyruvate carboxykinase gene PEPCK is as shown in SEQ ID NO: 4.

[0023] Preferably, in step S2, the reaction system for the PCR amplification is as follows: 12.5 μL of K5 HiFi 2×PCR Master Mix, 1 μL each of 10 μM upstream and downstream primers, 1 μL of cDNA template, and supplemented with ddH2O to 25 μL; the reaction procedure for the PCR amplification is as follows: pre-denaturation at 95°C for 3 min; denaturation at 95°C for 30 s, annealing at 55°C for 15 s, extension at 72°C for 1 min, for a total of 34 cycles; final extension at 72°C for 3 min.

[0024] Preferably, the primer pair PEPCK-P2 includes an upstream primer PEPCK-P2-F1 with a nucleotide sequence as shown in SEQ ID NO: 5 and a downstream primer PEPCK-P2-R1 with a nucleotide sequence as shown in SEQ ID NO: 6, and an upstream primer PEPCK-P2-F2 with a nucleotide sequence as shown in SEQ ID NO: 7 and a downstream primer PEPCK-P2-R2 with a nucleotide sequence as shown in SEQ ID NO: 8.

[0025] Preferably, in step S4, the reaction system for the PCR amplification is as follows: 12.5 μL of K5 HiFi 2×PCR Master Mix, 1 μL each of 10 μM upstream and downstream primers, 1 μL of cDNA template, and supplemented with ddH2O to 25 μL; the reaction procedure for the PCR amplification is as follows: pre-denaturation at 95°C for 3 min; denaturation at 95°C for 30 s, annealing at 55°C for 15 s, extension at 72°C for 10 s, for a total of 34 cycles; final extension at 72°C for 3 min.

[0026] Compared with the prior art, the beneficial effects of this solution are:

[0027] In view of the gluconeogenesis process of spider mites, the present invention discovers and provides dsRNA of phosphoenolpyruvate carboxykinase gene PEPCK, which can efficiently inhibit the glycogen conversion function of spider mites, has excellent lethal effects on them, can efficiently control the population quantity of spider mites, and reduce the field damage of spider mites. This dsRNA can be used for the development of transgenic mite-resistant plants or novel acaricides, can specifically prevent and control agricultural pest mites without affecting other beneficial insects and predator mites, its application can also effectively reduce the use of chemical acaricides, has higher environmental friendliness, and can also enrich the RNAi target information library specific to spider mites, laying a foundation for the creation of green mite control agents. Brief Description of the Drawings

[0028] Figure 1 It is the electrophoretic analysis diagram of the amplification of phosphoenolpyruvate carboxykinase gene PEPCK in Example 1 of the present invention;

[0029] Figure 2 It is the electrophoretic analysis diagram of the amplification of dsRNA of phosphoenolpyruvate carboxykinase gene PEPCK in Example 2 of the present invention;

[0030] Figure 3 It is the statistical result of the survival rate of spider mites fed with dsRNA of phosphoenolpyruvate carboxykinase gene PEPCK in Example 3 of the present invention;

[0031] Figure 4 It is the death phenotype of spider mites in Example 3 of the present invention. Detailed Embodiments

[0032] In order to enable those skilled in the art to better understand the solution of the present invention, the technical solution of the present invention will be further described in detail below in combination with the embodiments and drawings of the present invention. Obviously, the described embodiments are only a part of the embodiments of the present invention, rather than all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those of ordinary skill in the art without creative efforts shall fall within the protection scope of the present invention.

[0033] It should be noted that, without conflict, the embodiments in the present invention and the features in the embodiments can be combined with each other. The present invention will be described in detail below in combination with the embodiments.

[0034] Example 1 Synthesis of Phosphoenolpyruvate Carboxykinase Gene PEPCK

[0035] 1 Spider mite population

[0036] Tetranychus urticae and Tetranychus cinnabarinus were collected from a rose garden in Kunming, Yunnan, and Tetranychus truncatus was collected from a soybean field in Lanzhou, Gansu. All spider mite populations were reared in a constant temperature and light incubator. The test host was cowpea seedlings, and the rearing conditions were 26°C, 14 hours of light, and 10 hours of darkness.

[0037] 2 RNA Extraction and Reverse Transcription

[0038] Pick 200 female adult mites at 3 - 5 days old, quickly freeze them in liquid nitrogen, and then extract total RNA using Trizol. Subsequently, add 1 μL of DNaseⅠ to 1 μg of RNA to remove genomic DNA contamination. Using the purified RNA as a template, reverse transcribe to synthesize the first strand of cDNA using the Takara PrimeScriptII 1st Strand cDNA Synthesis Kit. The reaction system and conditions are strictly operated according to the kit instructions.

[0039] 3 Primer Design and Gene Cloning

[0040] According to the genomic databases of Tetranychus urticae and Tetranychus cinnabarinus, use Primer5.0 software to design full - length CDS primers P1 (Table 1). After the primers are synthesized by Tsingke Biological Gene Company, perform PCR amplification using mite cDNA as a template. The reaction system is: 12.5 μL of K5HiFi 2×PCR Master Mix, 1 μL of each upstream and downstream primer (10 μM), 1 μL of cDNA template, and make up to 25 μL with ddH2O.

[0041] Table 1 Amplification primers for the gene PEPCK sequence

[0042]

[0043] 4. PCR Amplification and Product Verification

[0044] The PCR reaction program is set as: pre - denaturation at 95℃ for 3 min; denaturation at 95℃ for 30 s, annealing at 55℃ for 15 s, extension at 72℃ for 1 min, for a total of 34 cycles; final extension at 72℃ for 3 min; store the product at - 20℃. Electrophoresis analysis shows that the band position of the amplified product is consistent with the expected target fragment size of 2013 bp (see Figure 1 ), indicating good primer specificity. The full - length CDS of the phosphoenolpyruvate carboxykinase gene can be successfully amplified by PCR, and the nucleotide sequence is as shown in SEQ ID NO: 4.

[0045]

[0046] After the amplified product was recovered by gel extraction, it was ligated to the pClone007 (Qingke Biotech) vector using a rapid ligase, and then transformed into 5α competent cells. The revived competent cells were evenly spread on a solid LB culture plate and incubated at 37 °C for 14 hours. Single colonies were picked for bacterial detection and sequencing. Positive colonies were expanded in LB culture medium and plasmids were extracted.

[0047] Example 2 Synthesis of dsRNA of Phosphoenolpyruvate Carboxykinase Gene PEPCK 1 Primer Design

[0048] Based on the CDS sequence of the phosphoenolpyruvate carboxykinase gene PEPCK cloned in Example 1, the dsRNA primer P2 (see Table 2) was designed using Primer5.0 software. The primer design included the following key features: a 300 - 500 bp region was selected as the template in the full-length CDS sequence; the T7 RNA polymerase promoter sequence (5'-TAATACGACTCACTATAGGGAGAGAATAGGCATGCGTAGATC-3') was added to the 5' ends of the upstream and downstream primers.

[0049] The Tm value of the primer was controlled at 55 ± 3 °C, the GC content was 40 - 60%, three consecutive G / C bases were avoided at the 3' end, and the last base was preferably T.

[0050] Table 2 Amplification Primers for dsRNA Sequence of Phosphoenolpyruvate Carboxykinase Gene PEPCK

[0051]

[0052] 2 Synthesis and Purification of dsRNA

[0053] The upstream and downstream fragments were amplified separately using the full-length plasmid of the phosphoenolpyruvate carboxykinase gene as the template. The reaction system was: 12.5 μL of K5 HiFi 2×PCR Master Mix, 1 μL of each of the upstream and downstream primers (10 μM), 1 μL of cDNA template, and ddH2O was added to make up to 25 μL. The PCR program was set as follows: pre-denaturation at 95 °C for 3 min; denaturation at 95 °C for 30 s, annealing at 55 °C for 15 s, extension at 72 °C for 10 s, for a total of 34 cycles; final extension at 72 °C for 3 min; the product was stored at -20 °C.

[0054] dsRNA synthesis was carried out using the T7 RiboMAXTM Express RNAi System. The reaction system was as follows: 10 μL of RiboMAXTM Express T7 2× Buffer, 1 - 8 μL of DNA template, 2 μL of Enzyme Mix, and made up to 20 μL with Nuclease-free Water. Incubate at 37 °C for 4 h. Remove the DNA template and mix equal volumes of the sense and antisense RNA solutions. Incubate at 70 °C for 10 min and then slowly cool to room temperature. Add 1 μL of RQ1 High Purity RNase-Free DNase and 1 μL of RNase A solution (diluted 1:200), and incubate at 37 °C for 30 min to degrade the residual DNA.

[0055] The purification of dsRNA was performed by ethanol precipitation: ① Add 0.1 volume of 3 M sodium acetate (pH 5.2) and 1 volume of isopropanol, and let stand on ice for 5 min; ② Centrifuge at 14000 rpm for 10 min and discard the supernatant; ③ Wash the precipitate with 0.5 mL of 70% ethanol and dry at room temperature for 15 min; ④ Dissolve the RNA in 20 - 50 volumes of Nuclease-free Water and store at -70 °C. The concentration of dsRNA was measured using NanoDrop2000 (A260 / A280 ≥ 1.8), and the integrity of dsRNA was detected by agarose gel electrophoresis. The nucleotide sequence of dsRNA is shown in SEQ ID NO: 1.

[0056] dsRNA nucleotide sequence (SEQ ID NO: 1):

[0057] TGCATCTCTAGTATTGGTCTTGATAAGTTGTCTTCAAAGGCAAGAAACTTTGTTGAGGAAAAGGCCAGAATATGTGAACCAGATAGCATTCACATATGCGATGGCACTGAAGAAGAAAACAATCAGCTTATCAATTTGATGGTCCAACAAGGAATGATCAAAAAATTACCAAAATATGAAAATTGTTGGCTGTCTCGAACTGATCCAGCTGATGTTGCTCGTGTAGAGTCTCTGACATTTATTTCAACCAGAAATAAACGTGATACTGTTCCAGAACCCAAACCTGGAGTAAAAGGAACTCTTGGAAATTGGATGTCACCGGATGATTTAGACAAAGCTCTAAATTCACGGTTCCCTAAATGCATGAAGGGAAGAACAATGTAT。

[0058] The results showed that the target dsRNA fragment was successfully cloned using the full-length plasmid of PEPCK as a template, and the size of the further synthesized dsRNA was consistent with the theoretical value of 384 bp ( Figure 2 ).

[0059] Example 3 Delivery Test of dsRNA by Feeding Method

[0060] After diluting the purified dsRNA solution in Example 2 with enzyme-free water to 1500 ng / μL, use a 10 μL pipette to evenly spot the solution on a 35 mm culture dish by the dropping method to form a 2×2 cm rectangular distribution grid.

[0061] Cut fresh cowpea leaves into 2×2 cm pieces, then dehydrate them at 60 °C for 2 min. Divide the dehydrated leaves into two groups, one as the control group and the other as the experimental group. Attach the dehydrated leaves of the experimental group to the dsRNA droplets and let the leaves fully absorb the dsRNA liquid for 4 - 5 hours. Transfer the two groups of leaves to a new culture dish. Sterile sponge and filter paper are pre-laid at the bottom of the culture dish for leaf water replenishment and freshness preservation. Pick 30 healthy young mites and transfer them to the treated leaves. Set three independent biological replicates for each group of experiments, continuously feed for seven days and observe and record the survival rate daily, and take pictures of the death phenotypes of the spider mites with a super-depth-of-field microscope.

[0062] Using the feeding method to deliver the dsRNA solution of PEPCK to Tetranychus cinnabarinus, Tetranychus urticae, and Tetranychus truncatus in the larval stage, with dsGFP targeting green fluorescent protein as a control. The feeding experiment found that compared with the control group, the three species of spider mites began to die 2 days after feeding on dsRNA, and the mortality rate increased significantly with the feeding time. By the 7th day, the mortality rates of the three species of spider mites all exceeded 50% ( Figure 3 ); taking the death phenotype of Tetranychus cinnabarinus as an example, when feeding on the dsRNA of PEPCK, the growth of the spider mites was significantly restricted, the body was shriveled, and the digestive cells on the back disappeared ( Figure 4 ), indicating that the dsRNA targeting PEPCK can significantly inhibit the energy metabolism system of mites, resulting in their massive death and high precision prevention and control efficiency for spider mites.

[0063] The above specific embodiments are only explanations of the present invention, and they are not limitations of the present invention. Those skilled in the art can make modifications to the embodiments without creative contributions according to needs after reading this specification, but as long as they are within the scope of the claims of the present invention, they are protected by the patent law.

Claims

1. A dsRNA targeting the phosphoenolpyruvate carboxykinase gene PEPCK, characterized in that, The nucleotide sequence of the dsRNA is as shown in SEQ ID NO:

1.

2. Use of the dsRNA targeting phosphoenolpyruvate carboxykinase gene PEPCK as described in claim 1, characterized in that, The application includes at least one of the following: (1) Preventing and controlling spider mites or preparing a product for preventing and controlling spider mites; (2) Promoting the death of spider mites or preparing a product for promoting the death of spider mites; (3) Inhibiting the survival of spider mites or preparing a product for inhibiting the survival of spider mites; (4) Inhibiting the expression of the PEPCK gene of spider mites or preparing a product for inhibiting the expression of the PEPCK gene of spider mites.

3. The application according to claim 2, wherein The spider mites include, but are not limited to, Tetranychus urticae, Tetranychus cinnabarinus, and Tetranychus truncatus.

4. A composition for controlling spider mites, characterized in that, The composition at least includes the dsRNA as described in claim 1.

5. The preparation method of the dsRNA targeting the phosphoenolpyruvate carboxykinase gene PEPCK as claimed in claim 1, characterized in that, It includes the following steps: S1. Extract the total RNA of spider mites, remove the genomic DNA in the total RNA, and reverse transcribe to synthesize cDNA; S2. Design the corresponding primer pair PEPCK-P1, use the cDNA as a template, and perform PCR amplification with the primer pair PEPCK-P1 to obtain the phosphoenolpyruvate carboxykinase gene PEPCK; S3. Based on the nucleotide sequence of the phosphoenolpyruvate carboxykinase gene PEPCK, design the primer pair PEPCK-A2; S4. Synthesize the RNAi fragment by PCR amplification, recover the amplification product, and perform the synthesis and purification of dsRNA to obtain the dsRNA targeting the phosphoenolpyruvate carboxykinase gene PEPCK.

6. The preparation method of the dsRNA targeting the phosphoenolpyruvate carboxykinase gene PEPCK according to claim 5, characterized in that, The primer pair PEPCK-P1 includes the upstream primer PEPCK-P1-F with a nucleotide sequence as shown in SEQ ID NO: 2 and the downstream primer PEPCK-P1-R with a nucleotide sequence as shown in SEQ ID NO:

3.

7. The preparation method of the dsRNA targeting the phosphoenolpyruvate carboxykinase gene PEPCK according to claim 5, characterized in that, The nucleotide sequence of the phosphoenolpyruvate carboxykinase gene PEPCK is as shown in SEQ ID NO:

4.

8. The preparation method of the dsRNA targeting phosphoenolpyruvate carboxykinase gene PEPCK according to claim 5, characterized in that, In step S2, the reaction system for the PCR amplification is: 12.5 μL of K5 HiFi 2×PCR MasterMix, 1 μL each of the upstream and downstream primers at 10 μM, 1 μL of cDNA template, and supplemented with ddH2O to 25 μL; the reaction program for the PCR amplification is: pre-denaturation at 95°C for 3 min; denaturation at 95°C for 30 s, annealing at 55°C for 15 s, extension at 72°C for 1 min, for a total of 34 cycles; final extension at 72°C for 3 min.

9. The preparation method of the dsRNA targeting phosphoenolpyruvate carboxykinase gene PEPCK according to claim 5, characterized in that, The primer pair PEPCK-P2 includes the upstream primer PEPCK-P2-F1 with a nucleotide sequence as shown in SEQ ID NO: 5 and the downstream primer PEPCK-P2-R1 with a nucleotide sequence as shown in SEQ ID NO: 6, and the upstream primer PEPCK-P2-F2 with a nucleotide sequence as shown in SEQ ID NO: 7 and the downstream primer PEPCK-P2-R2 with a nucleotide sequence as shown in SEQ ID NO:

8.

10. The preparation method of the dsRNA targeting the phosphoenolpyruvate carboxykinase gene PEPCK according to claim 5, characterized in that, In step S4, the reaction system for the PCR amplification is as follows: 12.5 μL of K5 HiFi 2×PCR Master Mix, 1 μL each of the upstream and downstream primers at 10 μM, 1 μL of cDNA template, and supplemented with ddH2O to 25 μL; the reaction program for the PCR amplification is: pre-denaturation at 95°C for 3 min; denaturation at 95°C for 30 s, annealing at 55°C for 15 s, extension at 72°C for 10 s, for a total of 34 cycles; final extension at 72°C for 3 min.

Images