HBP3 for improving salt tolerance of plants and application of HBP3

Abstract

The invention belongs to the technical field of plant genetic engineering, and particularly relates to HBP3 for improving plant salt tolerance and application of the HBP3, the nucleotide sequence of the HBP3 is shown as SEQ ID NO.3, and the amino acid sequence of the HBP3 is shown as SEQ ID NO.4. According to the invention, a gene HBP3 for pre-coding the heme binding protein is separated from red rice for the first time, and an overexpression plant is obtained by constructing a recombinant overexpression vector containing the HBP3 and transforming the recombinant overexpression vector into an arabidopsis plant. Compared with a wild type plant, the over-expression plant has the advantage that the tolerance to high salinity is enhanced. According to the invention, the salt stress resistance of HBP3 is found for the first time, the salt stress experiment result shows that the high salt tolerance of the overexpressed plant is obviously enhanced, and the expression of the two genes ABA1 and ABA2 related to abscisic acid in the overexpressed plant is reduced, so that a molecular basis is provided for revealing the salt stress regulation of the overexpressed plant.

Description

Technical Field

[0001] The present invention belongs to the technical field of plant genetic engineering, and specifically relates to an HBP3 for improving plant salt tolerance and its application. Background Art

[0002] The damage caused by the high-salt environment in the soil to plants is multi-faceted, seriously affecting their growth and development. First, high-salt stress will cause osmotic stress, the osmotic pressure of the soil solution increases, making it difficult for plant roots to absorb water, resulting in cell dehydration, plant wilting, and growth inhibition. Second, high-salt stress will cause ion toxicity, and a large amount of salt ions such as Na + and Cl - accumulate in large quantities, interfering with the absorption of other essential nutrients by plants, resulting in nutritional imbalance, and at the same time damaging cell organelles and affecting normal cell metabolism. In addition, high-salt stress will also trigger oxidative stress, inducing an increase in the production of reactive oxygen species in plants, and the antioxidant system may not be able to scavenge them in time, resulting in membrane lipid peroxidation and destroying the integrity of cell membranes. Photosynthesis will also be damaged, the stomata close to reduce the entry of carbon dioxide, chlorophyll degrades, and the photosynthetic efficiency decreases. Hormone balance is disrupted, and the levels of auxin and abscisic acid change, affecting plant growth and development. Reproductive growth is also affected, pollen viability decreases, and the seed setting rate decreases. Under high-salt stress, plants will also synthesize more secondary metabolites, consuming energy and resources. These damages interact with each other, ultimately resulting in inhibited plant growth, reduced yield, and lower quality. Therefore, there is an urgent need to provide a new strategy for plants to cope with salt stress. Summary of the Invention

[0003] To cope with the harm caused by salt stress to plants, the present invention provides an HBP3 for improving plant salt tolerance.

[0004] The technical solution adopted by the present invention is as follows:

[0005] The present invention provides an HBP3 for improving plant salt tolerance, and the nucleotide sequence of the HBP3 is shown as SEQ ID NO.3, and the amino acid sequence is shown as SEQ ID NO.4.

[0006] The present invention also provides an application of the HBP3, by constructing a recombinant overexpression vector of the HBP3 to prepare an overexpressing plant to improve the salt tolerance of the plant.

[0007] Preferably, the preparation method of the recombinant overexpression vector includes the following steps:

[0008] Extract rice RNA, reverse transcribe it into cDNA, amplify HBP3 using cDNA as a template; digest the overexpression vector with enzymes; ligate HBP3 with the digested overexpression vector to obtain a recombinant overexpression vector.

[0009] Preferably, the overexpression vector is pCXSN.

[0010] Preferably, when digesting the overexpression vector with restriction enzymes, the restriction enzyme used is XcmI.

[0011] Preferably, the method for constructing the overexpressing plant is as follows:

[0012] Transform the recombinant overexpression vector into Agrobacterium competent cells; perform enlarged culture to prepare an infection solution;

[0013] Use the infection solution to infect wild-type plants and culture them to obtain overexpressing plants.

[0014] Preferably, the Agrobacterium competent cells are EHA105.

[0015] Preferably, the conditions for the enlarged culture are to culture at 28 °C and 190 rpm for 24 h.

[0016] Preferably, the OD 600 value of the infection solution is 0.8.

[0017] Preferably, when using the infection solution to infect wild-type plants, the infection conditions are as follows:

[0018] The infection time is 1 min, and the total infection is performed twice, with an interval of 5 d between the two infections.

[0019] Compared with the prior art, the beneficial effects of the present invention are as follows:

[0020] The present invention provides an HBP3 for improving the salt tolerance of plants. The nucleotide sequence of HBP3 is shown in SEQ ID NO.3, and the amino acid sequence is shown in SEQ ID NO.4. The present invention first isolated a gene HBP3 encoding a heme-binding protein from the red rice variety Dahonggu. The full length of its CDS is 915 bp, and the primary structure of the pre-encoded protein contains 304 amino acids, including 2 cysteines, 15 tyrosines, and 10 methionines. The present invention constructs a recombinant overexpression vector containing HBP3 and transforms it into Arabidopsis thaliana plants to obtain overexpressing plants. It is found that compared with wild-type plants, the overexpressing plants have enhanced tolerance to high salinity. The present invention first discovers the salt stress tolerance function of HBP3. The results of the salt stress experiment show that the overexpressing plants have significantly enhanced tolerance to high salinity, and the expressions of two abscisic acid-related genes, ABA1 and ABA2, are both down-regulated in the overexpressing plants, providing a molecular basis for revealing its salt stress regulation. Further, in actual production applications, the overexpression of HBP3 can be used to enhance the salt tolerance of plants, so as to be used for breeding crop varieties resistant to abiotic stresses, thereby reducing the yield and quality damage caused by salt stress. Description of the Drawings

[0021] Figure 1 It is a figure showing the results of aseptic germination and seedling culture of red rice seeds. A: Aseptic germination; B: Aseptic seedlings.

[0022] Figure 2 It is a figure showing the detection result of PCR amplification gel electrophoresis of HBP3.

[0023] Figure 3 It is an electrophoresis figure after HBP3 is connected with pCXSN.

[0024] Figure 4 It is a figure showing the comparison result of seedling culture between wild-type plants and overexpressing plants.

[0025] Figure 5 It is a figure showing the detection result of PCR identification gel electrophoresis of wild-type plants and overexpressing plants.

[0026] Figure 6 It is a figure showing the comparison result of the salt stress tolerance ability between wild-type plants and overexpressing plants.

[0027] Figure 7 It is a figure showing the comparison result of the survival rate between wild-type plants and overexpressing plants under salt stress conditions.

[0028] Figure 8 It is for detecting the expression levels of ABA1 and ABA2 by qRT-PCR. A: Statistical analysis of the expression level of ABA1; B: Statistical analysis of the expression level of ABA2. Specific implementation manners

[0029] The present invention is further illustrated by the following specific examples, but the scope of the present invention is not limited. Without departing from the spirit and scope of the present invention, modifications or substitutions can be made to the details and forms of the technical solutions of the present invention, but these modifications or substitutions all fall within the protection scope of the present invention.

[0030] The inventive concept of the present invention is as follows:

[0031] Heme is one of the important members of the tetrapyrrole compound family. With the in-depth research, it has now been found that it not only serves as an important prosthetic group of hemoglobin, but also participates in the regulation of oxygen metabolism and transport, intracellular electron transfer, etc. In most cases, non-free heme in the body often interacts with protein subunits to form a complex and exert its regulatory function. However, excessive free heme can induce the production of reactive oxygen species and cause oxidative stress damage to cells. Therefore, intracellular heme must be regulated by the action of enzymes or specific proteins to maintain relative stability.

[0032] Phytohemagglutinin is relatively insoluble in water and needs to be transported to functional tissue sites with the help of its apoprotein-binding proteins. Heme-binding related proteins, with the English name heme binding-related proteins, abbreviated as HBP, include key factors such as heme oxygenase that participate in the regulation of heme levels and stress responses. Therefore, plant-derived heme apoproteins, including heme-binding and transport proteins, play an important role in the normal functioning of heme. Colored rice is an important rice germplasm resource. For example, red rice has outstanding advantages in its genetic resources to some extent. Using biotechnological methods to discover endogenous active protein factors is of great significance for further exploring its genetic resources and promoting their utilization. For example, identifying the factors that regulate stress will provide a basis for further developing and applying the functions of its genetic resources.

[0033] The genes encoding plant-derived heme-binding related proteins have important potential in enhancing plants' resistance to biotic and abiotic stresses in plants. However, there is little research on heme-binding related proteins in red rice, and the molecular activity of its in vitro regulation of stresses such as high salinity remains to be studied. The present invention for the first time isolated a pre-coded heme-binding protein gene HBP3 from red rice variety Dahonggu and provided application evidence for its function of regulating salt stress.

[0034] To enable those skilled in the art to better understand and implement the technical solutions of the present invention, the present invention will be further described below in conjunction with specific embodiments. In the description of the present invention, unless otherwise specified, the reagents used are commercially available, and the methods used are conventional techniques in the art.

[0035] Example 1

[0036] An HBP3 for improving plant salt tolerance and its application are as follows:

[0037] 1. Preparation of plant materials.

[0038] The red rice seeds are shelled and sterilized aseptically: sterilized with a 2% (v / v) sodium hypochlorite solution for 5 min, rinsed repeatedly 4 times with sterile water, placed on sterile filter paper in a petri dish, and germinated aseptically at a relative humidity of 65%. Cultured in an incubator at 28 °C with a 16 h / 8 h light and dark cycle. After 5 days of germination, sterile red rice seedlings are obtained, as shown in Figure 1 .

[0039] 2. PCR amplification of HBP3.

[0040] Take the sterile red rice seedlings, and extract total RNA by the Trizol method. Using the extracted total RNA as the material, after reverse transcription, RT-PCR reaction is carried out to obtain cDNA.

[0041] Subsequently, using specific primers HBP3-F and HBP3-R, PCR was performed with cDNA as the template to amplify HBP3. The PCR reaction program was as follows: pre-denaturation at 95°C for 3 min; denaturation at 95°C for 30 s, annealing at 50°C for 30 s, extension at 72°C for 60 s; final extension at 72°C for 5 min, and preservation at 16°C for 5 min. The number of reaction cycles was set to 30. The sequence of HBP3-F is as shown in SEQ ID NO.1; the sequence of HBP3-R is as shown in SEQ ID NO.2.

[0042] SEQ ID NO.1: CGGGATCCATGGCTGCTGGGAGGGGCA.

[0043] SEQ ID NO.2: CGGAATTCTCAATTAACCACATCAAGG.

[0044] The PCR reaction products were analyzed by agarose gel electrophoresis. The band size was consistent with the expectation, around 915 bp, see Figure 2 .

[0045] 3. Sequence the PCR reaction products and analyze their base composition.

[0046] After PCR was completed, the products were recovered, sent for sequencing, and the sequencing results were analyzed to identify their true base pair composition. Analysis showed that the full-length CDS of HBP3 was 915 bp. The CDS of HBP3 is as shown in SEQ ID NO.3.

[0047] SEQ ID NO.3:

[0048] ATGGCTGCTGGGAGGGGCATCAGTCAGCTTTTGAAGAAAGCATTTCGTCCATCTAGCTCATCTCCGCTCTCTTCATCCTGGATAAATCATGAAGAGTCCTCTGGCTTCACTGGATTGAGAGCATTGGCTATTCTGGGAGTTGGTGCTTCTGGCCTTTTAAGTTTTGCTACAATTGCATCTGCTGATGAAGCGGAGCATGGGTTGGAAGCCCCACACTATCCCTGGCCACATGCTGGCATCCTTAGCTCATATGATCATGCATCAATAAGGCGTGGCCATCAAGTTTATACACAAGTGTGTGCCTCTTGTCACTCAATGTCCTTGATTTCATACCGAGATTTGGTTGGTGTGGCCTATACAGAAGAGGAAACAAAAGCAATGGCTGCTGAGATTGAAGTGGTTGACGGTCCTAATGATGAAGGTGAAATGTTCACACGTCCAGGTAAGCTGAGCGACCGTTTCCCACAACCCTACGCAAATGAGCAAGCAGCTCGATTTTCAAATGGCGGGGCATACCCCCCGGATCTCAGTCTAATCACAAAGGCCAGGCACAATGGCCAGAACTATGTTTTTGCTCTTCTCACTGGTTATCGTGATCCACCTGCTGGTGTTTCGATTCGTGAAGGCTTGCATTACAATCCCTACTTCCCTGGTGGTGCCATAGCCATGCCCAAGATGCTTATTGATGGAGCAGTCGAGTATGAAGATGGCACTCCAGCTACAGAAGCCCAGATGGGAAAAGATGTTGTCTCGTTCTTGTCATGGGCGGCGGAGCCTGAGATGGAAGAGAGAAAACTGATGGGAGTGAAATGGATTTTTCTACTCTCCCTCGCACTTCTGCAAGCTGCATATTACCGGCGCATGAAGTGGTCCGTCTACAAGTCGCGCAAGCTGGTCCTTGATGTGGTTAATTGA。

[0049] 4. The encoded protein of HBP3.

[0050] According to the sequencing result of SEQ ID NO.3, DNAMAN software was used for translation, and it was predicted that the encoded protein contains 304 amino acids. The amino acids of HBP3 are shown in SEQ ID NO.4.

[0051] SEQ ID NO.4:

[0052] MAAGRGISQLLKKAFRPSSSSPLSSSWINHEESSGFTGLRALAILGVGASGLLSFATIASADEAEHGLEAPHYPWPHAGILSSYDHASIRRGHQVYTQVCASCHSMSLISYRDLVGVAYTEEETKAMAAEIEVVDGPNDEGEMFTRPGKLSDRFPQPYANEQAARFSNGGAYPPDLSLITKARHNGQNYVFALLTGYRDPPAGVSIREGLHYNPYFPGGAIAMPKMLIDGAVEYEDGTPATEAQMGKDVVSFLSWAAEPEMEERKLMGVKWIFLLSLALLQAAYYRRMKWSVYKSRKLVLDVVN.

[0053] 5. Preparation of recombinant overexpression vector.

[0054] After PCR, the product was recovered to obtain HBP3; the overexpression vector pCXSN was digested with the restriction endonuclease XcmI. After digestion at 37 °C for 2 h, the digested pCXSN was recovered. Then the digested pCXSN and HBP3 obtained by PCR amplification were ligated with T4 DNA ligase. 5 μL of the product in the ligation system was mixed with Escherichia coli competent cells, and after ice bath for 30 min, heat shock transformation was carried out. After completion, it was spread on LB medium containing 100 μg / mL Amp and cultured upside down for 16 h. Single colonies were observed and selected for liquid LB culture, plasmids were extracted, and sequencing was performed again. If the sequencing was correct, the recombinant overexpression vector pCXSN-HBP3 was obtained. The results are shown in Figure 3 , Figure 3 in which Rp-1 to Rp-3 are 3 parallel samples of the recombinant overexpression vector.

[0055] 6. Preparation of transgenic Arabidopsis plants.

[0056] Prepare electrocompetent cells of Agrobacterium tumefaciens EHA105. Then, use the electroporation method to transform the recombinant overexpression vector pCXSN-HBP3 into Agrobacterium tumefaciens EHA105, culture it, and verify to ensure successful transformation. Take the successfully transformed colonies and expand the culture in YEP liquid medium containing 100 μg / mL Kan and 100 μg / mL Rif at 28 °C and 190 rpm for 24 h for expansion culture until OD 600 value reaches 0.8. Centrifuge at 4000 rpm for 5 min to collect the bacterial cells, and resuspend the bacterial cells in 1 / 2 MS liquid medium containing 0.04% (v / v) 6-BA, 0.05% (v / v) Silwet L-77, and 5% (w / v) sucrose to obtain an infection solution with OD 600 = 0.8.

[0057] Invert the Arabidopsis thaliana flower buds into the infection solution for 1 min, and treat them twice with an interval of 5 days; cover the infected Arabidopsis thaliana with a black fresh-keeping bag, perform dark treatment at 22 °C for 24 h, then remove the bag and start normal cultivation until collecting Arabidopsis thaliana seeds.

[0058] After disinfecting and washing Arabidopsis thaliana seeds with 75% (v / v) absolute ethanol and sterile water, place them on 100 mL of 1 / 2 MS liquid medium containing 60 μL of 50 mg / mL Hyg. Place them in a 4 °C refrigerator for 3 days and culture them at 22 °C with a 16 h / 8 h photoperiod for 10 days, then observe the germination and growth of T3 generation plants, as shown in Figure 4 . Figure 4 Among them, Tsl4 and Tsl6 are two overexpression plants.

[0059] 7. Identification of HBP3 in overexpression plants.

[0060] Extract the total DNA of wild-type plants and overexpression plants using the small-scale CTAB method. Using it as a template, amplify HBP3, and detect the transformation of HBP3 by agarose gel electrophoresis. Use ddH2O as a blank control and wild-type as a negative control to identify positive overexpression plants. The electrophoresis results show that no target bands were detected in the ddH2O and WT samples, and HBP3 was identified in Tsl-4 and Tsl-6. The results are shown in Figure 5 .

[0061] 8. Evaluation of salt tolerance ability of overexpression plants.

[0062] On the ultra-clean workbench, use a pipette to suck an appropriate amount of sterile water to moisten the surface of the culture medium. Use a pipette to place the disinfected seeds of WT, Tsl-4, and Tsl-6 on the 1 / 2MS culture medium one by one, maintaining an appropriate spacing. After placing all the seeds, gently adjust the positions of the seeds with sterile forceps to ensure their even distribution. Wrap the culture dish with sealing film to prevent microbial contamination from the air while maintaining humidity. Use a marker pen to mark the types of seeds on the sealing film. Place the above culture dishes containing seeds in a 4°C refrigerator for dark reaction for three days.

[0063] Cultivation and observation: After three days, take the culture dishes out of the refrigerator and place them in an incubator for continued cultivation. After one week, observe whether Arabidopsis seedlings have grown. Carefully check the growth status of the seedlings using a magnifying glass or microscope.

[0064] After the germination of sterile seedlings, select Arabidopsis seedlings with similar growth status and size, and then perform salt stress treatment on them. Prepare a 200 mmol / L NaCl solution, and use forceps to gently place the selected Arabidopsis seedlings into the NaCl solution to ensure that the seedlings are completely immersed in the solution. The NaCl solution is treated for 7 days, and the leaf changes and death numbers of the seedlings in the NaCl solution are observed, photographed, statistically recorded, and analyzed in real time. At the same time, Arabidopsis seedlings without salt stress treatment are used as the control group. In the control group, neither WT nor the two overexpressing plants showed obvious changes or differences. On the 7th day after treatment with 200 mmol / L NaCl solution, the WT plants were almost completely albino, chlorophyll-losing and dead; while the overexpressing plants Tsl-4 and Tsl-6 both showed a relatively high survival level, with no obvious chlorophyll loss in the leaves, showing a significant difference from WT, as shown in Figure 6 。

[0065] 9. Survival rate of overexpressing plants.

[0066] After salt stress, a differential analysis was performed on the survival amounts of wild-type plants and overexpressing plants, and it was found that the survival rate of overexpressing plants was significantly higher than that of wild-type plants after the same salt stress, indicating that overexpression of HBP3 can significantly improve the salt tolerance of Arabidopsis plants. The results are shown in Figure 7 。

[0067] 10. Expression levels of endogenous genes ABA1 and ABA2 in transgenic plants.

[0068] It is known that in wild-type Arabidopsis, the ABA1 gene encodes zeaxanthin epoxidase; the ABA2 gene encodes short-chain dehydrogenase, and both are involved in the ABA biosynthesis pathway. If ABA1 and ABA2 are inactivated or their expression is reduced, the salt sensitivity of the plants will be decreased.

[0069] Total RNA was extracted from wild-type plants and overexpressing plant seedlings that had grown for 10 days under the same conditions, and qRT-PCR was performed using Actin as an internal reference and wild-type plants as control samples. The results showed that the expression of two ABA-related genes, ABA1 and ABA2, in Tsl-4 and Tsl-6 was downregulated, indicating that overexpression of HBP3 can directly or indirectly inhibit the abscisic acid synthesis signal, thereby enhancing the salt tolerance of plants.

[0070] The technical features of the above-described embodiments can be combined arbitrarily. For the sake of brevity of description, not all possible combinations of the technical features in the above-described embodiments are described. However, as long as there is no contradiction in the combination of these technical features, it should be considered as the scope described in this specification.

[0071] The above-described embodiments merely represent several implementation manners of the present invention, and the description thereof is relatively specific and detailed. However, it should not be construed as a limitation to the scope of the invention patent. It should be noted that for those of ordinary skill in the art, without departing from the concept of the present invention, several modifications and improvements can be made, and these all belong to the protection scope of the present invention.

Claims

1. An HBP3 for improving plant salt tolerance, characterized in that, The nucleotide sequence of the said HBP3 is as shown in SEQ ID NO.3, and the amino acid sequence is as shown in SEQ ID NO.

4.

2. The application of HBP3 according to claim 1, characterized in that, Overexpression plants are prepared by constructing a recombinant overexpression vector of the said HBP3 to improve the salt tolerance of plants.

3. The application according to claim 2, characterized in that, The method for preparing the said recombinant overexpression vector comprises the following steps: Extract rice RNA, reverse transcribe it into cDNA, and amplify HBP3 using the cDNA as a template; Digest the overexpression vector with enzymes; Ligate HBP3 with the digested overexpression vector to obtain a recombinant overexpression vector.

4. The application according to claim 3, characterized in that The said overexpression vector is pCXSN.

5. The application according to claim 3, wherein When digesting the overexpression vector with enzymes, the restriction endonuclease used is XcmI.

6. The application according to claim 3, characterized in that The method for constructing the said overexpression plants is as follows: Transform the said recombinant overexpression vector into Agrobacterium competent cells; Perform enlarged culture to prepare an infection solution; Use the infection solution to infect wild-type plants, and culture them to obtain overexpression plants.

7. The application according to claim 6, characterized in that, The said Agrobacterium competent cells are EHA105.

8. The application according to claim 6, characterized in that The conditions for the said enlarged culture are culturing at 28 °C and 190 rpm for 24 h.

9. The application according to claim 6, wherein The OD of the infection solution 600 value is 0.

8.

10. The application according to claim 6, characterized in that, When using the infection solution to infect wild-type plants, the conditions for the infection are: The infection time is 1 min, and the co-infection is performed twice with an interval of 5 d between the two infections.

Images